Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Developmental Biology

Die Induktion von mesenchymalen-Epithelial Transitions in Sarcomzellen

doi: 10.3791/55520 Published: April 7, 2017

ERRATUM NOTICE

Summary

Wir stellen hier ein Zellkulturverfahren für die auf Basis von kombinierten ektopische Expression von microRNA-200 Familienmitgliedern und grainyhead-like 2 (GRHL2) mesenchymale-epithelialen Transitionen (MET) in Sarkomzellen zu induzieren. Dieses Verfahren ist für eine besseren geeignet, die biologische Wirkung der phänotypischen Plastizität auf Krebs Aggressivität und Behandlungen zu verstehen.

Abstract

Phänotypische Plastizität bezieht sich auf ein Phänomen, bei dem Zellen, die transient Züge eines anderen Abstammungslinie gewinnen. Während Karzinom Progression treibt phänotypische Plastizität Invasion, Verbreitung und Metastasierung. Tatsächlich, während die meisten Studien der phänotypischen Plastizität im Zusammenhang mit der epithelialen abgeleiteten Karzinome waren, stellt sich Sarkome aus, die mesenchymalen Ursprungs sind, auch phänotypische Plastizität aufweisen, mit einer Teilmenge von Sarkomen ein Phänomen unterziehen, die eine mesenchymal- ähnelt epithelial Übergang (MET). Hier entwickeln wir ein Verfahren mit der ich-200-Familie und grainyhead-like 2 (GRHL2) diese MET-Phänomene wie in Sarkom Patienten beobachtet samples.we nachzuahmen sequentiell GRHL2 exprimieren und die ich-200-Familie unter Verwendung von Zell-Transduktion und Transfektion bzw. zu verstehen, um besser auf die molekularen Grundlagen dieser phänotypischen Übergänge in Sarcomzellen. Sarcoma-Zellen, ich-200s und GRHL2 demonstrierten verbesserten epithelialen characteristICs in der Zellmorphologie und den Umbau von epithelialen und mesenchymalen Biomarker. Zukünftige Studien mit Hilfe dieser Methoden können besser genutzt werden, um die phänotypischen Folgen der MET-ähnlicher Prozesse auf Sarkom-Zellen zu verstehen, wie Migration, Invasion, metastasierendem Neigung und Therapieresistenz.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Phänotypische Plastizität bezieht sich auf einen reversible Übergang zwischen zellulären Phänotypen, und wird allgemein in zwei Typen unterteilt, epithelial-to-mesenchymalen (EMT) Transitionen und mesenchymalen-to-epithelialen Transitionen (MET). Diese phänotypische Plastizität spielt eine wichtige Rolle bei der normalen Prozessen mehrzelliger Organismen, wie Entwicklung und Wundheilung 1; jedoch können dieselben Wege und Genexpressionsprogramme auch zu Krankheiten führen, wie Fibrose ( beschrieben in 2, 3, 4) und Karzinom - Metastasen (rezensiert in Referenzen 5, 6, 7, 8). Während Metastasierung zum Beispiel stört EMT Zellpolarität, Zell-Zell - Wechselwirkungen und fördert Invasion 9, 10. Zusammen EMT beitragens zu einem phänotypischen Zustand, dass Krebszellen Verbreitung erleichtert. Außerdem führt EMT auch mit vielen anderen phänotypischen Veränderungen , die einen aggressiven Phänotyp treiben, einschließlich der Deregulierung von Krebszellmetabolismus 6, der Entwicklung der Arzneimittelresistenz 11, 12, erhöhte Tumor-Initiierungsfähigkeit 13, 14 und Host Immunevasion 15.

Phänotypische Plastizität wurde in Karzinom Progression gut untersucht; zeigen jedoch Sarkome auch phänotypische Plastizität. Interessanterweise scheint es, als ob einige der gleichen Treiber der phänotypischen Plastizität bei Karzinomen auch Sarkom Plastizität und Aggressivität beitragen. Zum Beispiel zirkulierende Tumorzellen (CTCs) von Sarkom - Patienten wurden EpCAM, ein Zelloberflächenprotein exprimieren gezeigt , die typischerweise auf epithelialen Zellen 16 zu finden ist. Additional wurden 250 Weichteilsarkom Proben als Epithel-ähnlichen oder mesenchymalen artigen basierend auf Genexpression kategorisiert. Den Patienten in der Epithel-ähnlichen Biomarker Unterschrift hatten eine bessere Prognose als Patienten mit der mesenchymalen ähnlichen Biomarkers Signatur 17. Dies steht im Einklang mit vielen Karzinomen, in denen Patienten mit Epithel-ähnlichen Karzinome haben bessere Ergebnisse im Vergleich zu Patienten mit mesenchymalen artigen Tumoren 18.

Während einige Sarkome Biomarker und Genexpression Wege im Einklang mit MET, die molekularen Grundlagen dieser phänotypischen Plastizität zeigen noch schwer abzuschätzen. Um die Mechanismen und Fahrer von MET in Sarkom zu studieren wir ein Modell der MET Induktion entwickeln unter Verwendung von zwei epithelialen spezifischen Faktoren, die microRNA (du) -200 Familie und grainyhead-like 2 (GRHL2). Der miR-200s ist eine Familie von kleinem nicht-kodierenden RNAs, die die Genexpression regulieren, indem sie an den 3'-UTRs der Bindung messenger RNA und verhindert Übersetzung in ein Protein. Die miR-200-Familie besteht aus zwei Untergruppen - eines enthält, miR-141 und miR-200a, und das andere darunter miR-200b, miR-200c, miR-429 und. Mitglieder der ich-200 - Familie werden in epithelialen Geweben angereichert, und der Verlust von miR-200s ist mit Metastase in Karzinomen 19 verbunden. Die ich-200 - Familie ist auch in Weichteilsarkomen im Vergleich zu normalen Gewebe 20 nach unten reguliert. Ähnlich den miR-200s ist GRHL2 ein Schlüsselregulator für die Entwicklung epithelialer 21 wichtig ist. Der GRHL2 Transkriptionsfaktor wirkt auf zwei Arten epitheliale Gene, wie E-Cadherin hochzuregulieren: 1) in Epithelzellen, GRHL2 reprimiert direkt der EMT Master - Regulator, ZEB1 22; und 2) GRHL2 aktiviert direkt die Transkription von Genen epithelialer 23. Unsere bisherigen Untersuchungen haben gezeigt, dass die kombinierte Expression von miR-200s und GRHL2 in Sarcomzelleninduziert einen MET-ähnlichen Phänotyp 24. Hier stellen wir ein detailliertes Protokoll ein in vitro - Modell der MET - Induktion in Sarkomzellen Verwendung ektopische Expression von miR-200s und GRHL2 zu schaffen.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Vorbereitung der Reagenzien

  1. Bereiten DMEM für Zellkultur durch Zugabe von 50 ml fötalen Rinderserum (FBS) und 5 ml Penicillin-Streptomycin (5000 U / ml) zu 500 ml DMEM. Dieses Medium kann für bis zu sechs Monate bei 4 ° C gelagert werden.
  2. Resuspendieren lyophilisierte Primer in Nuklease-freies Wasser bis zu einer Endkonzentration von 10 uM. Store resuspendierten Primer bei -20 ° C.
  3. Bereiten Radioimmunpräzipitation-Assay (RIPA) -Puffer (150 mM NaCl, 0,5% Natriumdesoxycholat, 0,1% SDS, 50 mM Tris, pH 8,0). Ergänzung mit Protease-Inhibitor-Cocktail vor dem Gebrauch und halte Puffer auf Eis, wenn im Einsatz. Lagerung bei 4 ° C.
  4. Bereiten 10 mg / ml Polybren (Hexadimethrinbromid) in Wasser und Spritzenfilter zu sterilisieren einen 0,45 um Polyethersulfon-Filter. Lösung kann bis zu sechs Monate bei 4 ° C gelagert werden.
  5. Bereiten eine 1 mg / ml Arbeitslösung von Nitroblautetrazoliumchlorid von 10 mg in 10 ml PBS aufgelöst. Lagerung bei 4 ° C.

2. Lentivirale Transduktion von GRHL2

Tag 1

  1. Platte 3 x 10 5 HEK293T Zellen pro Vertiefung einer Platte mit 6 Vertiefungen in 2 ml DMEM , ergänzt. Beziffern Zellen eines automatisierten Zellzähler verwendet wird. Mit 5% CO 2 bei 37 ° C nach der Übernachtkultur 60% konfluent - Zellen sollten 40 sein.

Tag 2

  1. Verdünnte 2 ug leeren Vektor (pCMV-UBC-EGFP) oder 2 & mgr; g pCMV-GRHL2-UBC-EGFP 24, 25 in 200 ul serumfreiem Medium zusammen mit 1,8 ug pΔ8.9 und 0,2 ug pCMV-VSV -G Helferplasmiden. In einem separaten Röhrchen, verdünne 4 ul einer lipidbasierten Transfektionsreagenz in 200 ul serumfreiem Medium pro Transfektion (8 & mgr; l in 400 & mgr; L für zwei Proben). Füge 200 & mgr; l Transfektionsreagenz Mischung zu jeder Plasmid-Lösung und Inkubation für 20 min bei Raumtemperatur.
  2. Während der Incubation, HEK293T-Zellen waschen, indem das Medium durch Vakuumabsaugung entfernt und die Zellen mit 1 ml PBS gespült. Ersetzen Sie die PBS mit 800 & mgr; l Serum-freien Medien. Nach 20 min, 200 & mgr; l Transfektionsreagenz: Plasmid - Mischung aus Schritt 2.2 tropfenweise zu jedem Well und Inkubieren Zellen für 2 h bei 37 ° C in 5% CO 2.
  3. Sorgfältig Transfektionsmedium durch Vakuumabsaugung entfernen, und mit 2 ml DMEM, ergänzt ersetzen. Bringen Sie die Zellen in den Inkubator für Nachtkultur.
    HINWEIS: HEK293T-Zellen sind lose anhaftende. Medienwechsel muss mit Vorsicht durchgeführt werden, die Entfernung von Zellen aus dem Boden der Schale oder Kolben zu begrenzen.

Tag 3

  1. Aktualisieren Medien auf transfizierten HEK293T - Zellen und Platte 3 x 10 5 RD Zellen pro Vertiefung einer Platte mit 6 Vertiefungen in 2 ml DMEM , ergänzt. Kulturzellen über Nacht. RD-Zellen sind eine im Handel erhältliche menschliche Rhabdomyosarkom-Zelllinie.

Tag 4

  • Sammeln virale Medien aus HEK293T-Zellen. Pipette, um die Medien aus den DMEM HEK293T-Zellen und in einen neuen konischen 15 ml. ersetzen Sie vorsichtig mit neuen DMEM-Medium und Ort HEK293T Zellen zurück in den Inkubator für den nächsten Tag.
  • Fügen Sie 2 ul 10 mg / ml Polybren pro ml Viren Medien in zwei neue 50 ml konischen Röhrchen (ein für den leeren Vektor Transfektion und eine andere für die GRHL2 Transfektion). Spritzenfilter viraler Medien durch den Kolben aus einer 3 ml-Spritze zu entfernen und ein 0,45 um-Polyethersulfonmembran Filter an der Spitze befestigen.
    1. Fügen Sie die viralen gesammelten Medien in Schritt 2.6 in den Zylinder der Spritze, und tauchen in die neuen Medien 50 ml konischen Röhrchen mit Polybren. Entfernen Sie das Medium von RD-Zellen durch Vakuum-Aspiration und fügen gefiltert virale Medien RD-Zellen.
  • Tag 5

    1. Wiederholen Tag 4. HEK293T Zellen können verworfen werden, nachdem die viralen Medien gesammelt worden ist.

    Tag 7

    1. Wash RD Zellen mit 1 ml PBS und mit 200 & mgr; l von 0,05% Trypsin pro Vertiefung. Inkubieren bei 37 ° C für 5 min, 2 ml des ergänzten Medium und die Zellsuspension auf eine neue 15 ml konischen bewegen. Centrifuge Zellen bei 250 g für 5 Minuten bei Raumtemperatur und absaugen Medien. Resuspendieren in 1 ml DMEM (mit 5% FBS und 1% Penicillin-Streptomycin).
      HINWEIS: einen höheren Anteil an FBS verwenden, kann dazu führen, während der Durchflusszytometrie Verstopfung
      1. Filterzellen für die Durchflusszytometrie. Verwenden einer Pipette 1 ml der RD-Zellsuspension durch ein 30 um-Filter in der Durchflusszytometrie Rohre und Ort Röhrchen auf Eis anzuwenden.
      2. Sortieren EGFP + 26 - Zellen in 1,5 ml Mikrozentrifugenröhrchen 0,5 ml DMEM , das mit 10% FBS und 1% Penicillin-Streptomycin und auf Eis. Platte EGFP + Zellen in insgesamt 1 ml DMEM, ergänzt zu einem einzelnen Well einer 12-Well-Platte und in den Inkubator für Kultur sortiert.
        , Anmerkung: Die Ausbeute an EGFP + Zellen aus der Durchflusszytometrie nach dieser Transduktion ist in der Regel niedrig (50.000-100.000 Zellen). Die Zellen müssen für 10 kultiviert werden - 14 Tage vor dem Fortfahren zu Schritt 3.

    3. Reverse Transfektion von miR-200s

    1. Bereiten 50 uM Bestände von miR-200 unter Verwendung von Mimetika Nuklease-freien H 2 O. Aliquot Aktien und bei -20 ° C wiederholten Einfrier / Auftau - Zyklen zu vermeiden.
    2. Fügen 3 ul jeden 50 & mgr; M ich-200 mimic (du-200a, ich-200b und ich-200c) und 300 & mgr; l serumfreien Medien oder 9 ul 50 uM negative Kontrolle miRNA bis 300 & mgr; l serumfreien Medien.
    3. Fügen 6 ul von siRNA-spezifischen Transfektionsreagenz bis 600 & mgr; l serumfreien Medien und dividieren 300 ul dieser Mischung in zwei Rohre, eines für jeden der beiden miR Mischungen aus Schritt 3.2. Vereinige den 300 & mgr; l jede ich Mischung aus Schritt 3.2 mit einer Mischung aus 300 ul Transfektionsreagenz. Inkubieren für 20 Minuten bei Raum temperatur.
    4. eine Zellsuspension von 600.000 EGFP exprimierenden Zellen + RD EV oder GRHL2 in Abschnitt 2 in 2,4 ml erstellt (250 Zellen / ul) von serumfreiem Medium pro Behandlung während Inkubieren vorzubereiten.
    5. In einer 24-Well-Platte, 100 & mgr; l pro Well von miR-200 Mischung oder negative Kontrollmischung aus Schritt 3.3 in sechs Vertiefungen, und dann wurden 400 & mgr; l jeder Zellsuspension in drei Vertiefungen jeder miR Mischung hinzufügen.
    6. Inkubiere Zellen bei 37 ° C in 5% CO 2 über Nacht und Medien ändern , um vollständig DMEM am folgenden Tag ergänzt. Collect Zellen 2 Tage später für die Analyse geeignete Puffer (siehe unten). Zeitraffer-Imaging von RD Sarcomzellen MET laufen ist als ergänzendes Material zur Verfügung. Bild jede Vertiefung je 2 h mit einem 10X - Objektiv mit einer automatischen lebenden Zellen Imager 27.

    4. RNA-Extraktion, reverse Transkription und qPCR

    1. Extrahieren von RNA nach Herstellerangaben unter Verwendung eines Standard-RNAExtraction Kit 24. Extrahierte RNA kann bei -80 ° C gelagert werden.
    2. Quantifizieren RNA-Konzentration. Auftauen und die Arbeit mit RNA auf Eis. Um RNA-Konzentrationen messen UV-Absorption bei 260 nm mit einem Plattenleser-Spektrophotometer gemäß dem Protokoll des Herstellers quantifiziert. Verdünnte Proben alle auf die niedrigste Konzentration mit Nuklease-freien Wasser.
    3. Führen reverse Transkription von Gesamt-RNA in komplementäre DNA (cDNA). Kombinieren nicht weniger als 100 ng Gesamt - RNA mit PCR - Puffer, dNTP - Mix (100 mM), Random - Hexamer - Primer, reverse Transkriptase und Nuklease-freies Wasser in einem 20 ul Reaktionsvolumen 24. Führen RT Zyklen nach Protokoll des Herstellers. cDNA kann langfristig bei -20 ° C gelagert werden.
    4. Verdünne 20 & mgr; l Reaktionen auf 100 & mgr; l mit 80 & mgr; l Nuklease-freien H 2 O.
    5. Mix 5 & mgr; l eines fluoreszenzbasierten interkalierenden Farbstoff 2x qPCR Master Mix, 0,06 & mgr; l je 10 & mgr; M Primer, and 2 ul der verdünnten RT-Reaktion pro Probe.
    6. Run qPCR nach Herstellerprotokoll für die Fluoreszenz-basierten Master-Mix.
    7. Quantifizierung relative Mengen von mRNA durch das delta CT-Verfahren und normalisieren, um GAPDH. Zeichnen Sie die mittlere mRNA-Expression von biologischen Replikaten ± Standardabweichung für jede Behandlungsgruppe.
      HINWEIS: Besondere Vorsichtsmaßnahmen ergriffen werden sollten, wenn sie mit RNA Arbeitskontakt mit RNasen zu vermeiden, wie RNase-freie Kunststoffe und Reagenzien. Nicht-Einweg-Geräte sollten vor der Verwendung behandelt werden RNasen zu entfernen.

    5. Immunfluoreszenzanfärbung

    1. Nach dem Schritt 3.6, absaugen Medien durch Vakuumabsaugung von RD-Zellen in 24-Well-Format.
    2. Fix-Zellen durch Zugabe von 500 ul 4% Paraformaldehyd (PFA) pro Vertiefung und Inkubation für 15 min bei Raumtemperatur (RT). Nach der Fixierung statt Zellen in Phosphat-gepufferter Salzlösung (PBS) und bei 4 ° C über Nacht, falls notwendig.
    3. PermeabilisierungZellen, die durch Zugabe von 500 & mgr; l PBS + 0,2% Triton-X100 und 30 min bei RT inkubiert. Durch Vakuum-Aspiration, Permeabilisierung Puffer und wasche dreimal mit PBS entfernen.
    4. Block in 500 ul 5% Rinderserumalbumin (BSA) / PBS und Inkubieren Zellen für 30 min bei RT. Die Zellen können bei 4 ° C über Nacht bei Bedarf gespeichert werden.
    5. Bereiten primäre Antikörperverdünnung. Pipette 200 ul 5% BSA / PBS pro Napf in ein konisches 15 ml (12 Wells = 2,4 ml) gelöst und 1 & mgr; l des primären Antikörpers pro ml 5% BSA / PBS benötigt. Entfernen Blockierungspuffer durch Vakuum Aspiration und Abgabe 200 ul verdünnten primären Antikörpers in jede Vertiefung.
      1. Inkubiere Zellen in 1: 1.000 verdünnten Primärantikörper in 5% BSA / PBS für 1 h bei RT oder über Nacht bei 4 ° C. Nach der Inkubation, Waschen Zellen zweimal mit PBS.
    6. Vorbereiten der sekundäre Antikörperverdünnung in dem gleichen Volumen von 5% BSA / PBS, wie oben. Fügen Sie den fernen roten Farbstoff-konjugiertem sekundären Antikörper unter Verwendung einer 1: 2.000-Verdünnung. zusätzlich hinzufügen1 & mgr; g / ml Hoechst Farbstoff zu der Mischung. Entfernen Sie die PBS und fügen Sie zu jeder Vertiefung 200 & mgr; l der Mischung.
      1. 1 h im Dunkeln bei RT inkubieren. Waschen 3 mal mit PBS, läßt die Zellen in PBS und schützt die Zellen vor Licht mittels Folie. Die Zellen können bei 4 ° C bei Bedarf gespeichert werden.
    7. Bildzellen bei 400-facher Gesamtvergrößerung auf einem invertierten Epifluoreszenzmikroskop mit Anregungswellenlänge von 594 bis 650 nm.

    6. Western Blotting

    1. Wash-Zellen von 3,6 zweimal mit eiskaltem PBS. Auf Eis lysieren Zellen mit 50 & mgr; l 1x RIPA mit 1x Protease-Inhibitor-Cocktail ergänzt Puffern.
    2. Rock Lysate bei 4 ° C für 15 min, sammelt Lysate in 1,5-ml-Röhrchen und zentrifugiert bei hohen Geschwindigkeit (20,000 · g) für 5 min Proben zu klären. Zelllysate kann langfristig bei -80 ° C bei Bedarf gespeichert werden.
    3. Quantifizieren von Gesamt-Protein mit einer Bradford-Assay unter Verwendung und eine gleiche Menge an Protein in neue 1,5 ml-Mikrozentrifugenröhrchen aliquotiert. Bring Proben gleiche Volumen mit 2-Mercaptoethanol unter Verwendung von RIPA-Puffer und 3 × Laemmli-Ladepuffer ergänzt.
    4. Inkubieren Proben in 1x Laemmli-Probenladepuffer für 5 min bei 95 ° C und führen SDS-PAGE ein 4-12% Tris-Glycin-Gel bei 200 V unter Verwendung von 45 min. Die Menge an Protein geladen Bereiche in Abhängigkeit von der Zelllinie. In manchen Fällen ist ein 50 bis 100 & mgr; g Gesamtprotein benötigt E-Cadherin in mesenchymalen Zelllinien zu erkennen.
    5. Transfer Proteine ​​auf einen Nitrocellulose-Membran 2 h bei 50 V in 1 × Tris-Glycin-Transferpuffer.
    6. Block Membran für 1 h bei Raumtemperatur oder über Nacht bei 4 ° C in einem BSA-Basis Blockierungspuffern.
    7. Verdünnte primären Antikörper bei 1: 1000-Konzentration in 5 ml Blockierungspuffern, fügt Verdünnung auf die Membran, und Inkubieren unter sanftem für 1 h bei Raumtemperatur schaukelt oder über Nacht bei 4 ° C. Wasch Membran 3 mal in PBS mit 0,05% Tween-20.
    8. Inkubieren Membranen 1 h bei RT mit Infrarot-Fluoreszenzgekoppelten NEBENTy-Antikörper bei 1: 20.000-Verdünnung in Puffer wie oben blockiert.
    9. Waschen Membran zweimal in PBS mit 0,05% Tween-20 und dann einmal in PBS.
    10. Bild Membran unter Verwendung von Standard Infrarot-Fluoreszenz-Detektion.

    7. Anchorage-unabhängiges Wachstum Assays

    HINWEIS: Für ein detailliertes Weichagarassay Protokoll, 28 zu sehen.

    1. Warm steriles 2x DMEM-Medium auf 42 ° C in heißem Wasserbad. Während dieser Zeit wird Wärme 1% Agarose in der Mikrowelle für 3 min vorautoklavierten. Mikrowellen für weitere 30 s in einer Zeit nach Bedarf oder bis sie vollständig geschmolzen. Bewegen Agarose zu einem 42 ° C Wasserbad.
    2. Legen Sie ein 50 ml konischen Röhrchen in einem Becherglas mit 42 ° C Wasser in einer sterilen Haube und mischen 1% Agarose und 2x DMEM-Medium in einer 1: 1-Verhältnis Bilanzierung von 1,5 ml Gemisch pro Vertiefung in einer Platte mit 6 Vertiefungen. Immer bereiten zusätzliche DMEM / Agarose zum Pipettieren Fehler zu berücksichtigen und Blasen zu vermeiden.
    3. In Mischung auf dieSeiten des Brunnens, um sicherzustellen, keine Blasen bilden, und lassen Sie sich für 30 min bei RT stehen.
    4. Während die untere Schicht zu verfestigen, bereitet transfiziert jede Gruppe von RD-Zellen in Schritt 3 durch Waschen Medien und einmal mit 1 ml PBS abgesaugt. Aspirat PBS und mit 0,2 ml 0,05% Trypsin und Inkubation bei 37 ° C für 5 min.
    5. Neutralisieren Trypsin in 0,8 ml Medium und verreiben Zellen eine Einzelzellsuspension zu bilden. Übertragen Zellsuspension in ein 15 ml konischen Röhrchen.
    6. Zählen von Zellen und Berechnen Volumen der Zellsuspension, die für 10.000 Zellen pro Vertiefung.
    7. Erhitzt von 0,6% Agarose in der Mikrowelle für 3 min, gefolgt von 30 s in einer Zeit, bis sie vollständig geschmolzen. Bewegen Sie Agarose auf 42 ° C Wasserbad.
    8. Legen Sie ein 50 ml konischen Röhrchen in einem Becherglas mit 42 ° C Wasser in einer sterilen Haube. Mische 0,6% Agarose und verdünnte Zellsuspension in einem Verhältnis 1: 1 1,5 ml Mischung in einer Platte mit 6 Vertiefungen pro Vertiefung herzustellen. Immer vorbereitet zusätzliche Zellsuspension / Agarose mischen zum Pipettieren Fehler zu berücksichtigen undzu vermeiden Blasen.
      HINWEIS: Es ist wichtig, bei 42 ° C, hier zu arbeiten. Wenn die Temperatur zu niedrig ist, wird die Mischung vor dem Plattieren verfestigen, und Temperaturen über 42 ° C werden die Lebensfähigkeit der Zellen beeinflussen.
    9. Gut mischen durch Verreiben Zellen mehrmals und fügen Zellgemisch in die Vertiefungen, um sicherzustellen, keine Blasen bilden, und lassen Sie sich für 20 min bei RT erstarren.
    10. In 2 ml ergänzten Medium zu jeder Vertiefung und bewegen Platten Inkubator.
      1. Ändern Medien einmal pro Woche für 3-4 Wochen oder bis vielzellige Kolonien bilden. Achten Sie darauf, Berühren der Agar zu vermeiden, wenn Medien durch Absaugung entfernt wird. Alternativ dazu verwenden, um eine P1000 die oberste Schicht der flüssigen Medien zu entfernen.
      2. Beflecken Weichagarplatten durch Zugabe von 200 & mgr; L Nitroblautetrazoliumchlorid-Lösung (1 mg / ml in PBS) und Inkubieren der Platte über Nacht bei 37 ° C. Ersetzen Medien am nächsten Tag mit PBS für die Bildgebung.
      3. Bild Vertiefungen bei 40-facher Gesamtvergrößerung auf einem inversen Mikroskop.
      4. Führen Sie Analyse auf ImageJ für Koloniefläche und Zahl. Plot bedeuten Koloniezahl der biologischen Replikaten ± Standardabweichung.

    Subscription Required. Please recommend JoVE to your librarian.

    Representative Results

    or Start trial to access full content. Learn more about your institution’s access to JoVE content here

    Schema für MET Induktion in Sarkomzellen

    Eine allgemeine Zeitleiste für die Induktion von MET artigen Veränderungen in Sarkomzellen ist in Abbildung 1 dargestellt. Das Protokoll beginnt mit GRHL2 (Abbildung 1A), gefolgt von Transfektion der miR-200 - Familie (Abbildung 1B) Umwandlungs. GRHL2 oder ich-200 Familienmitglieder waren nicht in der Lage das Auftreten von RD-Zellen zu beeinflussen, wenn sie allein ausgedrückt, aber ektopische Expression von GRHL2 und ich-200 zusammen Ergebnissen in Epithel-ähnlichen morphologischen Veränderungen in RD Zellen. Zellen Übergang von einer spindelförmigen Form zu einer abgerundeten Aussehen mit erhöhten Zell-Zell - Kontakt (1C).

    Die Induktion von MET-ähnlichen Veränderungen in Sarcomzellen

    Die morphologische Veränderung in RD Zellen nach GRHL2 und ich-200Überexpression wurde durch Heraufregulation der epithelialen Marker E-Cadherin (2A) begleitet. Zugabe von miR-200s aufreguliert E-Cadherin allein, sondern in Kombination miR-200s und GRHL2 Überexprimierung synergistisch verstärkte E-Cadherin - Expression (Figur 2A; nicht maßstabs log). Darüber hinaus gab es einen Anstieg an Zell-Zell - Junctions von epithelialen Adhäsionsmoleküle, EpCAM und TJP1, weißen Pfeilen (auch bekannt zona occludens 1, ZO-1) (2B).

    MET Induktion verringert die Koloniebildung Fähigkeit von Sarkomzellen

    Heraufregulierung von epithelialen Proteinen wurde durch Herunterregulierung von mesenchymalen Genen ZEB1 und Notch1 (3A) begleitet, die Ziele für mich-200 bekannt sind. Induktion von MET reduzierte das verankerungsunabhängigem Wachstum von RD - Zellen , wie durch Koloniezahl (3B) gemessen. diese groWth Inhibition wurde von miR-200s allein angetrieben wird; als die Überexpression von GRHL2 führte zu einer Erhöhung der verankerungsunabhängige Wachstum (Abbildung 3). Dies steht im Einklang mit früheren Berichten zeigen GRHL2 Expression induziert Verankerung unabhängige Wachstum 22.

    Abbildung 1
    Abbildung 1: Zeitleiste des MET Induction mit GRHL2 Überexpression und ich-200 Transfection. (A) Zeitleiste von ektopischen Überexpression von GRHL2 in Zielzellen. (B) Zeitleiste der MET Induktion durch reverse Transfektion von miR-200 Familienmitgliedern in Zielzellen. (C) GRHL2 und du-200 - Überexpression führten zu Veränderungen in der Morphologie von Zielzellen , die mit MET. Maßstabsbalken = 75 & mgr; m Bitte klicken Sie hiereine größere Version dieser Figur zu sehen.

    Figur 2
    Abbildung 2: Die gleichzeitige Überexpression von GRHL2 und ich-200s Führte zu MET in Zielzellen. (A) Expression von miR-200 führte zu erhöhtem E-Cadherin - Expression während der kombinierten Expression von GRHL2 und ich-200s an einen synergistischen Effekt auf der E-Cadherin - Expression produzierte sowohl die mRNA (Mittelwert ± Standardabweichung) und Protein - Ebene. (B) kombinierte Expression von GRHL2 und ich-200 führte zu einem erhöhten Expression von EpCAM und TJP1 bei Zell-Zell - Kontakten (Pfeile). Maßstabsbalken = 20 um. * Zeigt p <0,05 unter Verwendung von ANOVA mit Tukey post-hoc correction.This Abbildung von Referenz modifiziert wurde 24 analysiert. Copyright © Amerikanische Gesellschaft für Mikrobiologie, Molekulare Zellbiologie, Band 36, Ausgabe 19, 2503-2513, 2016. Bitte klicken Sie hier , um eine größere Version dieser Figur zu sehen.

    Abbildung 3
    Abbildung 3: Expression von miR-200s Unterdrückt mesenchymalen Marker und Abnahmen Anchorage-unabhängiges Wachstum in Sarkom - Zellen. (A) - Überexpression von miR-200 , aber nicht GRHL2 gehemmt ZEB1 und Notch1 mRNA - Expression (Mittelwert ± Standardabweichung). (B) Überexpression von miR-200 , aber nicht GRHL2 inhibierten anoikis Widerstand in Sarkomzellen. Repräsentative Bilder von gefärbten Kolonien (Maßstabsbalken = 200 & mgr; m) und Quantifizierung der Koloniezahl (Mittelwert ± Standardabweichung) gezeigt. * Zeigt p <0,05 unter Verwendung von ANOVA mit Tukey post-hoc analysiert correction.This Figur wird von R verändert wurdebersicht 24. Copyright © Amerikanische Gesellschaft für Mikrobiologie, Molekulare Zellbiologie, Band 36, Ausgabe 19, 2503-2513, 2016. Bitte klicken Sie hier , um eine größere Version dieser Figur zu sehen.

    Abbildung 3
    Supplemental Video: RD Zellen leer Vektor und negative Kontrolle miRNAs Ausdruck zu bringen. Videos wurden von den Bildern von RD-Zellen, die mit leeren Vektor und negativer Kontrolle miRNAs erworben alle zwei Stunden unter Verwendung eines automatisierten Live-Zell-Imager zusammengestellt. Bitte klicken Sie hier , um dieses Video anzusehen. (Rechtsklick zum Download bereit .)

    Abbildung 3 />
    Supplemental Video 2: RD Zellen GRHL2-EGFP und Negativkontrolle miRNAs Ausdruck. Videos wurden von den Bildern von RD-Zellen, die mit GRHL2-EGFP und Negativkontrolle miRNAs erworben alle zwei Stunden unter Verwendung eines automatisierten Live-Zell-Imager zusammengestellt. Bitte klicken Sie hier , um dieses Video anzusehen. (Rechtsklick zum Download bereit .)

    Abbildung 3
    Supplemental Video 3: RD - Zellen, die leeren Vektor und miR200 miRNAs. Videos wurden von den Bildern von RD-Zellen, die mit leeren Vektor und miR200 miRNAs erworben alle zwei Stunden unter Verwendung eines automatisierten Live-Zell-Imager zusammengestellt. Bitte klicken Sie hier , um dieses Video anzusehen. (Rechtsklick zum Download bereit .)

    nt“fo: keep-together.within-page = "1"> Abbildung 3
    Supplemental Video 4: RD - Zellen, die GRHL2-EGFP und miR200 miRNAs. Videos wurden von den Bildern von RD-Zellen, die mit GRHL2-EGFP und miR200 miRNAs zusammengestellt erworben alle zwei Stunden eines automatisierten Live-Zell-Imager. Bitte klicken Sie hier , um dieses Video anzusehen. (Rechtsklick zum Download bereit .)

    Subscription Required. Please recommend JoVE to your librarian.

    Discussion

    or Start trial to access full content. Learn more about your institution’s access to JoVE content here

    Sarkome sind selten, aber sehr aggressive Krebsarten von einer mesenchymalen Abstammungslinie. Trotz ihrer mesenchymalen Abstammungslinie, wird eine Teilmenge von Sarkomen einen phänotypischen Übergang zu einem epithelial-ähnlichen Zustand zu unterziehen. Der MET-like - Schalter hat prognostische Relevanz, da Patienten mit Epithel-ähnlichen Tumoren sind weniger aggressiv 24. Trotz ihrer klinischen Relevanz, gibt es nur wenige Studien, die molekularen Mechanismen der Bewältigung dieser phänotypischen Übergänge in Sarkomen fahren.

    MET-Ähnliche Übergänge in Sarkom-Zellen zu untersuchen, haben wir ein MET-Induktionsmodell entwickelt, durch die Expression von epithelialen Faktoren GRHL2 Kombination und der miR-200-Familie. Dieses Verfahren induziert schnell Sarkomzellen mehr epithelial-ähnliche zu werden, wie durch Veränderungen in der Morphologie und die Genexpression gemessen. dieses Protokoll verwenden MET in Sarkom-Zellen zu induzieren erleichtert Studie über die Auswirkungen dieser Übergänge auf den Phänotypen, die Sarkom Aggressionen treiben, wieMigration, Invasion, Proliferation und Tod Widerstand und wie jede dieser Veränderungen in der Biologie Arzneimittelresistenz beeinflussen kann.

    Im Zusammenhang mit den epithelialen Karzinomen abgeleitetes, die Expression eines mesenchymalen Faktors ist oft ausreichend , EMT 14 zu induzieren. Jedoch wird in diesem sarcoma-derived Modell der MET die Expression von zwei epithelialen Faktoren, GRHL2 und ich-200, erforderlich. Interessanterweise hatte der miR-200s allein eine stärkere Wirkung auf den meisten von Biomarkern MET als GRHL2, während GRHL2 konnte robust epitheliale Gene nur in Gegenwart von miR-200-basierter Unterdrückung von epithelialem Repressoren Genen aktivieren, wie ZEB1 24. Es ist möglich , dass für einige mesenchymalen Zelltypen epitheliale Gene sowohl de-reprimiert (zB über mich-200s) und aktiviert (zB über GRHL2) sein müssen MET fahren.

    Wir haben über verschiedene cel in den Ebenen der GRHL2 Ausdruck Variation erfahrenl-Linien. Um dies zu überwinden, verwenden wir ein GRHL2 Expressionsplasmid , das 25 EGFP drückt auch mittels Durchflusszytometrie EGFP - positiven Zellen vor den Experimenten zu sortieren. Es ist auch wichtig, die Funktionalität von miR-200s und GRHL2 in verschiedenen Zelltypen zu validieren. EMT ist als mesenchymale-assoziierter Gene epithelialen und Spektrum betrachtet, basierend auf Expression die kontextabhängige Variation basierend auf Zelllinie, Krebsart, Behandlung, etc. Daher haben kann, untersuchten wir fünf Gene reguliert von miR-200 oder GRHL2 zu Konto für die Zellkontextabhängigen Veränderungen. Ein weiterer Nachteil dieses Assays ist das Vertrauen auf eine transiente Transfektion von miR-200s für MET Induktion. So können Langzeitexperimente kostspielig und kompliziert, wenn mehrere Wiederholungs Transfektionen notwendig werden. Dies kann durch Verwendung von miR-200-Expressionsplasmiden überwunden werden.

    Andere Studien haben auch Beweise für MET in Sarkomen. Zum Beispiel MET wurde in einer Untergruppe von leiomyosa beobachtetrcomas und wurde für Patienten mit einem besseren Überleben. Mechanistisch, Yang et al. festgestellt , dass 29 MET-ähnlichen Veränderungen zu induzieren in einer Leiomyosarkom Zellinie Hemmung des Slug mit siRNA ausreicht. Ebenso Abreicherung von noch einem anderen mesenchymalen Faktor, Schnecke, in mesenchymale Stammzellen bei Mäusen sarcoma Bildung 30 reduziert. Somit ist es klar aus der Literatur, dass es mehrere Wege zu einem MET-ähnlichen Phänotyp, die durch Zelltyp variieren kann. Zwar ist dies nicht der einzige Weg ist, MET zu induzieren, haben wir unsere Methode zu induzieren MET in zwei Sarkom-Subtypen, einschließlich Rhabdomyosarkom (RD-Zellen) und Osteosarkom (143B-Zellen) verwendet. In Zukunft wäre es interessant, diese verschiedenen Methoden in einem breiteren Bereich von Sarkom-Zellen zu vergleichen. Zum Beispiel haben bestimmte Sarkom-Subtypen zugrunde liegende genetische oder epigenetischen Veränderungen, die sie mehr oder weniger anfällig für MET Induktion machen?

    Die Ermittlung der Auswirkungen der METauf einer Vielzahl von biologischen Ausgaben in Sarkomen Zellen könnte ein besseres Verständnis dafür, warum Patienten mit Epithel-ähnlichen Sarkome eine verbesserte Prognose liefern. Darüber hinaus das Verständnis der Auswirkungen der Behandlung auf die phänotypischen Übergänge zwischen Zuständen fahren würde unser biologisches Verständnis vertiefen und auf Reaktion auf die aktuellen Therapien in Sarkom-Patienten zu informieren.

    Subscription Required. Please recommend JoVE to your librarian.

    Disclosures

    Die Autoren haben nichts zu offenbaren.

    Acknowledgments

    JA erkennt an Unterstützung von dem Duke Cancer Institute, The Duke University Genitourinary Oncology Laboratory, und die Duke University Abteilung für Orthopädie. HL wurde von der National Science Foundation (NSF) Zentrum für Theoretische Biologische Physik (NSF PHY-1.427.654) und NSF DMS-1361411 und als CPRIT (Cancer Prevention and Research Institute of Texas) Scholar in der Krebsforschung des Staates Texas unterstützt an der Rice University. KEW wurde vom NIH F32 CA192630 MKJ unterstützt und HL profitierte von nützlichen Gesprächen mit Mary C. Farach-Carson, JN Onuchic, Samir M. Hanash, Kenneth J. Pienta und Donald S. Coffey.

    Materials

    Name Company Catalog Number Comments
    Countess automated counter Life technologies AMQAX1000
    Countess cell counting chamber slides Invitrogen C10283
    SimpliAmp Thermal Cycler Thermo Fisher A24811
    Odyssey Fc LI-COR Inc
    ViiA7 Real Time PCR System Thermo Fisher 4453536
    PCR microplate Corning 321-29-051
    KAPA SYBR Fast Universal qPCR Kit KAPA Biosystems KK4602
    Starting Block (PBS) Blocking Buffer Thermo Fisher 37538 BSA-based blocking buffer
    Agarose General Purpose LE Genesee Scientific 20-102
    10x Tris/Glycine/SDS Buffer Bio-Rad Laboratories Inc 161-0732 Running buffer
    10x Tris/Glycine Buffer Bio-Rad Laboratories Inc 161-0734 Transfer buffer
    RIPA Buffer Sigma Life Sciences SLBG8489
    Amersham Protran 0.45 μm nitrocellulose GE Healthcare Lifesciences 10600012
    Quick-RNA MiniPrep Kit Genesee Scientific 11-358
    Laemmli Sample Buffer (4X) Bio-Rad Laboratories Inc 1610747
    Mini Trans-Blot Cell Bio-Rad Laboratories Inc 1703930
    Mini-Protean Tetra Cell Bio-Rad Laboratories Inc 1658005EDU
    DPBS Life technologies 14190-144
    0.05% Trypsin-EDTA Life technologies 11995-065
    DMEM Life technologies 11995-065
    Lipofectamine RNAi Max Thermo Fisher 13778150
    Lipofectamine 2000 Ragents Thermo Fisher 11668019
    Penicillin Streptomycin Life technologies 15140-122
    miRVana miRNA mimic negative control #1 Thermo Fisher 4464058 neg miRNA
    hsa-miR-200 mirVana miRNA mimic Thermo Fisher 4464066 miR200A
    has-miR-200 mirVana miRNA mimic Thermo Fisher 4404066 miR200B
    has-miR-200 mirVana miRNA mimic Thermo Fisher 4404066 miR200C
    Opti-MEM Life technologies 11088-021 serum-free media
    anti-Ecadherin antibody BD Bioscience 610182
    anti-beta actin Santa Cruz Biotechnology sc-69879
    anti-EpCam Ab Serotec MCA18706
    anti-ZO1 Invitrogen 402200
    IRDye 800W LI-COR Inc 925-32210
    IRDye 680 LI-COR Inc 926-32223
    anti-mouse AlexaFluor 647 Thermo Fisher A211241
    anti-rabbit AlexaFluor 647 Thermo Fisher ab150075
    Halt Protease and Phosphatesse Inhibitor Thermo Fisher 1861281
    Precision Plus Protein Dual Color Bio-Rad Laboratories Inc 161-0374
    Partec CellTrics Sysmex 04-004-2326 30 μm filter for flow
    GAPDH-F IDT AGCCACATCGCTCAGACAC
    GAPDH-R IDT GCCCAATACGACCAAATCC
    Ecadherin-F IDT TGGAGGAATTCTTGCTTTGC
    Ecadherin-R IDT CGCTCTCCTCCGAAGAAAC
    ZEB1-F IDT GCATACAGAACCCAACTTGAACGTC
    ZEB1-R IDT CGATTACACCCAGACTGC
    NOTCH-F IDT GGCAATCCGAGGACTATGAG
    NOTCH-R IDT CTCAGAACGCACTCGTTGAT
    nitro blue tetrazolium  Sigma N5514
    hexadimethrine bromide Sigma H9268 polybrene
    3 mL syringe BD Bioscience 309657
    Sterile syringe filter VWR 28145-505
    5mL polypropylene round-bottom tube 352063 flow cytometry tubes
    High-Capacity cDNA Reverse Transcription Kit Thermo Fisher 4368814 reverse transcription kit
    4% paraformaldyhyde Santa Cruz Biotechnology sc-281612
    Triton-X100 Sigma 93443
    bovine serum albumin Sigma A7906

    DOWNLOAD MATERIALS LIST

    References

    1. Weber, C. E., Li, N. Y., Wai, P. Y., Kuo, P. C. Epithelial-mesenchymal transition, TGF-beta, and osteopontin in wound healing and tissue remodeling after injury. J Burn Care Res. 33, (3), 311-318 (2012).
    2. Galichon, P., Finianos, S., Hertig, A. EMT-MET in renal disease: should we curb our enthusiasm. Cancer Lett. 341, (1), 24-29 (2013).
    3. Carew, R. M., Wang, B., Kantharidis, P. The role of EMT in renal fibrosis. Cell Tissue Res. 347, (1), 103-116 (2012).
    4. Willis, B. C., Borok, Z. TGF-beta-induced EMT: mechanisms and implications for fibrotic lung disease. Am J Physiol Lung Cell Mol Physiol. 293, (3), L525-L534 (2007).
    5. Ye, X., Weinberg, R. A. Epithelial-Mesenchymal Plasticity: A Central Regulator of Cancer Progression. Trends Cell Biol. 25, (11), 675-686 (2015).
    6. Li, L., Li, W. Epithelial-mesenchymal transition in human cancer: comprehensive reprogramming of metabolism, epigenetics, and differentiation. Pharmacol Ther. 150, 33-46 (2015).
    7. Tsai, J. H., Yang, J. Epithelial-mesenchymal plasticity in carcinoma metastasis. Genes Dev. 27, (20), 2192-2206 (2013).
    8. Bitting, R. L., Schaeffer, D., Somarelli, J. A., Garcia-Blanco, M. A., Armstrong, A. J. The role of epithelial plasticity in prostate cancer dissemination and treatment resistance. Cancer Metastasis Rev. 33, (2-3), 441-468 (2014).
    9. Schaeffer, D., Somarelli, J. A., Hanna, G., Palmer, G. M., Garcia-Blanco, M. A. Cellular Migration and Invasion Uncoupled: Increased Migration Is Not an Inexorable Consequence of Epithelial-to-Mesenchymal Transition. Mol Cell Biol. 34, (18), 3486-3499 (2014).
    10. Mathow, D., et al. Zeb1 affects epithelial cell adhesion by diverting glycosphingolipid metabolism. EMBO Rep. 16, (3), 321-331 (2015).
    11. Ware, K. E., et al. A mechanism of resistance to gefitinib mediated by cellular reprogramming and the acquisition of an FGF2-FGFR1 autocrine growth loop. Oncogenesis. 2, e39 (2013).
    12. Yauch, R. L., et al. Epithelial versus mesenchymal phenotype determines in vitro sensitivity and predicts clinical activity of erlotinib in lung cancer patients. Clin Cancer Res. 11, (24 Pt 1), 8686-8698 (2005).
    13. Jolly, M. K., et al. Towards elucidating the connection between epithelial-mesenchymal transitions and stemness. J R Soc Interface. 11, (101), 20140962 (2014).
    14. Mani, S. A., et al. The epithelial-mesenchymal transition generates cells with properties of stem cells. Cell. 133, (4), 704-715 (2008).
    15. Chen, L., et al. Metastasis is regulated via microRNA-200/ZEB1 axis control of tumour cell PD-L1 expression and intratumoral immunosuppression. Nat Commun. 5, 5241 (2014).
    16. Nicolazzo, C., Gradilone, A. Significance of circulating tumor cells in soft tissue sarcoma. Anal Cell Pathol (Amst). 697395 (2015).
    17. Somarelli, J. A., et al. Mesenchymal-epithelial transition in sarcomas is controlled by the combinatorial expression of miR-200s and GRHL2. Mol Cell Biol. (2016).
    18. Bae, Y. K., Choi, J. E., Kang, S. H., Lee, S. J. Epithelial-Mesenchymal Transition Phenotype Is Associated with Clinicopathological Factors That Indicate Aggressive Biological Behavior and Poor Clinical Outcomes in Invasive Breast Cancer. J Breast Cancer. 18, (3), 256-263 (2015).
    19. Humphries, B., Yang, C. The microRNA-200 family: small molecules with novel roles in cancer development, progression and therapy. Oncotarget. 6, (9), 6472-6498 (2015).
    20. Renner, M., et al. MicroRNA profiling of primary high-grade soft tissue sarcomas. Genes Chromosomes Cancer. 51, (11), 982-996 (2012).
    21. Petrof, G., et al. Mutations in GRHL2 result in an autosomal-recessive ectodermal Dysplasia syndrome. Am J Hum Genet. 95, (3), 308-314 (2014).
    22. Werner, S., et al. Dual roles of the transcription factor grainyhead-like 2 (GRHL2) in breast cancer. J Biol Chem. 288, (32), 22993-23008 (2013).
    23. Werth, M., et al. The transcription factor grainyhead-like 2 regulates the molecular composition of the epithelial apical junctional complex. Development. 137, (22), 3835-3845 (2010).
    24. Somarelli, J. A., et al. Mesenchymal-Epithelial Transition in Sarcomas Is Controlled by the Combinatorial Expression of MicroRNA 200s and GRHL2. Mol Cell Biol. 36, (19), 2503-2513 (2016).
    25. Varma, S., et al. The transcription factors Grainyhead-like 2 and NK2-homeobox 1 form a regulatory loop that coordinates lung epithelial cell morphogenesis and differentiation. J Biol Chem. 287, (44), 37282-37295 (2012).
    26. Pruitt, S. C., Mielnicki, L. M., Stewart, C. C. Analysis of fluorescent protein expressing cells by flow cytometry. Methods Mol Biol. 263, 239-258 (2004).
    27. Zhao, Z., et al. A high-content morphological screen identifies novel microRNAs that regulate neuroblastoma cell differentiation. Oncotarget. 5, (9), 2499-2512 (2014).
    28. Borowicz, S., et al. The soft agar colony formation assay. J Vis Exp. (92), e51998 (2014).
    29. Yang, J., et al. Integrated proteomics and genomics analysis reveals a novel mesenchymal to epithelial reverting transition in leiomyosarcoma through regulation of slug. Mol Cell Proteomics. 9, (11), 2405-2413 (2010).
    30. Alba-Castellon, L., et al. Snail1 expression is required for sarcomagenesis. Neoplasia. 16, (5), 413-421 (2014).
    31. Takaishi, M., Tarutani, M., Takeda, J., Sano, S. Mesenchymal to Epithelial Transition Induced by Reprogramming Factors Attenuates the Malignancy of Cancer Cells. PLoS One. 11, (6), e0156904 (2016).

    Erratum

    Formal Correction: Erratum: Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells
    Posted by JoVE Editors on 07/03/2018. Citeable Link.

    An erratum was issued for: Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells. An author name was updated.

    One of the authors' names was corrected from:

    Shenghan Xu

    to:

    Shengnan Xu

    Die Induktion von mesenchymalen-Epithelial Transitions in Sarcomzellen
    Play Video
    PDF DOI DOWNLOAD MATERIALS LIST

    Cite this Article

    Ware, K. E., Gilja, S., Xu, S., Shetler, S., Jolly, M. K., Wang, X., Bartholf Dewitt, S., Hish, A. J., Jordan, S., Eward, W., Levine, H., Armstrong, A. J., Somarelli, J. A. Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells. J. Vis. Exp. (122), e55520, doi:10.3791/55520 (2017).More

    Ware, K. E., Gilja, S., Xu, S., Shetler, S., Jolly, M. K., Wang, X., Bartholf Dewitt, S., Hish, A. J., Jordan, S., Eward, W., Levine, H., Armstrong, A. J., Somarelli, J. A. Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells. J. Vis. Exp. (122), e55520, doi:10.3791/55520 (2017).

    Less
    Copy Citation Download Citation Reprints and Permissions
    View Video

    Get cutting-edge science videos from JoVE sent straight to your inbox every month.

    Waiting X
    simple hit counter