Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Developmental Biology

सारकोमा कोशिकाओं में Mesenchymal-उपकला संक्रमण को प्रेरित करना

doi: 10.3791/55520 Published: April 7, 2017

ERRATUM NOTICE

Summary

हम यहाँ पेश माइक्रो RNA-200 परिवार के सदस्यों और grainyhead की तरह 2 (GRHL2) के संयुक्त अस्थानिक अभिव्यक्ति के आधार पर सार्कोमा कोशिकाओं में मेसेंकाईमल-उपकला संक्रमण (एमईटी) उत्प्रेरण के लिए एक सेल संस्कृति विधि। इस विधि कैंसर आक्रामकता और उपचार पर प्ररूपी plasticity के जैविक प्रभाव को समझने के बेहतर करने के लिए उपयुक्त है।

Abstract

प्ररूपी plasticity एक घटना जिसमें कोशिकाओं क्षणिक एक और वंश के लक्षण हासिल करने के लिए संदर्भित करता है। कार्सिनोमा प्रगति के दौरान, प्ररूपी plasticity ड्राइव आक्रमण, प्रसार और मेटास्टेसिस। दरअसल, जबकि प्ररूपी plasticity के अध्ययन के सबसे उपकला व्युत्पन्न कार्सिनोमा के संदर्भ में किया गया है, यह पता सार्कोमा, जो मूल में मेसेंकाईमल कर रहे हैं, भी प्ररूपी plasticity प्रदर्शन बदल जाता है, सार्कोमा के सबसेट के साथ एक घटना है कि एक mesenchymal- जैसा दिखता है के दौर से गुजर उपकला संक्रमण (एमईटी)। यहाँ, हम एक विधि मीर 200 परिवार और grainyhead की तरह 2 (GRHL2) शामिल इस MET की तरह सार्कोमा रोगी samples.We में मनाया क्रमिक रूप से GRHL2 और मीर 200 परिवार सेल पारगमन और अभिकर्मक का उपयोग कर व्यक्त घटना की नकल करने के लिए विकसित क्रमश: , बेहतर सार्कोमा कोशिकाओं में इन प्ररूपी संक्रमण के आणविक आधार को समझने के लिए। सारकोमा कोशिकाओं मीर 200s और GRHL2 व्यक्त बढ़ाया उपकला लक्षण का प्रदर्शन कियासेल आकृति विज्ञान और उपकला और मेसेंकाईमल बायोमार्कर के परिवर्तन में आईसीएस। इन विधियों का उपयोग भविष्य के अध्ययनों बेहतर इस तरह के प्रवास, आक्रमण, मेटास्टैटिक प्रवृत्ति, और चिकित्सा प्रतिरोध के रूप में सार्कोमा कोशिकाओं पर MET की तरह प्रक्रियाओं के प्ररूपी परिणामों को समझने के लिए इस्तेमाल किया जा सकता है।

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

प्ररूपी plasticity सेलुलर समलक्षणियों के बीच एक प्रतिवर्ती संक्रमण को संदर्भित करता है, और आमतौर पर दो प्रकार, उपकला करने वाली मेसेंकाईमल (EMT) संक्रमण और मेसेंकाईमल करने वाली उपकला संक्रमण (एमईटी) में बांटा गया है। यह प्ररूपी plasticity इस तरह के विकास और घाव भरने 1 के रूप में बहुकोशिकीय जीव, की सामान्य प्रक्रियाओं में एक महत्वपूर्ण भूमिका निभाता है; हालांकि, ये वही रास्ते और जीन अभिव्यक्ति कार्यक्रम भी रोग के लिए, इस तरह के फाइब्रोसिस जैसे नेतृत्व कर सकते हैं (की समीक्षा की में 2, 3, 4) और कार्सिनोमा मेटास्टेसिस (संदर्भ 5, 6, 7 में समीक्षा की, 8)। मेटास्टेसिस के दौरान, उदाहरण के लिए, EMT सेल polarity, सेल सेल बातचीत बाधित, और आक्रमण 9, 10 को बढ़ावा देता है। साथ में, EMT योगदानएक प्ररूपी राज्य कि कैंसर कोशिका प्रसार की सुविधा के लिए है। इसके अलावा, EMT भी अन्य प्ररूपी परिवर्तन है कि एक आक्रामक phenotype ड्राइव, कैंसर सेल चयापचय 6 के अविनियमन, दवा प्रतिरोध 11, 12 के विकास सहित, वृद्धि ट्यूमर दीक्षा क्षमता 13, 14 और प्रतिरक्षा चोरी 15 की मेजबानी की मेजबानी के लिए ले जाता है।

प्ररूपी plasticity अच्छी तरह से कार्सिनोमा प्रगति में अध्ययन किया गया है; हालांकि, सार्कोमा भी प्ररूपी plasticity दिखा रहे हैं। दिलचस्प बात यह है, ऐसा लगता है जैसे कि कार्सिनोमा में प्ररूपी plasticity के एक ही ड्राइवरों में से कुछ भी सार्कोमा plasticity और आक्रामकता के लिए योगदान करते हैं। उदाहरण के लिए, सार्कोमा रोगियों से घूम ट्यूमर कोशिकाओं (CTCs) EpCAM, एक कोशिका की सतह प्रोटीन है कि आम तौर पर उपकला कोशिकाओं 16 पर पाया जाता है व्यक्त करने के लिए दिखाया गया है। additionally, 250 कोमल ऊतक सार्कोमा नमूने उपकला की तरह या मेसेंकाईमल की तरह जीन अभिव्यक्ति के आधार पर के रूप में वर्गीकृत किया गया। उपकला की तरह बायोमार्कर हस्ताक्षर में मरीजों मेसेंकाईमल की तरह बायोमार्कर हस्ताक्षर 17 के साथ रोगियों की तुलना में एक बेहतर पूर्वानुमान था। यह कई कार्सिनोमा, जिसमें अधिक उपकला की तरह कार्सिनोमा के साथ रोगियों अधिक मेसेंकाईमल की तरह ट्यूमर 18 के साथ रोगियों की तुलना में बेहतर परिणाम है के अनुरूप है।

कुछ सार्कोमा बायोमार्कर और एमईटी के अनुरूप जीन अभिव्यक्ति रास्ते प्रदर्शित करते हैं, इस प्ररूपी plasticity के आणविक आधार खराब समझ रहते हैं। सार्कोमा में तंत्र और एमईटी के चालकों का अध्ययन करने के लिए हम दो उपकला विशेष कारकों का उपयोग MET प्रेरण का एक मॉडल विकसित की है, माइक्रो RNA (मीर) -200 परिवार और grainyhead की तरह 2 (GRHL2)। मीर 200s छोटे गैर-कोडिंग RNAs कि Messen के 3 'UTRs से जुड़ कर जीन की अभिव्यक्ति को विनियमित के एक परिवार हैंजर आरएनए और प्रोटीन में रोकने अनुवाद। मीर 141 और मीर 200a युक्त एक, और अन्य मीर 200b, मीर 200c, और मीर 429 सहित - मीर 200 परिवार दो उपसमूहों के होते हैं। मीर 200 परिवार के सदस्य उपकला ऊतकों में समृद्ध कर रहे हैं, और मीर 200s के नुकसान कार्सिनोमा 19 में मेटास्टेसिस साथ जुड़ा हुआ है। मीर 200 परिवार को भी सामान्य ऊतकों 20 की तुलना में नरम ऊतक सार्कोमा में downregulated है। मीर 200s के समान, GRHL2 एक महत्वपूर्ण नियामक कि उपकला विकास 21 के लिए महत्वपूर्ण है। GRHL2 प्रतिलेखन कारक दो तरह से काम करता है इस तरह के ई cadherin के रूप में उपकला जीन, upregulate करने के लिए: 1) उपकला कोशिकाओं में, GRHL2 सीधे EMT मास्टर नियामक represses, ZEB1 22; और 2) GRHL2 सीधे उपकला जीन 23 के प्रतिलेखन को सक्रिय करता है। हमारे पिछले जांच से पता चला है सार्कोमा कोशिकाओं में मीर 200s और GRHL2 के संयुक्त अभिव्यक्तिएक MET की तरह phenotype 24 लाती है। यहाँ, हम एक इन विट्रो मीर 200s और GRHL2 के अस्थानिक अभिव्यक्ति का उपयोग कर सार्कोमा कोशिकाओं में MET प्रेरण के मॉडल बनाने के लिए एक विस्तृत प्रोटोकॉल प्रस्तुत करते हैं।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. अभिकर्मकों की तैयारी

  1. भ्रूण गोजातीय सीरम (एफबीएस) और पेनिसिलिन-स्ट्रेप्टोमाइसिन (5,000 यू / एमएल) DMEM के 500 एमएल के 5 एमएल के 50 एमएल जोड़कर सेल संस्कृति के लिए DMEM तैयार करें। इस माध्यम अप करने के लिए छह महीने के लिए 4 डिग्री सेल्सियस पर संग्रहित किया जा सकता है।
  2. 10 सुक्ष्ममापी के अंतिम एकाग्रता के लिए nuclease मुक्त पानी में lyophilized प्राइमरों Resuspend। -20 डिग्री सेल्सियस पर स्टोर फिर से निलंबित कर दिया प्राइमरों।
  3. radioimmunoprecipitation परख (RIPA) बफर (150 मिमी NaCl, 0.5% सोडियम deoxycholate, 0.1% एसडीएस, 50 मिमी Tris, पीएच 8.0) तैयार करें। उपयोग करने से पहले प्रोटीज अवरोध करनेवाला कॉकटेल के साथ पूरक और बर्फ पर बफर रखने जब उपयोग में। 4 डिग्री सेल्सियस पर स्टोर।
  4. एक 0.45 सुक्ष्ममापी polyethersulfone फिल्टर का उपयोग कर नसबंदी पानी और सिरिंज फिल्टर में 10 मिलीग्राम / एमएल polybrene (hexadimethrine ब्रोमाइड) तैयार करें। समाधान अप करने के लिए छह महीने के लिए 4 डिग्री सेल्सियस पर संग्रहित किया जा सकता है।
  5. पीबीएस के 10 एमएल में 10 मिलीग्राम भंग द्वारा नाइट्रो नीले tetrazolium क्लोराइड की एक 1 मिलीग्राम / एमएल काम कर समाधान तैयार करें। 4 डिग्री सेल्सियस पर स्टोर।

2. GRHL2 की Lentiviral पारगमन

पहला दिन

  1. प्लेट पूरक DMEM 2 एमएल में एक 6-अच्छी तरह से थाली की अच्छी तरह से प्रति 3 x 10 5 HEK293T कोशिकाओं। एक स्वचालित सेल काउंटर का उपयोग कर कोशिकाओं यों। 5% सीओ 2 के साथ 37 डिग्री सेल्सियस पर रातोंरात संस्कृति के बाद 60% संगामी - प्रकोष्ठों 40 होना चाहिए।

दूसरा दिन

  1. PΔ8.9 के 1.8 माइक्रोग्राम और 0.2 माइक्रोग्राम pCMV-VSV के साथ खाली वेक्टर के 2 माइक्रोग्राम (pCMV-यूबीसी-EGFP) या 2 pCMV-GRHL2-यूबीसी-EGFP 24 की माइक्रोग्राम, 25 पतला सीरम मुक्त मीडिया के 200 μL में जी सहायक प्लास्मिड। एक अलग ट्यूब में अभिकर्मक प्रति सीरम मुक्त मीडिया (दो नमूनों के लिए 400 μL में 8 μL) के 200 μL में एक लिपिड आधारित अभिकर्मक अभिकर्मक के 4 μL पतला। अभिकर्मक अभिकर्मक मिश्रण के 200 μL प्रत्येक प्लाज्मिड समाधान में जोड़े और कमरे के तापमान पर 20 मिनट के लिए सेते हैं।
  2. incuba के दौरानमोर्चे, वैक्यूम आकांक्षा द्वारा मध्यम हटाने और पीबीएस के 1 एमएल के साथ कोशिकाओं धोने के द्वारा HEK293T कोशिकाओं को धोने। सीरम मुक्त मीडिया के 800 μL के साथ पीबीएस बदलें। कदम 2.2 dropwise से प्लाज्मिड मिश्रण प्रत्येक के लिए अच्छी तरह से 2 घंटे के लिए 37 डिग्री सेल्सियस पर 5% सीओ 2 में और कोशिकाओं सेते: 20 मिनट के बाद, 200 μL अभिकर्मक अभिकर्मक के जोड़ें।
  3. ध्यान से वैक्यूम आकांक्षा द्वारा अभिकर्मक मध्यम हटाने और पूरक DMEM 2 एमएल के साथ बदलें। रात भर संस्कृति के लिए इनक्यूबेटर करने के लिए कोशिकाओं लौटें।
    नोट: HEK293T कोशिकाओं शिथिल पक्षपाती हैं। मीडिया प्रतिस्थापन डिश या कुप्पी के नीचे से कोशिकाओं को हटाने के सीमित करने के लिए सावधानी के साथ किया जाना चाहिए।

तीसरा दिन

  1. पूरक DMEM 2 एमएल में ट्रांसफ़ेक्ट HEK293T कोशिकाओं और थाली पर मीडिया को रिफ्रेश एक 6 अच्छी तरह से थाली की अच्छी तरह से प्रति 3 x 10 5 आरडी कोशिकाओं। संस्कृति कोशिकाओं रात भर। आरडी कोशिकाओं एक वाणिज्यिक रूप से उपलब्ध मानव rhabdomyosarcoma सेल लाइन कर रहे हैं।

4 दिन

  • HEK293T कोशिकाओं से वायरल मीडिया इकट्ठा। एक नया 15 एमएल शंक्वाकार में HEK293T कोशिकाओं और जगह से DMEM मीडिया पिपेट। ध्यान से नई DMEM मीडिया और अगले दिन के लिए इनक्यूबेटर में वापस जगह HEK293T कोशिकाओं से बदल दें।
  • 10 मिलीग्राम / वायरल मीडिया के एमएल प्रति एमएल polybrene के 2 μL दो नए 50 एमएल शंक्वाकार ट्यूब (GRHL2 अभिकर्मक के लिए खाली वेक्टर अभिकर्मक के लिए और दूसरा) में जोड़ें। सिरिंज फिल्टर एक 3 एमएल सिरिंज से सवार को दूर करने और टिप करने के लिए एक 0.45 सुक्ष्ममापी polyethersulfone फिल्टर देते द्वारा वायरल मीडिया।
    1. कदम 2.6 में एकत्र वायरल मीडिया सिरिंज की नली में जोड़ें, और polybrene युक्त नया 50 एमएल शंक्वाकार ट्यूब में मीडिया डुबकी। वैक्यूम आकांक्षा द्वारा आरडी कोशिकाओं से मीडिया निकालें और आरडी कोशिकाओं के लिए फ़िल्टर वायरल मीडिया जोड़ें।
  • दिन 5

    1. वायरल मीडिया के बाद एकत्र किया गया है दोहराएँ दिवस 4. HEK293T कोशिकाओं खारिज किया जा सकता है।

    दिन 7

    1. पीबीएस के 1 एमएल के साथ धो आरडी कोशिकाओं और प्रति अच्छी तरह से 0.05% ट्रिप्सिन के 200 μL जोड़ें। , 5 मिनट के लिए 37 डिग्री सेल्सियस पर सेते पूरक मीडिया के 2 एमएल जोड़ने के लिए, और एक नया 15 एमएल शंक्वाकार करने के लिए सेल निलंबन चलते हैं। कमरे के तापमान और मीडिया aspirate पर 5 मिनट के लिए 250 XG पर अपकेंद्रित्र कोशिकाओं। DMEM के 1 एमएल में Resuspend (5% एफबीएस और 1% के साथ पूरक पेनिसिलिन-स्ट्रेप्टोमाइसिन)।
      नोट: एफबीएस के एक उच्च प्रतिशत का उपयोग फ्लो दौरान अवरोध का कारण हो सकता
      1. फ्लो के लिए फ़िल्टर कोशिकाओं। बर्फ पर ट्यूब और जगह ट्यूब प्रवाह cytometry में एक 30 सुक्ष्ममापी फिल्टर के माध्यम से 1 एमएल आरडी कोशिका निलंबन लागू करने के लिए एक विंदुक का प्रयोग करें।
      2. क्रमबद्ध EGFP + कोशिकाओं 26 1.5 एमएल microcentrifuge DMEM के 0.5 एमएल युक्त ट्यूब में 10% एफबीएस और 1% पेनिसिलिन-स्ट्रेप्टोमाइसिन और बर्फ पर जगह के साथ पूरक। प्लेट EGFP + एक 12 अच्छी तरह से थाली और संस्कृति के लिए इनक्यूबेटर में जगह की एक अच्छी तरह से क्रमबद्ध किए पूरक DMEM 1 एमएल की कुल में कोशिकाओं।
        ; नोट: प्रवाह से cytometry इस पारगमन के बाद EGFP + कोशिकाओं की उपज आम तौर पर कम (50,000-100,000 कोशिकाओं) है। चरण 3 पर आगे बढ़ने से पहले 14 दिनों - सेल 10 के लिए संवर्धित किया जा आवश्यकता हो सकती।

    3. मीर 200s की रिवर्स अभिकर्मक

    1. दोहराया / फ्रीज पिघलना चक्र से बचने के लिए -20 डिग्री सेल्सियस पर nuclease मुक्त एच 2 ओ विभाज्य स्टॉक और दुकान का उपयोग कर मीर 200 की नकल करता है की 50 माइक्रोन स्टॉक तैयार करें।
    2. प्रत्येक 50 माइक्रोन मीर 200 की नकल (मीर 200a, मीर 200b, और मीर 200c) 300 μL सीरम मुक्त मीडिया के लिए 50 माइक्रोन नकारात्मक नियंत्रण miRNA के 9 μL 300 सीरम मुक्त मीडिया की μL या के 3 μL जोड़ें।
    3. siRNA विशेष अभिकर्मक अभिकर्मक के 6 μL सीरम मुक्त मीडिया के 600 μL में जोड़े और दो नलियों, कदम 3.2 से दो मीर मिश्रण से प्रत्येक के लिए एक में इस मिश्रण के 300 μL विभाजित करते हैं। अभिकर्मक अभिकर्मक के 300 μL का एक मिश्रण के साथ कदम 3.2 से प्रत्येक मीर मिश्रण के 300 μL जोड़ें। कक्ष ते पर 20 मिनट के लिए सेते हैंmperature।
    4. विकासशील है, एक सेल (250 कोशिकाओं / μL) उपचार प्रति सीरम मुक्त मीडिया की 600,000 EGFP + आरडी कोशिकाओं ईवी या GRHL2 2.4 एमएल में धारा 2 में बनाया व्यक्त करने का निलंबन तैयार करते हैं।
    5. एक 24 अच्छी तरह से थाली में, छह कुओं में मीर 200 मिश्रण या कदम 3.3 से नकारात्मक नियंत्रण मिश्रण का अच्छी तरह से प्रति 100 μL जोड़ने के लिए, और उसके बाद प्रत्येक मीर मिश्रण के तीन कुओं में प्रत्येक कोशिका निलंबन के 400 μL जोड़ें।
    6. रात भर 5% सीओ 2 में 37 डिग्री सेल्सियस पर कोशिकाओं सेते हैं और मीडिया को बदलने के लिए पूरी तरह से अगले दिन DMEM पूरक करने के लिए। उचित बफर (देखें नीचे) का उपयोग कर विश्लेषण के लिए 2 दिनों के बाद कोशिकाओं को इकट्ठा। आरडी सार्कोमा एमईटी के दौर से गुजर कोशिकाओं की समय-अंतराल इमेजिंग पूरक सामग्री के रूप में उपलब्ध है। छवि एक स्वचालित लाइव सेल इमेजर 27 का उपयोग कर एक 10X उद्देश्य के साथ प्रत्येक अच्छी तरह से हर 2 घंटे।

    4. शाही सेना निकासी, रिवर्स प्रतिलेखन, और qPCR

    1. एक मानक शाही सेना का उपयोग कर निर्माता के निर्देशों के अनुसार निकालें आरएनएनिष्कर्षण किट 24। निकाले शाही सेना -80 डिग्री सेल्सियस पर संग्रहीत किया जा सकता।
    2. शाही सेना एकाग्रता यों। पिघलना और बर्फ पर शाही सेना के साथ काम करते हैं। शाही सेना सांद्रता यों के लिए, निर्माता के प्रोटोकॉल के अनुसार एक थाली पाठक स्पेक्ट्रोफोटोमीटर के साथ 260 एनएम पर यूवी अवशोषण को मापने। nuclease मुक्त पानी के साथ सबसे कम एकाग्रता के लिए सभी नमूनों पतला।
    3. पूरक डीएनए (सीडीएनए) में कुल शाही सेना की रिवर्स प्रतिलेखन निष्पादित करें। पीसीआर बफर, dNTP मिश्रण (100 मिमी), यादृच्छिक hexamer प्राइमरों के साथ कुल शाही सेना का कोई कम से कम 100 एनजी कम्बाइन, एक 20 μL प्रतिक्रिया मात्रा 24 में ट्रांसस्क्रिप्टेज और nuclease मुक्त पानी रिवर्स। निर्माण के प्रोटोकॉल के अनुसार आर टी चक्र चलाएँ। सीडीएनए -20 डिग्री सेल्सियस पर भंडारित किया जा सकता लंबे समय तक।
    4. Nuclease मुक्त एच 2 ओ के 80 μL के साथ 100 μL करने के लिए 20 μL प्रतिक्रियाओं पतला
    5. मिक्स एक प्रतिदीप्ति आधारित intercalating डाई 2x qPCR मास्टर मिश्रण के 5 μL, प्रत्येक 10 माइक्रोन प्राइमर का 0.06 μL, एकnd 2 नमूना प्रति पतला आरटी प्रतिक्रिया की μL।
    6. भागो qPCR प्रतिदीप्ति आधारित मास्टर मिश्रण के लिए निर्माता के प्रोटोकॉल के अनुसार।
    7. डेल्टा सीटी विधि द्वारा mRNA की सापेक्ष मात्रा की गणना करना और GAPDH के लिए सामान्य बनाते हैं। प्रत्येक उपचार समूह के लिए मानक विचलन ± जैविक प्रतिकृति का मतलब mRNA अभिव्यक्ति प्लॉट करें।
      नोट: विशेष सावधानियों जब शाही सेना के साथ काम करने में इस तरह के RNase मुक्त प्लास्टिक और अभिकर्मकों का उपयोग कर के रूप में RNases, के साथ संपर्क से बचने के लिए लिया जाना चाहिए। गैर डिस्पोजेबल उपकरण RNases दूर करने के लिए उपयोग करने से पहले इलाज किया जाना चाहिए।

    5. Immunofluorescence धुंधला

    1. 24-अच्छी तरह प्रारूप में आरडी कोशिकाओं से कदम 3.6, मीडिया aspirate वैक्यूम आकांक्षा द्वारा के बाद।
    2. 4% paraformaldehyde (पीएफए) अच्छी तरह से प्रति के 500 μL जोड़कर कोशिकाओं को ठीक करें और (आर टी) कमरे के तापमान पर 15 मिनट के लिए सेते हैं। निर्धारण के बाद, फॉस्फेट में जगह कोशिकाओं रातोंरात यदि आवश्यक हो तो 4 डिग्री सेल्सियस पर खारा (पीबीएस) और स्टोर बफ़र।
    3. Permeabilizeपीबीएस + 0.2% ट्राइटन-X100 के 500 μL जोड़ने और आरटी पर 30 मिनट सेते द्वारा कोशिकाओं। वैक्यूम आकांक्षा रखकर permeabilization बफर हटाने और पीबीएस के साथ तीन बार धोएं।
    4. 5% गोजातीय सीरम albumin के 500 μL (BSA) / पीबीएस में ब्लॉक और आरटी पर 30 मिनट के लिए कोशिकाओं को सेते हैं। कोशिकाओं रातोंरात यदि आवश्यक हो तो 4 डिग्री सेल्सियस पर संग्रहित किया जा सकता है।
    5. प्राथमिक एंटीबॉडी कमजोर पड़ने को तैयार करें। 5% बीएसए की पिपेट 200 μL / अच्छी तरह से प्रति पीबीएस एक 15 एमएल शंक्वाकार में (12 कुओं = 2.4 एमएल) और 5% बीएसए की प्रति मिली प्राथमिक एंटीबॉडी के 1 μL जोड़ें / पीबीएस की जरूरत है। वैक्यूम आकांक्षा द्वारा अवरुद्ध बफर निकालें और प्रत्येक अच्छी तरह से करने के लिए पतला प्राथमिक एंटीबॉडी के 200 μL बांटना।
      1. 1 में कोशिकाओं सेते: 1,000 पतला प्राथमिक आरटी पर या रात भर 4 डिग्री सेल्सियस पर पीबीएस 5% बीएसए में एंटीबॉडी / 1 घंटे के लिए। ऊष्मायन के बाद, कोशिकाओं पीबीएस के साथ दो बार धोएं।
    6. जैसा कि ऊपर 5% बीएसए / पीबीएस का एक ही मात्रा में माध्यमिक एंटीबॉडी कमजोर पड़ने को तैयार करें। 2,000 कमजोर पड़ने: दूर की लाल डाई-संयुग्मित माध्यमिक एंटीबॉडी एक 1 का उपयोग कर जोड़ें। इसके अतिरिक्त जोड़ने1 माइक्रोग्राम / मिश्रण करने के लिए हेक्स्ट डाई के एमएल। पीबीएस निकालें और प्रत्येक अच्छी तरह से करने के लिए मिश्रण के 200 μL जोड़ें।
      1. अंधेरे में 1 घंटे के लिए आरटी पर सेते हैं। पीबीएस के साथ 3 बार धोएं, पीबीएस में कोशिकाओं को छोड़, और पन्नी का उपयोग कर प्रकाश से कोशिकाओं की रक्षा। कोशिकाओं 4 डिग्री सेल्सियस पर भंडारित किया जा सकता यदि आवश्यक हो तो।
    7. 650 एनएम - उत्तेजना तरंग दैर्ध्य 594 के साथ एक औंधा epifluorescence माइक्रोस्कोप पर 400X कुल आवर्धन पर छवि कोशिकाओं।

    6. पश्चिमी सोख्ता

    1. 3.6 से कोशिकाओं को बहुत ठंडा पीबीएस के साथ दो बार धोएं। बर्फ पर, 1x RIPA के 50 μL के साथ ल्य्से कोशिकाओं 1x प्रोटीज अवरोध करनेवाला कॉकटेल के साथ पूरक बफर।
    2. 15 मिनट के लिए 4 डिग्री सेल्सियस पर रॉक lysates, 5 मिनट के नमूने को स्पष्ट करने के लिए उच्च गति (20,000 XG) पर 1.5 एमएल ट्यूब में lysates, और अपकेंद्रित्र इकट्ठा। सेल lysates -80 डिग्री सेल्सियस पर भंडारित किया जा सकता लंबे समय तक यदि आवश्यक हो तो।
    3. कुल प्रोटीन एक ब्रैडफोर्ड परख का उपयोग कर की गणना करना और नए 1.5 एमएल microcentrifuge ट्यूब में प्रोटीन की समान मात्रा विभाज्य। ब्रिनRIPA बफर और 3x Laemmli लोड हो रहा है बफर 2-mercaptoethanol के साथ पूरक का उपयोग कर बराबर मात्रा के ग्राम नमूने हैं।
    4. 95 डिग्री सेल्सियस पर 5 मिनट के लिए 1x Laemmli नमूना लोड हो रहा है बफर में नमूने सेते हैं और 45 मिनट के लिए 200 वी पर एक 4-12% Tris-ग्लाइसिन जेल का उपयोग कर एसडीएस-पृष्ठ चलाते हैं। सेल लाइन पर निर्भर करता है प्रोटीन से भरी हुई पर्वतमाला की राशि। कुछ मामलों में, कुल प्रोटीन के 50-100 माइक्रोग्राम मेसेंकाईमल सेल लाइनों में ई cadherin का पता लगाने की जरूरत है।
    5. 1x Tris-ग्लाइसिन हस्तांतरण बफर में 50 वी में 2 घंटे के लिए एक nitrocellulose झिल्ली पर स्थानांतरण प्रोटीन।
    6. कमरे के तापमान पर या एक ही रात में बीएसए आधारित अवरुद्ध बफर में 4 डिग्री सेल्सियस पर 1 घंटे के लिए ब्लॉक झिल्ली।
    7. , अवरुद्ध बफर के 5 एमएल में 1,000 एकाग्रता झिल्ली को कमजोर पड़ने जोड़ने के लिए, और सौम्य कमरे के तापमान पर या रात भर 4 डिग्री सेल्सियस पर 1 घंटे के लिए कमाल के साथ सेते हैं: 1 पर प्राथमिक एंटीबॉडी पतला। धो झिल्ली 3 0.05% बीच 20 के साथ पीबीएस में कई बार।
    8. अवरक्त फ्लोरोसेंट युग्मित secondar साथ आरटी पर 1 घंटे के लिए झिल्ली सेते1 में वाई एंटीबॉडी: जैसा कि ऊपर बफर को रोकने में 20,000 कमजोर पड़ने।
    9. और 0.05% बीच 20 के साथ पीबीएस में झिल्ली दो बार धोएं तो एक पीबीएस में समय।
    10. छवि मानक अवरक्त प्रतिदीप्ति का पता लगाने का उपयोग कर झिल्ली।

    7. एंकोरेज स्वतंत्र विकास Assays

    नोट: एक विस्तृत नरम अगर परख प्रोटोकॉल के लिए, 28 को देखते हैं।

    1. गर्म पानी स्नान में 42 डिग्री सेल्सियस तक गर्म बाँझ 2x DMEM मीडिया। इस समय के दौरान, गर्मी माइक्रोवेव में 3 मिनट के लिए पहले से autoclaved 1% agarose। एक समय के रूप में की जरूरत है या जब तक पूरी तरह से पिघल में एक अतिरिक्त 30 s के लिए माइक्रोवेव। एक 42 डिग्री सेल्सियस जल स्नान करने के लिए agarose ले जाएँ।
    2. एक बाँझ हुड में 42 डिग्री सेल्सियस पानी के साथ एक बीकर में एक 50 एमएल शंक्वाकार ट्यूब रखें और 1% agarose और 2x DMEM मीडिया एक 1 में मिश्रण: 1 के अनुपात लेखांकन एक 6 अच्छी तरह से थाली में अच्छी तरह से प्रति मिश्रण के 1.5 एमएल के लिए। हमेशा अतिरिक्त DMEM / agarose pipetting त्रुटि के लिए खाते में करने के लिए तैयार और बुलबुले से बचने के लिए।
    3. करने के लिए मिश्रण जोड़ेंअच्छी तरह से की तरफ, कोई बुलबुले सुनिश्चित फार्म और आरटी पर 30 मिनट के लिए छोड़ दें।
    4. नीचे की परत solidifying है, वहीं मीडिया श्वास और 1 एमएल पीबीएस के साथ एक बार धोने से चरण 3 में ट्रांसफ़ेक्ट आरडी कोशिकाओं के प्रत्येक समूह तैयार करते हैं। पीबीएस Aspirate और 0.05% ट्रिप्सिन की 0.2 एमएल जोड़ें और 5 मिनट के लिए 37 डिग्री सेल्सियस पर सेते हैं।
    5. मीडिया और महीन चुर्ण बनाना कोशिकाओं के 0.8 एमएल में ट्रिप्सिन बेअसर एक एकल कोशिका निलंबन के रूप में। एक 15 एमएल शंक्वाकार ट्यूब को सेल निलंबन स्थानांतरण।
    6. कोशिकाओं की गणना करें और सेल में अच्छी तरह से प्रति 10,000 कोशिकाओं के लिए आवश्यक निलंबन की मात्रा की गणना।
    7. एक समय में 30 रों के बाद 3 मिनट के लिए माइक्रोवेव में 0.6% agarose गरम करें जब तक पूरी तरह से पिघल। 42 डिग्री सेल्सियस जल स्नान करने के लिए agarose ले जाएँ।
    8. एक बाँझ हुड में 42 डिग्री सेल्सियस पानी के साथ एक बीकर में एक 50 एमएल शंक्वाकार ट्यूब रखें। एक 1 में 0.6% agarose और पतला सेल निलंबन मिक्स: 1 के अनुपात में एक 6-अच्छी तरह से थाली में अच्छी तरह से प्रति मिश्रण के 1.5 एमएल तैयार करने के लिए। हमेशा अतिरिक्त कोशिका निलंबन तैयार / agarose pipetting त्रुटि के लिए खाते मिश्रण औरबुलबुले से बचने के लिए।
      नोट: यह यहाँ 42 डिग्री सेल्सियस पर काम करने के लिए महत्वपूर्ण है। तापमान बहुत कम है मिश्रण चढ़ाना से पहले जमना जाएगा, और ऊपर 42 डिग्री सेल्सियस तापमान सेल व्यवहार्यता को प्रभावित करेगा।
    9. कोशिकाओं कई बार triturating द्वारा अच्छी तरह से मिलाएं और कुओं के लिए सेल मिश्रण जोड़ने के लिए, कोई बुलबुले प्रपत्र सुनिश्चित करने, और आरटी पर 20 मिनट के लिए जमना करते हैं।
    10. अच्छी तरह से प्रत्येक के लिए पूरक मीडिया के 2 एमएल जोड़ें और इनक्यूबेटर करने के लिए प्लेटों के लिए कदम।
      1. 3-4 सप्ताह के लिए या जब तक बहु सेलुलर कालोनियों फार्म सप्ताह में एक बार मीडिया बदलें। जब वैक्यूम आकांक्षा द्वारा मीडिया को हटाने अगर छू से बचने के लिए सावधान रहें। वैकल्पिक रूप से, तरल मीडिया के ऊपर परत को हटाने के लिए एक P1000 का उपयोग करें।
      2. मुलायम अगर प्लेट 200 नाइट्रो के μL ब्लू tetrazolium क्लोराइड समाधान जोड़कर (1 मिलीग्राम / पीबीएस में एमएल) दाग और 37 डिग्री सेल्सियस पर रात में थाली सेते हैं। इमेजिंग के लिए पीबीएस के साथ अगले दिन मीडिया बदलें।
      3. उलटे माइक्रोस्कोप पर 40X कुल आवर्धन पर छवि कुओं।
      4. कॉलोनी क्षेत्र और संख्या के लिए ImageJ पर विश्लेषण करें। प्लॉट मतलब जैविक प्रतिकृति की कॉलोनी नंबर ± मानक विचलन।

    Subscription Required. Please recommend JoVE to your librarian.

    Representative Results

    or Start trial to access full content. Learn more about your institution’s access to JoVE content here

    सार्कोमा कोशिकाओं में MET शामिल करने के लिए स्कीमा

    सार्कोमा कोशिकाओं में MET की तरह परिवर्तन के शामिल होने के लिए एक सामान्य समय चित्र 1 में दिखाया गया है। प्रोटोकॉल GRHL2 (चित्रा 1 ए), मीर 200 परिवार (चित्रा 1 बी) के अभिकर्मक के बाद transducing से शुरू होता है। GRHL2 या मीर 200 परिवार के सदस्यों को जब अकेले व्यक्त आरडी कोशिकाओं की उपस्थिति को प्रभावित करने में सक्षम नहीं थे, लेकिन उपकला की तरह आरडी कोशिकाओं में रूपात्मक परिवर्तन में परिणाम एक साथ GRHL2 और मीर 200s के अस्थानिक अभिव्यक्ति। एक धुरी के आकार रूप से बढ़ाकर सेल सेल संपर्क (चित्रा 1C) के साथ एक अधिक गोल उपस्थिति के लिए कक्ष संक्रमण।

    सार्कोमा कोशिकाओं में MET की तरह परिवर्तन को प्रेरित करना

    GRHL2 और मीर 200 पर आरडी कोशिकाओं में रूपात्मक परिवर्तनओवर-अभिव्यक्ति उपकला मार्कर ई cadherin (चित्रा 2 ए) के अपरेगुलेशन थे। मीर 200s के अलावा अकेले upregulated ई cadherin, लेकिन संयुक्त मीर 200s और GRHL2 overexpression synergistically बढ़ाया ई cadherin अभिव्यक्ति (चित्रा 2A; पैमाने प्रवेश नहीं)। इसके अलावा, उपकला आसंजन अणु, EpCAM और TJP1, श्वेत तीरों में से सेल सेल जंक्शनों पर वृद्धि हुई है (चित्रा 2 बी) (यह भी जोना occludens 1, ZO-1 के रूप में जाना जाता है) था।

    MET प्रेरण सार्कोमा कोशिकाओं की कॉलोनी गठन की क्षमता कम हो जाती है

    उपकला प्रोटीन की upregulation मेसेंकाईमल जीन Zeb1 और Notch1 (चित्रा 3 ए) है, जो मीर 200 के लिए लक्ष्य में जाना जाता है के डाउनरेगुलेशन थे। के रूप में कॉलोनी संख्या (चित्रा 3 बी) द्वारा मापा MET को प्रेरित करना आरडी कोशिकाओं के लंगरवानी स्वतंत्र विकास कम कर दिया। यह growth निषेध अकेले मीर 200s से प्रेरित था; GRHL2 की overexpression लंगरवानी स्वतंत्र विकास (चित्रा 3) में वृद्धि करने के लिए नेतृत्व के रूप में। यह लंगरवानी स्वतंत्र विकास 22 लाती पिछली रिपोर्टों GRHL2 अभिव्यक्ति दिखा के अनुरूप है।

    आकृति 1
    चित्र 1: GRHL2 से अधिक अभिव्यक्ति और मीर 200 अभिकर्मक के साथ मुलाकात की प्रेरण की समय रेखा। (ए) लक्ष्य कोशिकाओं में GRHL2 के अस्थानिक से अधिक अभिव्यक्ति की समय रेखा। (बी) के लक्ष्य कोशिकाओं में मीर 200 परिवार के सदस्यों की रिवर्स अभिकर्मक के माध्यम से MET प्रेरण की समय रेखा। (सी) GRHL2 और मीर 200 से अधिक अभिव्यक्ति एमईटी के अनुरूप लक्ष्य कोशिकाओं की आकारिकी में परिवर्तन भी आया। स्केल बार = 75 सुक्ष्ममापी लिए यहां क्लिक करेंयह आंकड़ा का एक बड़ा संस्करण देखने के लिए।

    चित्र 2
    चित्र 2: समवर्ती से अधिक अभिव्यक्ति GRHL2 और मीर 200s के लक्ष्य कोशिकाओं में एमईटी का नेतृत्व किया। (ए) मीर 200s की अभिव्यक्ति ऊंचा ई cadherin अभिव्यक्ति के लिए प्रेरित किया, जबकि GRHL2 और मीर 200s के संयुक्त अभिव्यक्ति दोनों mRNA पर ई cadherin अभिव्यक्ति पर एक सहक्रियाशील प्रभाव (मानक विचलन ± मतलब मान) और प्रोटीन के स्तर का उत्पादन किया। (बी) GRHL2 और मीर 200s का संयुक्त अभिव्यक्ति सेल सेल संपर्कों (तीर) में EpCAM और TJP1 की वृद्धि की अभिव्यक्ति के लिए प्रेरित किया। स्केल बार = 20 सुक्ष्ममापी। * पी इंगित करता है <0.05 के साथ Tukey के पोस्ट-हॉक correction.This आंकड़ा संदर्भ 24 से संशोधित किया गया है एनोवा का उपयोग कर विश्लेषण किया। सूक्ष्म जीव विज्ञान, आणविक सेल बायोलॉजी, मात्रा 36, अंक 19, 2503-2513, 2 के लिए कॉपीराइट © अमेरिकन सोसायटी016. यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

    चित्र तीन
    चित्र 3: मीर 200s दबा Mesenchymal मार्करों और सारकोमा कोशिकाओं में घटने एंकोरेज स्वतंत्र विकास की अभिव्यक्ति। (ए) से अधिक - मीर 200s की अभिव्यक्ति नहीं बल्कि GRHL2 Zeb1 और Notch1 mRNA अभिव्यक्ति (मानक विचलन ± मतलब मान) हिचकते। (बी) से अधिक अभिव्यक्ति मीर 200s की नहीं बल्कि GRHL2 सार्कोमा कोशिकाओं में संकोची anoikis प्रतिरोध। दाग कालोनियों (स्केल बार = 200 सुक्ष्ममापी) और कॉलोनी नंबर (मानक विचलन ± मतलब मान) की मात्रा के प्रतिनिधि छवियों दिखाए जाते हैं। * संकेत पी <0.05 Tukey के पोस्ट-हॉक correction.This आंकड़ा साथ एनोवा का उपयोग कर विश्लेषण किया आर से संशोधित किया गया हैeference 24। सूक्ष्म जीव विज्ञान, आणविक सेल बायोलॉजी, मात्रा 36, अंक 19, 2503-2513, 2016 के लिए कॉपीराइट © अमेरिकन सोसायटी यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

    चित्र तीन
    पूरक वीडियो: आरडी कोशिकाओं खाली वेक्टर और नकारात्मक नियंत्रण miRNAs व्यक्त। वीडियो खाली वेक्टर और नकारात्मक नियंत्रण miRNAs एक स्वचालित लाइव सेल इमेजर का उपयोग कर हर दो घंटे का अधिग्रहण साथ ट्रांसफ़ेक्ट आरडी कोशिकाओं की छवियों से संकलित किया गया। यह वीडियो देखने के लिए यहां क्लिक करें। (डाउनलोड करने के लिए राइट क्लिक करें।)

    चित्र तीन />
    पूरक वीडियो 2: आरडी कोशिकाओं को व्यक्त करने GRHL2-EGFP और नकारात्मक नियंत्रण miRNAs। वीडियो एक स्वचालित लाइव सेल इमेजर का उपयोग कर हर दो घंटे का अधिग्रहण GRHL2-EGFP और नकारात्मक नियंत्रण miRNAs साथ ट्रांसफ़ेक्ट आरडी कोशिकाओं की छवियों से संकलित किया गया। यह वीडियो देखने के लिए यहां क्लिक करें। (डाउनलोड करने के लिए राइट क्लिक करें।)

    चित्र तीन
    पूरक वीडियो 3: खाली वेक्टर और miR200 miRNAs व्यक्त करते आरडी कोशिकाओं। वीडियो खाली वेक्टर और miR200 miRNAs साथ ट्रांसफ़ेक्ट आरडी कोशिकाओं की छवियों एक स्वचालित लाइव सेल इमेजर का उपयोग कर हर दो घंटे का अधिग्रहण से संकलित किया गया। यह वीडियो देखने के लिए यहां क्लिक करें। (डाउनलोड करने के लिए राइट क्लिक करें।)

    NT "के लिए: रखने together.within-पन्ने की =" 1 "> चित्र तीन
    पूरक वीडियो 4: आरडी कोशिकाओं को व्यक्त करने GRHL2-EGFP और miR200 miRNAs। वीडियो GRHL2-EGFP और miR200 miRNAs साथ ट्रांसफ़ेक्ट आरडी कोशिकाओं की छवियों से संकलित किया गया एक स्वचालित लाइव सेल इमेजर का उपयोग कर हर दो घंटे हासिल कर ली। यह वीडियो देखने के लिए यहां क्लिक करें। (डाउनलोड करने के लिए राइट क्लिक करें।)

    Subscription Required. Please recommend JoVE to your librarian.

    Discussion

    or Start trial to access full content. Learn more about your institution’s access to JoVE content here

    सार्कोमा के एक मेसेंकाईमल वंश की दुर्लभ है, लेकिन अत्यधिक आक्रामक कैंसर हैं। उनके मेसेंकाईमल वंश के बावजूद, सार्कोमा के एक सबसेट एक और अधिक उपकला की तरह राज्य के लिए एक प्ररूपी संक्रमण से गुजरना होता है। यह MET की तरह स्विच, शकुन प्रासंगिकता है के रूप में अधिक उपकला की तरह ट्यूमर के साथ रोगियों कम आक्रामक 24 कर रहे हैं। उनके नैदानिक ​​प्रासंगिकता के बावजूद, कुछ सार्कोमा में इन प्ररूपी बदलाव ड्राइविंग आणविक तंत्र को संबोधित कर अध्ययन कर रहे हैं।

    सार्कोमा कोशिकाओं में MET की तरह संक्रमण की जांच करने के लिए, हम उपकला कारकों GRHL2 और मीर 200 परिवार की अभिव्यक्ति एक साथ मिलाकर एक MET-प्रेरण मॉडल विकसित किया है। इस विधि तेजी से सार्कोमा कोशिकाओं को प्रेरित करता है के रूप में आकृति विज्ञान और जीन अभिव्यक्ति में परिवर्तन द्वारा मापा अधिक उपकला की तरह बन जाते हैं। सार्कोमा कोशिकाओं में MET प्रेरित करने के लिए इस प्रोटोकॉल का उपयोग समलक्षणियों कि सार्कोमा आक्रामकता, इस तरह के ड्राइव पर ये बदलाव के प्रभाव का अध्ययन की सुविधाप्रवास, आक्रमण, प्रसार और मौत प्रतिरोध और कैसे के रूप में जीव विज्ञान में इन परिवर्तनों में से प्रत्येक दवा प्रतिरोध को प्रभावित कर सकते हैं।

    उपकला व्युत्पन्न कार्सिनोमा के संदर्भ में, एक मेसेंकाईमल कारक की अभिव्यक्ति अक्सर EMT 14 प्रेरित करने के लिए पर्याप्त है। हालांकि, MET दो उपकला कारकों, GRHL2 और मीर 200s की अभिव्यक्ति के इस सार्कोमा व्युत्पन्न मॉडल में, आवश्यक हैं। दिलचस्प बात यह है मीर 200s अकेले, GRHL2 से एमईटी के सबसे बायोमार्कर पर एक मजबूत प्रभाव नहीं पड़ा, जबकि GRHL2 मजबूती के साथ ZEB1 24 के रूप में, केवल उपकला जीन repressors के मीर 200 के आधार पर दमन की उपस्थिति में उपकला जीन को सक्रिय करने के इस तरह के कर रहा था। ऐसा नहीं है कि कुछ मेसेंकाईमल प्रकार की कोशिकाओं के लिए उपकला जीन होने की जरूरत है संभव है दोनों de-दमित (के माध्यम से जैसे मीर 200s) और सक्रिय (जैसे के माध्यम से GRHL2) MET ड्राइव करने के लिए।

    हम अलग-अलग सेल भर में GRHL2 अभिव्यक्ति के स्तर में भिन्नता का अनुभव किया हैएल लाइनों। इस पर काबू पाने के लिए, हम एक GRHL2 अभिव्यक्ति प्लाज्मिड भी EGFP सकारात्मक कोशिकाओं प्रवाह cytometry प्रयोगों से पहले से सॉर्ट करने के EGFP 25 को व्यक्त करता है कि इस्तेमाल किया। यह भी विभिन्न प्रकार की कोशिकाओं में मीर 200s और GRHL2 की कार्यक्षमता को मान्य करने के लिए महत्वपूर्ण है। EMT एक स्पेक्ट्रम उपकला और मेसेंकाईमल जुड़े जीन की अभिव्यक्ति के आधार पर है, जो सेल लाइन, कैंसर के प्रकार, उपचार, आदि इसलिए के आधार पर संदर्भ पर निर्भर भिन्नता हो सकती है के रूप में देखा जाता है, हम करने के लिए मीर 200 या GRHL2 द्वारा विनियमित पांच जीन विश्लेषण किया सेल संदर्भ पर निर्भर परिवर्तन के लिए खाते। इस परख की एक और चेतावनी MET शामिल करने के लिए मीर 200s की एक क्षणिक अभिकर्मक पर निर्भरता है। इस प्रकार, लंबी अवधि के प्रयोगों महंगा और जटिल हो सकता है जब कई दोहराने transfections आवश्यक हो गया है। यह मीर 200 अभिव्यक्ति प्लास्मिड का उपयोग करके दूर किया जा सकता।

    अन्य अध्ययनों से भी सार्कोमा में एमईटी के सबूत सूचना दी है। उदाहरण के लिए, MET leiomyosa के सबसेट में मनाया गयाrcomas और रोगियों के लिए बेहतर अस्तित्व के साथ जुड़े थे। Mechanistically, यांग एट अल। पाया गया कि siRNA साथ स्लग की एक leiomyosarcoma सेल लाइन निषेध में MET की तरह परिवर्तन 29 प्रेरित करने के लिए पर्याप्त था। इसी तरह, अभी तक एक और मेसेंकाईमल कारक, घोंघा, मीजेनकाइमल स्टेम कोशिका में की कमी चूहों 30 में सार्कोमा गठन कम कर दिया। इस प्रकार, यह एक MET की तरह phenotype, जो कोशिका प्रकार के आधार पर भिन्न हो सकते हैं करने के लिए कई रास्ते देखते हैं कि साहित्य से स्पष्ट है। हालांकि इस MET प्रेरित करने के लिए एक ही रास्ता नहीं है, हम rhabdomyosarcoma (आरडी कोशिकाओं) और ऑस्टियो सार्कोमा (143B कोशिकाओं) सहित दो सार्कोमा उपप्रकार, में MET प्रेरित करने के लिए हमारे विधि का इस्तेमाल किया है। भविष्य में, यह सार्कोमा कोशिकाओं का एक व्यापक रेंज में इन विभिन्न तरीकों की तुलना करने के लिए दिलचस्प हो जाएगा। उदाहरण के लिए, कुछ सार्कोमा उपप्रकार अंतर्निहित आनुवंशिक या epigenetic परिवर्तन है कि उन्हें और अधिक या कम MET प्रेरण के लिए अतिसंवेदनशील बनाते है?

    एमईटी के प्रभाव की पहचान करनासार्कोमा कोशिकाओं में जैविक उत्पादन की एक किस्म पर की क्यों अधिक उपकला की तरह सार्कोमा के साथ रोगियों एक बेहतर पूर्वानुमान है एक बेहतर समझ प्रदान कर सकता है। इसके अलावा, राज्यों के बीच प्ररूपी बदलाव ड्राइविंग हमारे जैविक समझ को गहरा और सार्कोमा रोगियों में वर्तमान उपचारों के जवाब पर सूचित पर उपचार के प्रभाव को समझने।

    Subscription Required. Please recommend JoVE to your librarian.

    Disclosures

    लेखकों के पास खुलासे के लिए कुछ भी नहीं है।

    Acknowledgments

    JAS ड्यूक कैंसर संस्थान, ड्यूक विश्वविद्यालय जेनिटोयुरनेरी कैंसर विज्ञान प्रयोगशाला, और विकलांग के ड्यूक विश्वविद्यालय विभाग की ओर से समर्थन मानता है। HL राष्ट्रीय विज्ञान फाउंडेशन (NSF) सैद्धांतिक जैविक भौतिकी के लिए केंद्र द्वारा समर्थित किया गया (NSF PHY-1,427,654) और NSF डीएमएस 1,361,411, और एक CPRIT के रूप में (कैंसर की रोकथाम और टेक्सास के अनुसंधान संस्थान) के टेक्सास राज्य के कैंसर रिसर्च में विद्वान राइस विश्वविद्यालय में। केईडब्लू एनआईएच F32 CA192630 MKJ द्वारा समर्थित किया गया और HL मैरी C फाराच-कार्सन, जे एन Onuchic, समीर M हनाश, केनेथ J पिएंटा, और डोनाल्ड S कॉफ़े के साथ उपयोगी विचार विमर्श से लाभ हुआ।

    Materials

    Name Company Catalog Number Comments
    Countess automated counter Life technologies AMQAX1000
    Countess cell counting chamber slides Invitrogen C10283
    SimpliAmp Thermal Cycler Thermo Fisher A24811
    Odyssey Fc LI-COR Inc
    ViiA7 Real Time PCR System Thermo Fisher 4453536
    PCR microplate Corning 321-29-051
    KAPA SYBR Fast Universal qPCR Kit KAPA Biosystems KK4602
    Starting Block (PBS) Blocking Buffer Thermo Fisher 37538 BSA-based blocking buffer
    Agarose General Purpose LE Genesee Scientific 20-102
    10x Tris/Glycine/SDS Buffer Bio-Rad Laboratories Inc 161-0732 Running buffer
    10x Tris/Glycine Buffer Bio-Rad Laboratories Inc 161-0734 Transfer buffer
    RIPA Buffer Sigma Life Sciences SLBG8489
    Amersham Protran 0.45 μm nitrocellulose GE Healthcare Lifesciences 10600012
    Quick-RNA MiniPrep Kit Genesee Scientific 11-358
    Laemmli Sample Buffer (4X) Bio-Rad Laboratories Inc 1610747
    Mini Trans-Blot Cell Bio-Rad Laboratories Inc 1703930
    Mini-Protean Tetra Cell Bio-Rad Laboratories Inc 1658005EDU
    DPBS Life technologies 14190-144
    0.05% Trypsin-EDTA Life technologies 11995-065
    DMEM Life technologies 11995-065
    Lipofectamine RNAi Max Thermo Fisher 13778150
    Lipofectamine 2000 Ragents Thermo Fisher 11668019
    Penicillin Streptomycin Life technologies 15140-122
    miRVana miRNA mimic negative control #1 Thermo Fisher 4464058 neg miRNA
    hsa-miR-200 mirVana miRNA mimic Thermo Fisher 4464066 miR200A
    has-miR-200 mirVana miRNA mimic Thermo Fisher 4404066 miR200B
    has-miR-200 mirVana miRNA mimic Thermo Fisher 4404066 miR200C
    Opti-MEM Life technologies 11088-021 serum-free media
    anti-Ecadherin antibody BD Bioscience 610182
    anti-beta actin Santa Cruz Biotechnology sc-69879
    anti-EpCam Ab Serotec MCA18706
    anti-ZO1 Invitrogen 402200
    IRDye 800W LI-COR Inc 925-32210
    IRDye 680 LI-COR Inc 926-32223
    anti-mouse AlexaFluor 647 Thermo Fisher A211241
    anti-rabbit AlexaFluor 647 Thermo Fisher ab150075
    Halt Protease and Phosphatesse Inhibitor Thermo Fisher 1861281
    Precision Plus Protein Dual Color Bio-Rad Laboratories Inc 161-0374
    Partec CellTrics Sysmex 04-004-2326 30 μm filter for flow
    GAPDH-F IDT AGCCACATCGCTCAGACAC
    GAPDH-R IDT GCCCAATACGACCAAATCC
    Ecadherin-F IDT TGGAGGAATTCTTGCTTTGC
    Ecadherin-R IDT CGCTCTCCTCCGAAGAAAC
    ZEB1-F IDT GCATACAGAACCCAACTTGAACGTC
    ZEB1-R IDT CGATTACACCCAGACTGC
    NOTCH-F IDT GGCAATCCGAGGACTATGAG
    NOTCH-R IDT CTCAGAACGCACTCGTTGAT
    nitro blue tetrazolium  Sigma N5514
    hexadimethrine bromide Sigma H9268 polybrene
    3 mL syringe BD Bioscience 309657
    Sterile syringe filter VWR 28145-505
    5mL polypropylene round-bottom tube 352063 flow cytometry tubes
    High-Capacity cDNA Reverse Transcription Kit Thermo Fisher 4368814 reverse transcription kit
    4% paraformaldyhyde Santa Cruz Biotechnology sc-281612
    Triton-X100 Sigma 93443
    bovine serum albumin Sigma A7906

    DOWNLOAD MATERIALS LIST

    References

    1. Weber, C. E., Li, N. Y., Wai, P. Y., Kuo, P. C. Epithelial-mesenchymal transition, TGF-beta, and osteopontin in wound healing and tissue remodeling after injury. J Burn Care Res. 33, (3), 311-318 (2012).
    2. Galichon, P., Finianos, S., Hertig, A. EMT-MET in renal disease: should we curb our enthusiasm. Cancer Lett. 341, (1), 24-29 (2013).
    3. Carew, R. M., Wang, B., Kantharidis, P. The role of EMT in renal fibrosis. Cell Tissue Res. 347, (1), 103-116 (2012).
    4. Willis, B. C., Borok, Z. TGF-beta-induced EMT: mechanisms and implications for fibrotic lung disease. Am J Physiol Lung Cell Mol Physiol. 293, (3), L525-L534 (2007).
    5. Ye, X., Weinberg, R. A. Epithelial-Mesenchymal Plasticity: A Central Regulator of Cancer Progression. Trends Cell Biol. 25, (11), 675-686 (2015).
    6. Li, L., Li, W. Epithelial-mesenchymal transition in human cancer: comprehensive reprogramming of metabolism, epigenetics, and differentiation. Pharmacol Ther. 150, 33-46 (2015).
    7. Tsai, J. H., Yang, J. Epithelial-mesenchymal plasticity in carcinoma metastasis. Genes Dev. 27, (20), 2192-2206 (2013).
    8. Bitting, R. L., Schaeffer, D., Somarelli, J. A., Garcia-Blanco, M. A., Armstrong, A. J. The role of epithelial plasticity in prostate cancer dissemination and treatment resistance. Cancer Metastasis Rev. 33, (2-3), 441-468 (2014).
    9. Schaeffer, D., Somarelli, J. A., Hanna, G., Palmer, G. M., Garcia-Blanco, M. A. Cellular Migration and Invasion Uncoupled: Increased Migration Is Not an Inexorable Consequence of Epithelial-to-Mesenchymal Transition. Mol Cell Biol. 34, (18), 3486-3499 (2014).
    10. Mathow, D., et al. Zeb1 affects epithelial cell adhesion by diverting glycosphingolipid metabolism. EMBO Rep. 16, (3), 321-331 (2015).
    11. Ware, K. E., et al. A mechanism of resistance to gefitinib mediated by cellular reprogramming and the acquisition of an FGF2-FGFR1 autocrine growth loop. Oncogenesis. 2, e39 (2013).
    12. Yauch, R. L., et al. Epithelial versus mesenchymal phenotype determines in vitro sensitivity and predicts clinical activity of erlotinib in lung cancer patients. Clin Cancer Res. 11, (24 Pt 1), 8686-8698 (2005).
    13. Jolly, M. K., et al. Towards elucidating the connection between epithelial-mesenchymal transitions and stemness. J R Soc Interface. 11, (101), 20140962 (2014).
    14. Mani, S. A., et al. The epithelial-mesenchymal transition generates cells with properties of stem cells. Cell. 133, (4), 704-715 (2008).
    15. Chen, L., et al. Metastasis is regulated via microRNA-200/ZEB1 axis control of tumour cell PD-L1 expression and intratumoral immunosuppression. Nat Commun. 5, 5241 (2014).
    16. Nicolazzo, C., Gradilone, A. Significance of circulating tumor cells in soft tissue sarcoma. Anal Cell Pathol (Amst). 697395 (2015).
    17. Somarelli, J. A., et al. Mesenchymal-epithelial transition in sarcomas is controlled by the combinatorial expression of miR-200s and GRHL2. Mol Cell Biol. (2016).
    18. Bae, Y. K., Choi, J. E., Kang, S. H., Lee, S. J. Epithelial-Mesenchymal Transition Phenotype Is Associated with Clinicopathological Factors That Indicate Aggressive Biological Behavior and Poor Clinical Outcomes in Invasive Breast Cancer. J Breast Cancer. 18, (3), 256-263 (2015).
    19. Humphries, B., Yang, C. The microRNA-200 family: small molecules with novel roles in cancer development, progression and therapy. Oncotarget. 6, (9), 6472-6498 (2015).
    20. Renner, M., et al. MicroRNA profiling of primary high-grade soft tissue sarcomas. Genes Chromosomes Cancer. 51, (11), 982-996 (2012).
    21. Petrof, G., et al. Mutations in GRHL2 result in an autosomal-recessive ectodermal Dysplasia syndrome. Am J Hum Genet. 95, (3), 308-314 (2014).
    22. Werner, S., et al. Dual roles of the transcription factor grainyhead-like 2 (GRHL2) in breast cancer. J Biol Chem. 288, (32), 22993-23008 (2013).
    23. Werth, M., et al. The transcription factor grainyhead-like 2 regulates the molecular composition of the epithelial apical junctional complex. Development. 137, (22), 3835-3845 (2010).
    24. Somarelli, J. A., et al. Mesenchymal-Epithelial Transition in Sarcomas Is Controlled by the Combinatorial Expression of MicroRNA 200s and GRHL2. Mol Cell Biol. 36, (19), 2503-2513 (2016).
    25. Varma, S., et al. The transcription factors Grainyhead-like 2 and NK2-homeobox 1 form a regulatory loop that coordinates lung epithelial cell morphogenesis and differentiation. J Biol Chem. 287, (44), 37282-37295 (2012).
    26. Pruitt, S. C., Mielnicki, L. M., Stewart, C. C. Analysis of fluorescent protein expressing cells by flow cytometry. Methods Mol Biol. 263, 239-258 (2004).
    27. Zhao, Z., et al. A high-content morphological screen identifies novel microRNAs that regulate neuroblastoma cell differentiation. Oncotarget. 5, (9), 2499-2512 (2014).
    28. Borowicz, S., et al. The soft agar colony formation assay. J Vis Exp. (92), e51998 (2014).
    29. Yang, J., et al. Integrated proteomics and genomics analysis reveals a novel mesenchymal to epithelial reverting transition in leiomyosarcoma through regulation of slug. Mol Cell Proteomics. 9, (11), 2405-2413 (2010).
    30. Alba-Castellon, L., et al. Snail1 expression is required for sarcomagenesis. Neoplasia. 16, (5), 413-421 (2014).
    31. Takaishi, M., Tarutani, M., Takeda, J., Sano, S. Mesenchymal to Epithelial Transition Induced by Reprogramming Factors Attenuates the Malignancy of Cancer Cells. PLoS One. 11, (6), e0156904 (2016).

    Erratum

    Formal Correction: Erratum: Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells
    Posted by JoVE Editors on 07/03/2018. Citeable Link.

    An erratum was issued for: Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells. An author name was updated.

    One of the authors' names was corrected from:

    Shenghan Xu

    to:

    Shengnan Xu

    सारकोमा कोशिकाओं में Mesenchymal-उपकला संक्रमण को प्रेरित करना
    Play Video
    PDF DOI DOWNLOAD MATERIALS LIST

    Cite this Article

    Ware, K. E., Gilja, S., Xu, S., Shetler, S., Jolly, M. K., Wang, X., Bartholf Dewitt, S., Hish, A. J., Jordan, S., Eward, W., Levine, H., Armstrong, A. J., Somarelli, J. A. Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells. J. Vis. Exp. (122), e55520, doi:10.3791/55520 (2017).More

    Ware, K. E., Gilja, S., Xu, S., Shetler, S., Jolly, M. K., Wang, X., Bartholf Dewitt, S., Hish, A. J., Jordan, S., Eward, W., Levine, H., Armstrong, A. J., Somarelli, J. A. Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells. J. Vis. Exp. (122), e55520, doi:10.3791/55520 (2017).

    Less
    Copy Citation Download Citation Reprints and Permissions
    View Video

    Get cutting-edge science videos from JoVE sent straight to your inbox every month.

    Waiting X
    simple hit counter