Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Developmental Biology

Induzione di mesenchimali-epiteliale transizioni in cellule di sarcoma

doi: 10.3791/55520 Published: April 7, 2017

ERRATUM NOTICE

Summary

Presentiamo qui un metodo di coltura cellulare per indurre transizioni mesenchimali-epiteliale (MET) in cellule di sarcoma basato su espressione ectopica combinata di microRNA-200 familiari e grainyhead-like 2 (GRHL2). Questo metodo è adatto per una migliore comprensione dell'impatto biologico della plasticità fenotipica sull'aggressività cancro e trattamenti.

Abstract

plasticità fenotipica si riferisce a un fenomeno in cui le cellule transitoriamente ottenere tratti di un altro lineage. Durante la progressione del carcinoma, plasticità fenotipica spinge l'invasione, la diffusione e le metastasi. Infatti, mentre la maggior parte degli studi di plasticità fenotipica sono stati nel contesto di carcinomi epiteliali derivate, si scopre sarcomi, che sono mesenchimali in origine, anche esibire plasticità fenotipica, con un sottoinsieme di sarcomi subire un fenomeno che assomiglia a un mesenchymal- transizione epiteliale (TEM). Qui, abbiamo sviluppato un metodo comprendendo la famiglia miR-200 e grainyhead-like 2 (GRHL2) per imitare questo fenomeno MET-come osservato nel sarcoma paziente samples.we sequenzialmente esprimono GRHL2 e la famiglia miR-200 utilizzando la trasduzione delle cellule e trasfezione, rispettivamente , per meglio comprendere le basi molecolari di queste transizioni fenotipiche in cellule di sarcoma. cellule di sarcoma che esprimono miR-200 e GRHL2 hanno dimostrato una maggiore caratteristica atmosfera epitelialeCI della morfologia cellulare e le modificazioni del epiteliali e mesenchimali biomarker. Studi futuri usando questi metodi possono essere utilizzati per comprendere meglio le conseguenze fenotipiche dei processi MET simili su cellule di sarcoma, quali la migrazione, invasione, propensione metastatica, e resistenza alla terapia.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

plasticità fenotipica si riferisce ad una transizione reversibile tra fenotipi cellulari, ed è generalmente suddiviso in due tipi, epiteliali-to-mesenchimale (EMT) transizioni e mesenchimali-to-epiteliale transizioni (TEM). Questa plasticità fenotipica gioca un ruolo importante nei normali processi di organismi multicellulari, come lo sviluppo e la guarigione della ferita 1; tuttavia, questi stessi percorsi e programmi di espressione genica può anche portare a malattie come la fibrosi (valutata in 2, 3, 4) e carcinoma metastasi (valutata in riferimento 5, 6, 7, 8). Durante la metastasi, per esempio, EMT sconvolge la polarità delle cellule, le interazioni cellula-cellula, e promuove l'invasione 9, 10. Insieme, EMT contribuires ad uno stato fenotipico che facilita la diffusione delle cellule tumorali. Inoltre, EMT comporta anche una serie di altre alterazioni fenotipiche che guidano un fenotipo aggressivo, tra deregolazione del metabolismo delle cellule del cancro 6, lo sviluppo di resistenza ai farmaci 11, 12, maggiore capacità tumore-apertura 13, 14 e ospitare evasione immune 15.

plasticità fenotipica è stato ben studiato nella progressione carcinoma; Tuttavia, sarcomi presentano inoltre plasticità fenotipica. È interessante notare che sembra come se alcuni degli stessi conducenti di plasticità fenotipica in carcinomi contribuiscono anche al sarcoma plasticità e l'aggressività. Ad esempio, è stato dimostrato cellule tumorali circolanti (CTC) di pazienti con sarcoma di esprimere EpCAM, una proteina di superficie cellulare che si trova in genere su cellule epiteliali 16. Addizionale, 250 campioni sarcomi dei tessuti molli sono stati classificati come epiteliali simile o mesenchimali come base di espressione genica. I pazienti nella firma biomarker epiteliale simile hanno avuto una prognosi migliore rispetto ai pazienti con la firma biomarcatore mesenchimali simil-17. Ciò è coerente con molti carcinomi, in cui i pazienti con più carcinomi epiteliali-come hanno risultati migliori rispetto ai pazienti con più tumori mesenchimali simil-18.

Mentre alcuni sarcomi visualizzano biomarker e percorsi di espressione genica coerenti con il TEM, le basi molecolari di questa plasticità fenotipica rimangono poco compresi. Per studiare i meccanismi e gli autisti di MET nel sarcoma abbiamo sviluppato un modello di induzione MET usando due fattori specifici epiteliali, il microRNA (miR) -200 famiglia e grainyhead-like 2 (GRHL2). I miR-200 sono una famiglia di piccoli RNA non codificanti che regolano l'espressione genica legandosi alla UTR di messen 3'ger RNA e prevenire traduzione in proteina. La famiglia miR-200 è costituito da due sottogruppi - uno contenente miR-141 e miR-200a, e l'altro tra cui miR-200b, 200c-miR, e miR-429. I membri della famiglia miR-200 sono arricchite nei tessuti epiteliali, e la perdita di miR-200 è associata con metastasi nei carcinomi 19. La famiglia miR-200 è anche downregulated in sarcomi dei tessuti molli rispetto al tessuto normale 20. Simile alle MIR-200s, GRHL2 è un regolatore chiave che è importante per lo sviluppo epiteliale 21. Il fattore di trascrizione GRHL2 agisce in due modi per upregulate geni epiteliali, come E-caderina: 1) Nelle cellule epiteliali, GRHL2 reprime direttamente il principale regolatore EMT, ZEB1 22; e 2) GRHL2 direttamente attiva la trascrizione dei geni epiteliali 23. Le nostre indagini precedenti hanno dimostrato che l'espressione combinata di miR-200 e GRHL2 in cellule di sarcomainduce un fenotipo MET simile 24. Qui, presentiamo un protocollo dettagliato per creare un modello in vitro del TEM induzione in cellule di sarcoma usando l'espressione ectopica di miR-200 e GRHL2.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Preparazione dei reagenti

  1. Preparare DMEM per coltura cellulare aggiungendo 50 ml di siero fetale bovino (FBS) e 5 mL di penicillina-streptomicina (5.000 U / ml) a 500 ml di DMEM. Questo terreno può essere conservato a 4 ° C per un massimo di sei mesi.
  2. Risospendere primer liofilizzati in acqua priva di nucleasi ad una concentrazione finale di 10 uM. primer negozio risospese a -20 ° C.
  3. Preparare dosaggio radioimmunoprecipitazione (RIPA) tampone (150 mM NaCl, 0.5% desossicolato sodico, 0,1% SDS, 50 mM Tris, pH 8,0). Supplemento con cocktail inibitore della proteasi prima dell'uso e mantenere tampone sul ghiaccio quando è in uso. Conservare a 4 ° C.
  4. Preparare 10 mg / mL polibrene (hexadimethrine bromuro) filtro acqua e la siringa per sterilizzare utilizzando un filtro polietersulfone 0,45 um. Soluzione può essere conservato a 4 ° C per un massimo di sei mesi.
  5. Preparare una soluzione di 1 mg / ml di lavoro del nitro blu tetrazolio cloruro sciogliendo 10 mg in 10 ml di PBS. Conservare a 4 ° C.

2. lentivirali trasduzione del GRHL2

Giorno 1

  1. Piastra 3 x 10 5 cellule HEK293T per pozzetto di una piastra da 6 pozzetti in 2 ml di DMEM supplementato. Quantificare cellule utilizzando un contatore automatico di cellule. Le cellule devono essere 40 - 60% confluenti dopo coltura di una notte a 37 ° C con 5% di CO 2.

Giorno 2

  1. Diluire 2 pg di vettore vuoto (pCMV-UBC-EGFP) o 2 pg di pCMV-GRHL2-UBC-EGFP 24, 25 in 200 ml di mezzo privo di siero insieme con 1,8 ug di pΔ8.9 e 0,2 pg di pCMV-VSV plasmidi helper -G. In un tubo separato, diluire 4 ml di una base lipidica reagente di trasfezione in 200 ml di mezzo privo di siero per ogni trasfezione (8 ml in 400 microlitri per due campioni). Aggiungere 200 microlitri di miscela reagente di trasfezione per ogni soluzione plasmide e incubare per 20 minuti a temperatura ambiente.
  2. Durante l'incubazione, lavare le cellule HEK293T rimuovendo il mezzo mediante aspirazione sottovuoto e risciacquo cellule con 1 ml di PBS. Sostituire il PBS con 800 ml di mezzi senza siero. Dopo 20 minuti, aggiungere 200 ml di reagente di trasfezione: miscela plasmide dal punto 2.2 a gocce a ciascun pozzetto e incubare le cellule per 2 ore a 37 ° C in 5% CO 2.
  3. rimuovere accuratamente mezzo trasfezione mediante aspirazione a vuoto e sostituirlo con 2 mL di supplementato DMEM. Riportare le cellule per l'incubatore per la cultura durante la notte.
    NOTA: le cellule HEK293T sono vagamente aderente. sostituzione dei supporti deve essere effettuata con cautela per limitare la rimozione delle cellule dal fondo del piatto o del matraccio.

3 ° giorno

  1. Aggiornare multimediale su cellule trasfettate e HEK293T piastra 3 x 10 5 cellule RD per pozzetto di una piastra da 6 pozzetti in 2 ml di DMEM supplementato. cellule cultura durante la notte. cellule RD sono una linea cellulare di rabdomiosarcoma umano disponibile in commercio.

4 ° giorno

  • Raccogliere media virali dalle cellule HEK293T. Pipettare il supporto DMEM dalle cellule HEK293T e posto in un nuovo 15 ml conica. Ricollocare accuratamente con i nuovi media e cellule DMEM posto HEK293T indietro in incubatrice per il giorno successivo.
  • Aggiungere 2 ml di 10 mg / mL polibrene per mL di mezzi virali in due nuove provette coniche 50 ml (uno per il vettore trasfezione vuota e un'altra per la trasfezione GRHL2). Filtro per siringa media virali rimuovendo lo stantuffo di una siringa da 3 ml e allegare un filtro da 0,45 micron polietersulfone alla punta.
    1. Aggiungere i media virali raccolti nella fase 2.6 nel cilindro della siringa, e immergersi supporti nelle nuove provette coniche da 50 ml contenente polibrene. Rimozione di supporti da cellule RD mediante aspirazione a vuoto e aggiungere media viral filtrato cellule RD.
  • 5 ° giorno

    1. Ripetere Giorno 4. Cellule HEK293T possono essere scartati dopo che i media virale è stato raccolto.

    giorno 7

    1. Lavare le cellule RD con 1 ml di PBS e aggiungere 200 ml di 0,05% tripsina per pozzetto. Incubare a 37 ° C per 5 minuti, aggiungere 2 ml di terreni integrati, e spostare sospensione cellulare in un 15 ml conica. cellule centrifugare a 250 xg per 5 minuti a temperatura ambiente e dei media aspirare. Risospendere in 1 ml di DMEM (supplementato con 5% FBS e 1% di penicillina-streptomicina).
      NOTA: Utilizzando una percentuale maggiore di FBS può causare intasamenti durante citofluorimetria
      1. celle filtranti per citometria di flusso. Utilizzare una pipetta per applicare la sospensione cellulare 1 mL RD attraverso un filtro 30 um in citofluorimetria tubi e Consiglio di tubi su ghiaccio.
      2. EGFP + cellule Ordina 26 in provette da 1,5 ml microcentrifuga contenenti 0,5 ml di DMEM supplementato con 10% FBS e 1% di penicillina-streptomicina e posto sul ghiaccio. Piastra EGFP + cellule in totale di 1 ml di DMEM supplementato ordinati in un singolo pozzetto di una piastra 12 pozzetti e posto in incubatore per coltura.
        ; NOTA: La resa di cellule EGFP + da citofluorimetria dopo trasduzione è solitamente bassa (50.000-100.000 cellule). Le cellule possono avere bisogno di essere in coltura per 10 - 14 giorni prima di procedere alla fase 3.

    3. Reverse trasfezione di Mir-200s

    1. Preparare 50 uM scorte di miR-200 imita utilizzando priva di nucleasi H 2 O. scorte aliquote e conservare a -20 ° C per evitare ripetuti cicli di congelamento / scongelamento.
    2. Aggiungere 3 ml di ogni 50 pM miR-200 mimico (miR-200a, miR-200b, e miR-200c) a 300 ml di mezzo privo di siero o 9 ml di 50 mM miRNA controllo negativo a mezzo privo di siero 300 microlitri.
    3. Aggiungere 6 ml di specifici siRNA reagente di trasfezione per 600 ml di mezzo privo di siero e dividere 300 ml di questa miscela in due tubi, uno per ciascuna delle due miscele miR dal punto 3.2. Combinare i 300 ml di ciascuna miscela miR dal passo 3.2 con una miscela di 300 ml di reagente di trasfezione. Incubare per 20 min a camera temperature.
    4. Durante l'incubazione preparare una sospensione cellulare di 600.000 cellule EGFP + RD esprimenti EV o GRHL2 creato nella sezione 2 in 2.4 mL (250 cellule / pl) di mezzo privo di siero per ogni trattamento.
    5. In una piastra a 24 pozzetti, aggiungere 100 microlitri per pozzetto di miR-200 della miscela o della miscela di controllo negativo dal punto 3.3 in sei pozzetti e quindi aggiungere 400 ml di ciascuna sospensione cellulare in tre pozzetti di ogni miscela miR.
    6. Incubare le cellule a 37 ° C in 5% di CO 2 durante la notte e cambiare media per integrati pienamente DMEM il giorno seguente. Raccogliere celle 2 giorni più tardi per analisi utilizzando tampone appropriato (vedi sotto). time-lapse imaging di cellule di sarcoma RD sottoposti TEM è disponibile come materiale supplementare. Immagine ciascun pozzetto ogni 2 h con un obiettivo 10X utilizzando un processo automatizzato imager live-cell 27.

    4. estrazione dell'RNA, trascrizione inversa e qPCR

    1. Estrarre l'RNA secondo le istruzioni del costruttore, utilizzando un RNA di seriekit di estrazione 24. RNA estratto può essere conservato a -80 ° C.
    2. Quantificare concentrazione di RNA. Scongelare e lavorare con l'RNA sul ghiaccio. Per quantificare le concentrazioni di RNA, misurare l'assorbanza UV a 260 nm con uno spettrofotometro lettore di piastre secondo il protocollo del produttore. Diluire tutti i campioni per la più bassa concentrazione di acqua priva di nucleasi.
    3. Eseguire la trascrizione inversa di RNA totale in DNA complementare (cDNA). Combinare non inferiore a 100 ng di RNA totale con tampone PCR, miscela dNTP (100 mM), primer esameriche casuali, trascrittasi inversa e acqua priva di nucleasi in un volume di reazione di 20 microlitri 24. Eseguire cicli RT secondo il protocollo del produttore. cDNA può essere immagazzinato a lungo termine a -20 ° C.
    4. Diluire 20 reazioni microlitri a 100 microlitri con 80 ml di priva di nucleasi H 2 O.
    5. Mescolare 5 ml di una fluorescenza a base di colorante intercalante 2x qPCR master mix, 0,06 ml di ogni 10 micron di primer, unnd 2 microlitri di reazione RT diluito per campione.
    6. Eseguire qPCR secondo il protocollo del produttore per il master mix basato sulla fluorescenza.
    7. Quantificare quantità relative di mRNA mediante il metodo CT delta e normalizzare a GAPDH. Tracciare l'espressione dell'mRNA medio di repliche biologiche ± deviazione standard per ciascun gruppo di trattamento.
      NOTA: devono essere prese precauzioni speciali quando si lavora con l'RNA per evitare il contatto con RNasi, come l'utilizzo della plastica e dei reagenti RNasi-free. materiali riutilizzabili devono essere trattati prima dell'uso per rimuovere RNasi.

    5. Immunofluorescenza

    1. Seguendo passo 3.6, supporti aspirato mediante aspirazione a vuoto da cellule RD in formato a 24 pozzetti.
    2. Fissare cellule aggiungendo 500 ml di 4% paraformaldeide (PFA) per pozzetto ed incubare per 15 minuti a temperatura ambiente (RT). Seguendo fissazione, Consiglio di cellule in soluzione salina tamponata con fosfato (PBS) e conservare a 4 ° C per una notte, se necessario.
    3. permeabilizecellule aggiungendo 500 ml di PBS + 0,2% Triton-X100 e incubare 30 minuti a temperatura ambiente. Mediante aspirazione a vuoto, rimuovere il tampone permeabilizzazione e lavare tre volte con PBS.
    4. Blocco in 500 ml di 5% di albumina sierica bovina (BSA) / PBS e incubare le cellule per 30 minuti a RT. Cellule possono essere conservate a 4 ° C per una notte, se necessario.
    5. Preparare la diluizione anticorpo primario. Pipettare 200 ml di 5% BSA / PBS per pozzetto in una conica 15 mL (12 pozzetti = 2,4 mL) e aggiungere 1 ml di anticorpo primario per ml di 5% BSA / PBS necessaria. Rimuovere tampone bloccante mediante aspirazione a vuoto e dispensare 200 microlitri di anticorpo primario diluito ad ogni pozzetto.
      1. Incubare le cellule in 1: 1.000 diluiti anticorpi primari in 5% BSA / PBS per 1 ora a RT o durante la notte a 4 ° C. Dopo l'incubazione, lavare le cellule due volte con PBS.
    6. Preparare la diluizione anticorpo secondario nello stesso volume di 5% BSA / PBS come sopra. Aggiungere l'anticorpo secondario rosso lontano colorante-coniugato con una diluizione 1: 2.000. Inoltre aggiungi1 mg / mL di Hoechst colorante per il mix. Rimuovere il PBS e aggiungere 200 ml di miscela per ogni pozzetto.
      1. Incubare a RT per 1 ora al buio. Lavare 3 volte con PBS, le cellule lasciare in PBS, e proteggere le cellule dalla luce con un foglio. Cellule possono essere conservate a 4 ° C, se necessario.
    7. celle di immagine a 400X ingrandimento totale con un microscopio a epifluorescenza invertita con lunghezza d'onda di eccitazione 594 - 650 nm.

    6. Western Blotting

    1. Lavare le cellule da 3.6 due volte con PBS ghiacciato. In ghiaccio, le cellule Lisare con 50 ml di 1x RIPA buffer di integrate con 1x cocktail di inibitori delle proteasi.
    2. lisati Rock a 4 ° C per 15 min, raccolgono lisati in provette da 1,5 mL, e centrifugare ad alta velocità (20.000 xg) per 5 minuti per chiarire campioni. I lisati cellulari possono essere conservati a lungo termine a -80 ° C, se necessario.
    3. Quantificare proteina totale utilizzando un saggio Bradford e un'aliquota una pari quantità di proteina in nuove provette da microcentrifuga da 1,5 ml. Brincampioni g a parità di volume, con tampone RIPA e tampone di caricamento 3x Laemmli integrato con 2-mercaptoetanolo.
    4. Incubare campioni in 1x Laemmli buffer di caricamento del campione per 5 min a 95 ° C ed eseguire SDS-PAGE usando un gel Tris-glicina 4-12% a 200 V per 45 minuti. La quantità di catene proteiche caricata a seconda della linea cellulare. In alcuni casi, è necessario 50-100 pg di proteina totale per rilevare E-caderina in cellule mesenchimali.
    5. proteine ​​di trasferimento su una membrana di nitrocellulosa per 2 ore a 50 V in tampone di trasferimento 1x Tris-glicina.
    6. Blocco membrana per 1 ora a temperatura ambiente o per una notte a 4 ° C in tampone bloccante BSA-based.
    7. Diluire anticorpi primari a 1: 1.000 concentrazione in 5 mL di tampone bloccante, aggiungere diluizione alla membrana, e incubare con delicata dondolo per 1 ora a temperatura ambiente o per una notte a 4 ° C. membrana lavata 3 volte in PBS con 0,05% Tween-20.
    8. Incubare membrane per 1 ora a temperatura ambiente con secondar fluorescente accoppiati infrarossiy anticorpo a 1: 20.000 diluizione nel tampone di bloccaggio come sopra.
    9. Lavare membrana due volte in PBS con 0,05% Tween-20 e poi una volta in PBS.
    10. Membrana Immagine utilizzando il rilevamento della fluorescenza a raggi infrarossi standard.

    7. saggi crescita ancoraggio-indipendente

    NOTA: Per una dettagliata morbido protocollo del test agar, vedere 28.

    1. Calda sterile supporti 2x DMEM al 42 ° C in bagno di acqua calda. Durante questo tempo, il calore pre-autoclave 1% agarosio nel microonde per 3 minuti. Microonde per altri 30 s per volta, se necessario o fino a quando completamente sciolto. Spostare agarosio ad un bagno d'acqua C 42 °.
    2. Posizionare una provetta da 50 ml in un becher con 42 ° C acqua in una cappa sterile e mescolare 1% agarosio e supporti 2x DMEM in un rapporto 1: 1 contabilità per 1,5 ml di miscuglio per pozzetto in una piastra da 6 pozzetti. Sempre preparare in più DMEM / agarosio per tenere conto di errori di pipettamento e per evitare le bolle.
    3. Aggiungete il composto alpareti del pozzo, assicurando bolle si formano e lasciate riposare per 30 minuti a RT.
    4. Mentre lo strato inferiore è solidificazione, preparare ciascun gruppo di cellule trasfettate RD nel passaggio 3 aspirando media e lavare una volta con 1 ml di PBS. Aspirare PBS e aggiungere 0,2 ml di 0,05% tripsina e incubare a 37 ° C per 5 min.
    5. Neutralizzare tripsina in 0,8 mL di media e cellule Triturare per formare una cella singola sospensione. Trasferimento sospensione cellulare in un tubo da 15 ml.
    6. Contare le cellule e calcolare il volume di sospensione cellulare richiesto per 10.000 cellule per pozzetto.
    7. Riscaldare 0,6% agarosio nel microonde per 3 min, seguiti da 30 s alla volta fino completamente sciolto. Spostare agarosio a 42 ° C bagnomaria.
    8. Posizionare una provetta da 50 ml in un becher con 42 ° C acqua in una cappa sterile. Mescolare 0,6% agarosio e sospensione cellulare diluita in un rapporto 1: 1 per preparare 1,5 ml di miscela per pozzetto in una piastra da 6 pozzetti. Sempre preparare sospensione cellulare extra / agarosio mix per tenere conto di errori pipettaggio eper evitare bolle.
      NOTA: E 'importante lavorare a 42 ° C qui. Se la temperatura è troppo bassa la miscela solidificare prima placcatura, e temperature superiori a 42 ° C influenzerà vitalità cellulare.
    9. Mescolare bene triturando cellule diverse volte e aggiungere miscela di cellule nei pozzetti, garantendo che non forma bolle e lasciate solidificare per 20 minuti a RT.
    10. Aggiungere 2 ml di media integrate ad ogni bene e passare piastre per incubatrice.
      1. Modificare i media una volta alla settimana per 3-4 settimane o fino a quando le colonie multicellulari formano. Fare attenzione a non toccare l'agar quando si rimuove media da parte aspirazione a vuoto. In alternativa, utilizzare un P1000 per rimuovere lo strato superiore di liquidi.
      2. Macchiare molli piastre di agar aggiungendo 200 ml di soluzione di cloruro Nitro Blu tetrazolo (1 mg / ml in PBS) e incubare la piastra per una notte a 37 ° C. Sostituire i media il giorno dopo con PBS per l'imaging.
      3. pozzi Immagine a 40X di ingrandimento totale di un microscopio invertito.
      4. Eseguire l'analisi su ImageJ per l'area della colonia e il numero. Trama numero medio colonia di repliche biologiche ± deviazione standard.

    Subscription Required. Please recommend JoVE to your librarian.

    Representative Results

    or Start trial to access full content. Learn more about your institution’s access to JoVE content here

    Schema per l'induzione MET in cellule di sarcoma

    Una cronologia generale per l'induzione di modifiche MET simili in cellule di sarcoma è mostrato in Figura 1. Il protocollo inizia trasduzione GRHL2 (Figura 1A), seguita da trasfezione della famiglia miR-200 (Figura 1B). familiari GRHL2 o miR-200 non erano in grado di influenzare l'aspetto delle cellule RD quando espresso da solo, ma l'espressione ectopica di GRHL2 e MIR-200s insieme provoca cambiamenti morfologici epiteliali-simili in cellule RD. Cellule transizione da una forma a forma di fuso ad un aspetto più arrotondato con maggiore contatto cellula-cellula (Figura 1C).

    L'induzione di cambiamenti MET-come in cellule di sarcoma

    La variazione morfologica in cellule RD su GRHL2 e miR-200sovraespressione è stata accompagnata da sovraregolazione della epiteliale marcatore E-caderina (Figura 2A). Aggiunta di mir-200s upregulated caderina-alone, ma combinato mir-200 e GRHL2 sovraespressione sinergicamente aumentata espressione E-caderina (Figura 2A; non scala logaritmica). Inoltre, v'è stato un aumento alle giunzioni cellula-cellula epiteliale di molecole di adesione, EpCAM e TJP1, frecce bianche (noto anche come occludere Zona 1, ZO-1) (Figura 2B).

    induzione MET diminuisce la capacità di formazione della colonia cellule di sarcoma

    Upregulation di proteine epiteliali è stata accompagnata da sottoregolazione di geni mesenchimali Zeb1 e Notch1 (Figura 3A), che sono noti per bersagli miR-200. Induzione del TEM ridotto la crescita ancoraggio-indipendente di cellule RD misurata dal numero di colonie (Figura 3B). Questo growth l'inibizione è stata trainata dalle sole miR-200; come sovraespressione di GRHL2 portato ad un aumento della crescita indipendente ancoraggio (Figura 3). Ciò è coerente con precedenti relazioni che mostrano espressione GRHL2 induce la crescita ancoraggio-indipendente 22.

    Figura 1
    Figura 1: temporale del TEM induzione con GRHL2 sovraespressione e miR-200 Trasfezione. (A) temporale di espressione eccessiva ectopica di GRHL2 nelle cellule bersaglio. (B) temporale del TEM induzione mediante trasfezione inverso familiari miR-200 in cellule bersaglio. (C) GRHL2 e miR-200 sovraespressione portato a cambiamenti nella morfologia delle cellule bersaglio coerenti con TEM. Barra di scala = 75 micron Clicca quiper visualizzare una versione più grande di questa figura.

    figura 2
    Figura 2: Simultanea sovraespressione di GRHL2 e MIR-200s LED per MET in cellule bersaglio. (A) Espressione di Mir-200s portato all'espressione E-caderina elevata mentre l'espressione combinata di GRHL2 e miR-200 prodotto un effetto sinergico sull'espressione E-caderina sia a mRNA (valori medi ± deviazione standard) ei livelli di proteina. (B) espressione combinata di GRHL2 e MIR-200s portato ad aumentata espressione di EpCAM e TJP1 a contatti cellula-cellula (frecce). bar scala = 20 um. * Indica p <0.05 analizzati mediante ANOVA con post-hoc correction.This figura di Tukey è stato modificato dal riferimento 24. Copyright © American Society for Microbiology, biologia molecolare delle cellule, il volume 36, Numero 19, 2503-2513, 2016. Si prega di cliccare qui per vedere una versione più grande di questa figura.

    Figura 3
    Figura 3: Espressione di Mir-200S Sopprime mesenchimali marker e diminuisce crescita ancoraggio-indipendente in cellule di sarcoma. (A) sopra - espressione di miR-200 ma non GRHL2 inibisce l'espressione Zeb1 e Notch1 mRNA (valori medi ± deviazione standard). (B) Over-espressione di mir-200s ma non GRHL2 resistenza anoikis inibita in cellule di sarcoma. Immagini rappresentative di colonie macchiati (Scala bar = 200 um) e quantificazione del numero di colonie (valori medi ± deviazione standard) sono mostrati. * Indica p <0.05 analizzati utilizzando ANOVA con il post-hoc correction.This figura di Tukey è stato modificato da rRiferimenti 24. Copyright © American Society for Microbiology, biologia molecolare delle cellule, il volume 36, Numero 19, 2503-2513, 2016. Si prega di cliccare qui per vedere una versione più grande di questa figura.

    Figura 3
    Video Supplemento: cellule che esprimono RD vettore vuoto e miRNA controllo negativo. Video sono stati compilati da immagini di cellule RD trasfettate con vettore vuoto e miRNA controllo negativo acquisiti ogni due ore utilizzando un processo automatizzato imager live-cell. Clicca qui per visualizzare questo video. (Tasto destro del mouse per scaricare).

    Figura 3 />
    Supplemental Video 2: Le cellule che esprimono RD miRNA controllo negativo GRHL2-EGFP e. Video sono stati compilati da immagini di cellule trasfettate con RD GRHL2-EGFP e miRNA controllo negativo acquisiti ogni due ore utilizzando un processo automatizzato imager live-cell. Clicca qui per visualizzare questo video. (Tasto destro del mouse per scaricare).

    Figura 3
    Supplemental Video 3: Le cellule RD Esprimere vettore vuoto e miR200 miRNA. Video sono stati compilati da immagini di cellule RD trasfettate con vettore vuoto e miR200 miRNA acquisiti ogni due ore utilizzando un processo automatizzato imager live-cell. Clicca qui per visualizzare questo video. (Tasto destro del mouse per scaricare).

    nt" fo: keep-together.within-page = "1"> Figura 3
    Supplemental video 4: Celle RD Esprimendo GRHL2-EGFP e miR200 miRNA. Video sono stati compilati da immagini di cellule trasfettate con RD GRHL2-EGFP e miR200 miRNA acquisiti ogni due ore utilizzando un processo automatizzato imager live-cell. Clicca qui per visualizzare questo video. (Tasto destro del mouse per scaricare).

    Subscription Required. Please recommend JoVE to your librarian.

    Discussion

    or Start trial to access full content. Learn more about your institution’s access to JoVE content here

    I sarcomi sono rari, ma altamente aggressivi tumori di un lignaggio mesenchimale. Nonostante la loro lignaggio mesenchimali, un sottogruppo di sarcomi sembra subire una transizione fenotipica ad un epiteliale stato simile più. Questo interruttore TEM-like ha rilevanza prognostica, come pazienti con più tumori epiteliali-simili sono meno aggressivi 24. Nonostante la loro rilevanza clinica, ci sono pochi studi che riguardano i meccanismi molecolari mappa queste transizioni fenotipiche in sarcomi.

    Per esaminare transizioni MET simili in cellule di sarcoma, abbiamo sviluppato un modello MET-induzione combinando espressione dei fattori epiteliali GRHL2 e la famiglia miR-200. Questo metodo induce rapidamente cellule di sarcoma di diventare più epiteliale simile come misurato da alterazioni nella morfologia e l'espressione genica. Usando questo protocollo per indurre MET in cellule di sarcoma facilita lo studio degli effetti di queste transizioni sui fenotipi che guidano sarcoma aggressione, talecome la migrazione, l'invasione, la proliferazione e la resistenza alla morte e come ciascuno di questi cambiamenti nella biologia possono influenzare la resistenza ai farmaci.

    Nel contesto di carcinomi epiteliali derivate, espressione di un fattore mesenchimali è spesso sufficiente a indurre EMT 14. Tuttavia, in questo modello sarcoma-derivato del TEM espressione di due fattori epiteliali, GRHL2 e miR-200, sono richiesti. È interessante notare che i mir-200s da sola aveva un effetto maggiore sulla maggior biomarker di MET di GRHL2, mentre GRHL2 era in grado di attivare i geni robusto epiteliali solo in presenza di repressione miR-200 a base di repressori gene epiteliali, come ZEB1 24. È possibile che per alcuni tipi di cellule mesenchimali geni epiteliali devono essere sia de-represso (ad esempio tramite MIR-200s) ed attivato (ad esempio attraverso GRHL2) per guidare il TEM.

    Abbiamo sperimentato variazione nei livelli di espressione GRHL2 tutta diversa cell linee. Per superare questo, abbiamo utilizzato un plasmide di espressione che esprime anche GRHL2 EGFP 25 per ordinare in citometria a flusso cellule positive EGFP prima esperimenti. È anche fondamentale per convalidare la funzionalità di mir-200 e GRHL2 in differenti tipi cellulari. EMT è visto come uno spettro basata sull'espressione di geni epiteliali e mesenchimali associati, che possono avere variazioni dipendenti dal contesto basato su linea cellulare, il tipo di cancro, trattamento, ecc Pertanto, abbiamo analizzato cinque geni regolati da miR-200 o GRHL2 a tener conto delle variazioni dipendenti dal contesto cellulari. Un altro avvertimento di questo saggio è la dipendenza da una trasfezione transiente di miR-200 per il TEM induzione. Così, gli esperimenti a lungo termine possono diventare costoso e complicato quando più trasfezioni ripetute diventano necessari. Questo può essere superato utilizzando miR-200 plasmidi di espressione.

    Altri studi hanno anche riportato la prova di MET in sarcomi. Per esempio, il TEM è stato osservato in un sottogruppo di leiomyosarcomas ed è stata associata con una migliore sopravvivenza per i pazienti. Meccanicisticamente, Yang et al. trovato che in una linea cellulare inibizione leiomiosarcoma di Slug con siRNA era sufficiente per indurre TEM-like modifiche 29. Analogamente, deplezione di ancora un altro fattore mesenchimali, lumaca, in cellule staminali mesenchimali ridotta formazione sarcoma nei topi 30. Pertanto, è chiaro dalla letteratura che esistono più percorsi di un fenotipo TEM-simili, che può variare da tipo cellulare. Anche se questo non è l'unico modo per indurre il TEM, abbiamo usato il nostro metodo per indurre MET in due sottotipi di sarcoma, compresi rabdomiosarcoma (cellule RD) e osteosarcoma (143B cellule). In futuro, sarebbe interessante confrontare questi metodi differenti in una gamma più ampia di cellule di sarcoma. Ad esempio, non alcuni sottotipi di sarcoma hanno alterazioni genetiche o epigenetiche sottostanti che li rendono più o meno sensibili al TEM induzione?

    Identificare l'impatto di METsu una varietà di uscite biologici in cellule sarcomi potrebbe fornire una migliore comprensione del perché i pazienti con più sarcomi epiteliali simile ad un miglior prognosi. Inoltre, comprendere l'impatto del trattamento sulla guida le transizioni fenotipiche tra gli stati avrebbero approfondire la nostra comprensione biologica e informare sulla risposta alle attuali terapie nei pazienti sarcoma.

    Subscription Required. Please recommend JoVE to your librarian.

    Disclosures

    Gli autori non hanno nulla da rivelare.

    Acknowledgments

    JAS riconosce il sostegno del duca Cancer Institute, The Duke University genito-urinario Laboratorio di Oncologia, e il Dipartimento di Ortopedia dell'Università Duke. HL è stato sostenuto dalla National Science Foundation (NSF) Centro di Fisica Teorica biologica (NSF PHY-1.427.654) e NSF DMS-1.361.411, e come un CPRIT (prevenzione del cancro e Research Institute del Texas) Scholar Ricerca sul Cancro dello Stato del Texas alla Rice University. KEW stato supportato dal NIH F32 CA192630 MKJ e HL beneficiato utili discussioni con Mary C. Farach-Carson, JN Onuchic, Samir M. Hanash, Kenneth J. Pienta, e Donald S. Coffey.

    Materials

    Name Company Catalog Number Comments
    Countess automated counter Life technologies AMQAX1000
    Countess cell counting chamber slides Invitrogen C10283
    SimpliAmp Thermal Cycler Thermo Fisher A24811
    Odyssey Fc LI-COR Inc
    ViiA7 Real Time PCR System Thermo Fisher 4453536
    PCR microplate Corning 321-29-051
    KAPA SYBR Fast Universal qPCR Kit KAPA Biosystems KK4602
    Starting Block (PBS) Blocking Buffer Thermo Fisher 37538 BSA-based blocking buffer
    Agarose General Purpose LE Genesee Scientific 20-102
    10x Tris/Glycine/SDS Buffer Bio-Rad Laboratories Inc 161-0732 Running buffer
    10x Tris/Glycine Buffer Bio-Rad Laboratories Inc 161-0734 Transfer buffer
    RIPA Buffer Sigma Life Sciences SLBG8489
    Amersham Protran 0.45 μm nitrocellulose GE Healthcare Lifesciences 10600012
    Quick-RNA MiniPrep Kit Genesee Scientific 11-358
    Laemmli Sample Buffer (4X) Bio-Rad Laboratories Inc 1610747
    Mini Trans-Blot Cell Bio-Rad Laboratories Inc 1703930
    Mini-Protean Tetra Cell Bio-Rad Laboratories Inc 1658005EDU
    DPBS Life technologies 14190-144
    0.05% Trypsin-EDTA Life technologies 11995-065
    DMEM Life technologies 11995-065
    Lipofectamine RNAi Max Thermo Fisher 13778150
    Lipofectamine 2000 Ragents Thermo Fisher 11668019
    Penicillin Streptomycin Life technologies 15140-122
    miRVana miRNA mimic negative control #1 Thermo Fisher 4464058 neg miRNA
    hsa-miR-200 mirVana miRNA mimic Thermo Fisher 4464066 miR200A
    has-miR-200 mirVana miRNA mimic Thermo Fisher 4404066 miR200B
    has-miR-200 mirVana miRNA mimic Thermo Fisher 4404066 miR200C
    Opti-MEM Life technologies 11088-021 serum-free media
    anti-Ecadherin antibody BD Bioscience 610182
    anti-beta actin Santa Cruz Biotechnology sc-69879
    anti-EpCam Ab Serotec MCA18706
    anti-ZO1 Invitrogen 402200
    IRDye 800W LI-COR Inc 925-32210
    IRDye 680 LI-COR Inc 926-32223
    anti-mouse AlexaFluor 647 Thermo Fisher A211241
    anti-rabbit AlexaFluor 647 Thermo Fisher ab150075
    Halt Protease and Phosphatesse Inhibitor Thermo Fisher 1861281
    Precision Plus Protein Dual Color Bio-Rad Laboratories Inc 161-0374
    Partec CellTrics Sysmex 04-004-2326 30 μm filter for flow
    GAPDH-F IDT AGCCACATCGCTCAGACAC
    GAPDH-R IDT GCCCAATACGACCAAATCC
    Ecadherin-F IDT TGGAGGAATTCTTGCTTTGC
    Ecadherin-R IDT CGCTCTCCTCCGAAGAAAC
    ZEB1-F IDT GCATACAGAACCCAACTTGAACGTC
    ZEB1-R IDT CGATTACACCCAGACTGC
    NOTCH-F IDT GGCAATCCGAGGACTATGAG
    NOTCH-R IDT CTCAGAACGCACTCGTTGAT
    nitro blue tetrazolium  Sigma N5514
    hexadimethrine bromide Sigma H9268 polybrene
    3 mL syringe BD Bioscience 309657
    Sterile syringe filter VWR 28145-505
    5mL polypropylene round-bottom tube 352063 flow cytometry tubes
    High-Capacity cDNA Reverse Transcription Kit Thermo Fisher 4368814 reverse transcription kit
    4% paraformaldyhyde Santa Cruz Biotechnology sc-281612
    Triton-X100 Sigma 93443
    bovine serum albumin Sigma A7906

    DOWNLOAD MATERIALS LIST

    References

    1. Weber, C. E., Li, N. Y., Wai, P. Y., Kuo, P. C. Epithelial-mesenchymal transition, TGF-beta, and osteopontin in wound healing and tissue remodeling after injury. J Burn Care Res. 33, (3), 311-318 (2012).
    2. Galichon, P., Finianos, S., Hertig, A. EMT-MET in renal disease: should we curb our enthusiasm. Cancer Lett. 341, (1), 24-29 (2013).
    3. Carew, R. M., Wang, B., Kantharidis, P. The role of EMT in renal fibrosis. Cell Tissue Res. 347, (1), 103-116 (2012).
    4. Willis, B. C., Borok, Z. TGF-beta-induced EMT: mechanisms and implications for fibrotic lung disease. Am J Physiol Lung Cell Mol Physiol. 293, (3), L525-L534 (2007).
    5. Ye, X., Weinberg, R. A. Epithelial-Mesenchymal Plasticity: A Central Regulator of Cancer Progression. Trends Cell Biol. 25, (11), 675-686 (2015).
    6. Li, L., Li, W. Epithelial-mesenchymal transition in human cancer: comprehensive reprogramming of metabolism, epigenetics, and differentiation. Pharmacol Ther. 150, 33-46 (2015).
    7. Tsai, J. H., Yang, J. Epithelial-mesenchymal plasticity in carcinoma metastasis. Genes Dev. 27, (20), 2192-2206 (2013).
    8. Bitting, R. L., Schaeffer, D., Somarelli, J. A., Garcia-Blanco, M. A., Armstrong, A. J. The role of epithelial plasticity in prostate cancer dissemination and treatment resistance. Cancer Metastasis Rev. 33, (2-3), 441-468 (2014).
    9. Schaeffer, D., Somarelli, J. A., Hanna, G., Palmer, G. M., Garcia-Blanco, M. A. Cellular Migration and Invasion Uncoupled: Increased Migration Is Not an Inexorable Consequence of Epithelial-to-Mesenchymal Transition. Mol Cell Biol. 34, (18), 3486-3499 (2014).
    10. Mathow, D., et al. Zeb1 affects epithelial cell adhesion by diverting glycosphingolipid metabolism. EMBO Rep. 16, (3), 321-331 (2015).
    11. Ware, K. E., et al. A mechanism of resistance to gefitinib mediated by cellular reprogramming and the acquisition of an FGF2-FGFR1 autocrine growth loop. Oncogenesis. 2, e39 (2013).
    12. Yauch, R. L., et al. Epithelial versus mesenchymal phenotype determines in vitro sensitivity and predicts clinical activity of erlotinib in lung cancer patients. Clin Cancer Res. 11, (24 Pt 1), 8686-8698 (2005).
    13. Jolly, M. K., et al. Towards elucidating the connection between epithelial-mesenchymal transitions and stemness. J R Soc Interface. 11, (101), 20140962 (2014).
    14. Mani, S. A., et al. The epithelial-mesenchymal transition generates cells with properties of stem cells. Cell. 133, (4), 704-715 (2008).
    15. Chen, L., et al. Metastasis is regulated via microRNA-200/ZEB1 axis control of tumour cell PD-L1 expression and intratumoral immunosuppression. Nat Commun. 5, 5241 (2014).
    16. Nicolazzo, C., Gradilone, A. Significance of circulating tumor cells in soft tissue sarcoma. Anal Cell Pathol (Amst). 697395 (2015).
    17. Somarelli, J. A., et al. Mesenchymal-epithelial transition in sarcomas is controlled by the combinatorial expression of miR-200s and GRHL2. Mol Cell Biol. (2016).
    18. Bae, Y. K., Choi, J. E., Kang, S. H., Lee, S. J. Epithelial-Mesenchymal Transition Phenotype Is Associated with Clinicopathological Factors That Indicate Aggressive Biological Behavior and Poor Clinical Outcomes in Invasive Breast Cancer. J Breast Cancer. 18, (3), 256-263 (2015).
    19. Humphries, B., Yang, C. The microRNA-200 family: small molecules with novel roles in cancer development, progression and therapy. Oncotarget. 6, (9), 6472-6498 (2015).
    20. Renner, M., et al. MicroRNA profiling of primary high-grade soft tissue sarcomas. Genes Chromosomes Cancer. 51, (11), 982-996 (2012).
    21. Petrof, G., et al. Mutations in GRHL2 result in an autosomal-recessive ectodermal Dysplasia syndrome. Am J Hum Genet. 95, (3), 308-314 (2014).
    22. Werner, S., et al. Dual roles of the transcription factor grainyhead-like 2 (GRHL2) in breast cancer. J Biol Chem. 288, (32), 22993-23008 (2013).
    23. Werth, M., et al. The transcription factor grainyhead-like 2 regulates the molecular composition of the epithelial apical junctional complex. Development. 137, (22), 3835-3845 (2010).
    24. Somarelli, J. A., et al. Mesenchymal-Epithelial Transition in Sarcomas Is Controlled by the Combinatorial Expression of MicroRNA 200s and GRHL2. Mol Cell Biol. 36, (19), 2503-2513 (2016).
    25. Varma, S., et al. The transcription factors Grainyhead-like 2 and NK2-homeobox 1 form a regulatory loop that coordinates lung epithelial cell morphogenesis and differentiation. J Biol Chem. 287, (44), 37282-37295 (2012).
    26. Pruitt, S. C., Mielnicki, L. M., Stewart, C. C. Analysis of fluorescent protein expressing cells by flow cytometry. Methods Mol Biol. 263, 239-258 (2004).
    27. Zhao, Z., et al. A high-content morphological screen identifies novel microRNAs that regulate neuroblastoma cell differentiation. Oncotarget. 5, (9), 2499-2512 (2014).
    28. Borowicz, S., et al. The soft agar colony formation assay. J Vis Exp. (92), e51998 (2014).
    29. Yang, J., et al. Integrated proteomics and genomics analysis reveals a novel mesenchymal to epithelial reverting transition in leiomyosarcoma through regulation of slug. Mol Cell Proteomics. 9, (11), 2405-2413 (2010).
    30. Alba-Castellon, L., et al. Snail1 expression is required for sarcomagenesis. Neoplasia. 16, (5), 413-421 (2014).
    31. Takaishi, M., Tarutani, M., Takeda, J., Sano, S. Mesenchymal to Epithelial Transition Induced by Reprogramming Factors Attenuates the Malignancy of Cancer Cells. PLoS One. 11, (6), e0156904 (2016).

    Erratum

    Formal Correction: Erratum: Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells
    Posted by JoVE Editors on 07/03/2018. Citeable Link.

    An erratum was issued for: Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells. An author name was updated.

    One of the authors' names was corrected from:

    Shenghan Xu

    to:

    Shengnan Xu

    Induzione di mesenchimali-epiteliale transizioni in cellule di sarcoma
    Play Video
    PDF DOI DOWNLOAD MATERIALS LIST

    Cite this Article

    Ware, K. E., Gilja, S., Xu, S., Shetler, S., Jolly, M. K., Wang, X., Bartholf Dewitt, S., Hish, A. J., Jordan, S., Eward, W., Levine, H., Armstrong, A. J., Somarelli, J. A. Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells. J. Vis. Exp. (122), e55520, doi:10.3791/55520 (2017).More

    Ware, K. E., Gilja, S., Xu, S., Shetler, S., Jolly, M. K., Wang, X., Bartholf Dewitt, S., Hish, A. J., Jordan, S., Eward, W., Levine, H., Armstrong, A. J., Somarelli, J. A. Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells. J. Vis. Exp. (122), e55520, doi:10.3791/55520 (2017).

    Less
    Copy Citation Download Citation Reprints and Permissions
    View Video

    Get cutting-edge science videos from JoVE sent straight to your inbox every month.

    Waiting X
    simple hit counter