Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Developmental Biology

A indução de transições mesenquimais-epiteliais em células de sarcoma

doi: 10.3791/55520 Published: April 7, 2017

ERRATUM NOTICE

Summary

Apresentamos aqui um método de cultura de células para a indução de transições mesenquimais-epiteliais (MET) em células de sarcoma com base na expressão ectópica combinado de microARN-200 e os membros da família grainyhead-like 2 (GRHL2). Este método é adequado para a melhor compreensão do impacto biológico de plasticidade fenotípica sobre a agressividade e tratamentos do cancro.

Abstract

plasticidade fenotípica refere-se a um fenómeno no qual as células transitoriamente ganhar traços de outra linhagem. Durante a progressão do carcinoma, plasticidade fenotípica impulsiona invasão, disseminação e metástase. Com efeito, enquanto que a maioria dos estudos de plasticidade fenotípica têm sido no contexto de carcinomas epiteliais derivadas de, verifica-se os sarcomas, os quais são mesenquimal de origem, também exibem plasticidade fenotípica, com um subconjunto de sarcomas submetidos a um fenómeno que se assemelha a um mesenchymal- transição epitelial (MET). Aqui, nós desenvolvemos um método compreendendo a família de miR-200 e grainyhead-like 2 (GRHL2) para imitar este fenómeno MET-como observado no sarcoma paciente samples.We sequencialmente expressar GRHL2 e a família de miR-200 utilizando a transdução de células e transfecção, respectivamente , para compreender melhor as bases moleculares destas transições fenotípica em células de sarcoma. células de sarcoma que expressam miR-200s e GRHL2 demonstrado characterist epitelial aumentadaics na morfologia celular e alteração de biomarcadores epiteliais e mesenquimais. Estudos futuros utilizando estes métodos podem ser utilizados para compreender melhor as consequências fenotipicas de processos MET-como sobre células de sarcoma, tais como migração, invasão, propensão metastática, e resistência à terapia.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

plasticidade fenotípica refere-se a uma transição reversível entre os fenótipos celulares, e é geralmente divididos em dois tipos, epitelial-a-mesenquimal (EMT) transições e transições mesenquimais-a-epitelial (MET). Esta plasticidade fenotípica desempenha um papel importante em processos normais de organismos multicelulares, tais como desenvolvimento e cicatrização de feridas 1; no entanto, estas mesmas vias e programas de expressão génica também pode levar a doenças, tais como fibrose (revisto em 2, 3, 4) e a metástase de carcinoma (revisto em referências 5, 6, 7, 8). Durante a metástase, por exemplo, EMT perturba polaridade celular, as interacções célula-célula, e promove a invasão 9, 10. Juntos, EMT contribuirs para um estado fenotípico que facilita a disseminação de células de cancro. Além disso, EMT também conduz a uma série de outras alterações fenotípicas que dirigem um fenipo agressivo, incluindo a desregulação do metabolismo celular de cancro 6, o desenvolvimento de resistência ao fármaco 11, 12, o aumento da capacidade do tumor-iniciação 13, 14 e 15 acolher evasão imune.

plasticidade fenotípica tem sido bem estudada na progressão do carcinoma; no entanto, os sarcomas também exibem plasticidade fenotípica. Curiosamente, parece que alguns dos mesmos drivers de plasticidade fenotípica em carcinomas também contribuem para a plasticidade sarcoma e agressividade. Por exemplo, células tumorais circulantes (CTCs) a partir de pacientes de sarcoma foram mostrados para expressar o EpCAM, uma proteína da superfície celular que é tipicamente encontrado em culas epiteliais 16. Addicionalmente, 250 amostras de sarcoma dos tecidos moles foram categorizados como epitelial-mesenquimal como ou semelhantes com base na expressão do gene. Pacientes na assinatura biomarcador epitelial-like tiveram melhor prognóstico do que pacientes com a assinatura biomarcador mesenquimais-like 17. Isto é consistente com muitos carcinomas, em que os doentes com mais de carcinomas epiteliais semelhantes têm melhores resultados em comparação com os pacientes com mais do mesquima semelhante a tumores 18.

Enquanto alguns sarcomas exibir biomarcadores e vias de expressão génica consistentes com MET, as bases moleculares da plasticidade fenotípica permanecem pouco compreendidos. Para estudar os mecanismos e os condutores de MET em sarcoma foi desenvolvido um modelo de indução MET utilizando dois factores específicos do epitélio, o microARN (MIR) -200 família e grainyhead-like 2 (GRHL2). Os miR-200 são uma família de pequenos RNAs não-codificantes que regulam a expressão de genes por ligao ao dos UTRs 3 de messenger ARN e evitando a tradução na proteína. A família de miR-200 consiste em dois sub-grupos - um contendo miR-141 e miR-200a, e o outro incluindo o miR-200b, miR-200c, e miR-429. Os membros da família de miR-200 são enriquecidos em tecidos epiteliais, e a perda de miR-200 está associado com a metástase em carcinomas 19. A família de miR-200 também é regulada negativamente nos sarcomas de tecidos moles em comparação com o tecido normal 20. Similar aos miR-200s, GRHL2 é um regulador chave que é importante para o desenvolvimento epitelial 21. O factor de transcrição GRHL2 actua em dois modos para regular positivamente genes epiteliais, tais como a E-caderina: 1) Em células epiteliais, GRHL2 reprime directamente o principal regulador EMT, ZEB1 22; e 2) GRHL2 activa directamente a transcrição de genes epiteliais 23. As nossas investigações anteriores mostraram que a expressão combinada de miR-200s e GRHL2 em células de sarcomainduz um fenótipo MET-24 como. Aqui, nós apresentamos um protocolo detalhado para criar um modelo in vitro de indução MET em células de sarcoma usando a expressão ectópica de miR-200s e GRHL2.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Preparação dos Reagentes

  1. Prepare DMEM para cultura de células por adição de 50 ml de soro fetal de bovino (FBS) e 5 mL de penicilina-estreptomicina (5000 U / mL) a 500 mL de meio DMEM. Este meio pode ser armazenado a 4 ° C durante até seis meses.
  2. Ressuspender iniciadores liofilizados em água isenta de nuclease, a uma concentração final de 10 uM. iniciadores loja re-suspenso a -20 ° C.
  3. Prepare ensaio de radioimunoprecipitação tampão (RIPA) (NaCl 150 mM, 0,5% de desoxicolato de sódio, 0,1% de SDS, Tris a 50 mM, pH 8,0). Suplemento com o cocktail inibidor de protease antes da utilização e manter tampão em gelo quando em utilização. Armazenar a 4 ° C.
  4. Prepare a 10 mg / mL de polibreno (brometo de hexadimetrina) no filtro de água e de uma seringa para esterilizar utilizando um filtro de 0,45? M de polietersulfona. Solução pode ser armazenada a 4 ° C durante até seis meses.
  5. Prepara-se uma solução de 1 mg / mL de trabalho de cloreto de tetrazólio azul nitro por dissolução de 10 mg em 10 mL de PBS. Armazenar a 4 ° C.

2. Transdução Lentivirus de GRHL2

Dia 1

  1. A placa 3 x 10 5 culas HEK293T por poço de uma placa de 6 cavidades em 2 ml de DMEM suplementado. Quantificar culas utilizando um contador de células automatizado. As células devem ser 40 - 60% confluentes, após cultura durante a noite a 37 ° C com 5% de CO 2.

Dia 2

  1. Dilui-se 2 ug de vector vazio (pCMV-EGFP-UBC) ou 2? G de pCMV-GRHL2-UBC-EGFP 24, 25 em 200 uL de meio sem soro, juntamente com 1,8 ug de pΔ8.9 e 0,2 ug de pCMV-VSV plasmídeos auxiliares -G. Num tubo separado, dilui-se 4 ul de um reagente de transfecção à base de lípidos em 200 uL de meio isento de soro por transfecção (8 uL em 400 uL de duas amostras). Adicionar 200? L de mistura de reagente de transfecção para cada solução de plasmídeo e incubar durante 20 min à temperatura ambiente.
  2. Durante o incubação, lavar as células HEK293T por remoção do meio por aspiração e lavagem as células com 1 ml de PBS. Substituir o PBS com 800 uL de meio isento de soro. Após 20 min, adiciona-se 200 uL de reagente de transfecção: mistura de plasmídeo a partir do passo 2.2 gota a gota, a cada poço e incubar as células durante 2 h a 37 ° C em 5% de CO 2.
  3. Cuidadosamente remover meio de transfecção por aspiração e substituir com 2 ml de DMEM suplementado. As células voltem para a incubadora para a cultura durante a noite.
    NOTA: As células HEK293T são vagamente aderente. Meios de substituição deve ser realizado com cuidado para limitar a remoção das células a partir do fundo do prato ou frasco.

Dia 3

  1. Actualizar meios em células HEK293T transfectadas e a placa 3 x 10 5 culas RD por poço de uma placa de 6 cavidades em 2 ml de DMEM suplementado. Células de cultura durante a noite. culas RD são uma linha de células de rabdomiossarcoma humano comercialmente disponível.

dia 4

  • Recolhe meios viral a partir de células HEK293T. Pipetar o meio DMEM a partir das células HEK293T e em lugar de um novo 15 mL cónico. Cuidadosamente substituir com novos media DMEM e células lugar HEK293T de volta na incubadora para o dia seguinte.
  • Adicionar 2 mL de 10 mg / ml de polibreno por mL de meio virais em dois novos tubos de 50 mL cónicos (uma para a transfecção o vector vazio e outro para a transfecção GRHL2). filtro de seringa de meios viral, removendo o êmbolo de uma seringa de 3 mL e anexar um filtro de 0,45? m de polietersulfona para a ponta.
    1. Adicionar os meios virais recolhidas no passo 2.6 para dentro do tambor da seringa, e mergulhar meios para os novos tubos de 50 mL cónicos contendo polibrene. Remover o meio a partir de culas RD por aspiração a vácuo e adicionar meios viral filtrada para células RD.
  • dia 5

    1. Dia 4. células HEK293T de repetição podem ser descartados após a mídia viral foi recolhido.

    dia 7

    1. Lavar as células RD com 1 mL de PBS e adicionar 200 ul de tripsina a 0,05% por poço. Incubar a 37 ° C durante 5 min, adicionar 2 ml de meio suplementado, e mover-se suspensão de células para um novo 15 mL cónico. células centrifugar a 250 xg durante 5 min à temperatura ambiente e meios aspirado. Ressuspender em 1 mL de meio DMEM (suplementado com 5% de FBS e 1% de penicilina-estreptomicina).
      NOTA: Usando uma percentagem mais elevada de SBF podem provocar entupimento, durante o fluxo de citometria
      1. células de filtro para citometria de fluxo. Usar uma pipeta para aplicar a suspensão de células 1 mL DR através de um filtro de 30 um em tubos de citometria de fluxo e os tubos de colocar em gelo.
      2. Ordenação de eGFP + 26 em tubos de microcentrífuga de 1,5 mL contendo 0,5 mL de DMEM suplementado com 10% FBS e 1% de penicilina-estreptomicina e colocar em gelo. Placa eGFP + no total de 1 mL de DMEM suplementado classificados em um único poço de uma placa de 12 poços e lugar na incubadora para cultura.
        ; NOTA: O rendimento de células a partir de EGFP + citometria de fluxo após esta transdução é geralmente baixa (50.000-100.000 células). As células podem precisar de ser cultivadas durante 10 - 14 dias antes de prosseguir para o passo 3.

    3. Transfecção reversa de miR-200s

    1. Preparar 50 uM stocks de miR-200 imita usando livre de nuclease H 2 O. estoques alíquotas e armazenar a -20 ° C para evitar ciclos de congelamento / descongelamento.
    2. Adiciona-se 3 mL de cada um de 50? M de miR-200 mímico (miR-200a, miR-200b, e miR-200 c) a 300 uL de meio isento de soro ou 9 mL de 50 um miARN controlo negativo para meio isento de soro de 300 uL.
    3. Adicionar 6 mL de reagente de transfecção específico siRNA para 600 uL de meio isento de soro e 300 pL de dividir esta mistura em dois tubos, um para cada uma das duas misturas de miR passo 3.2. Combinam-se as 300 uL de cada mistura de miR do passo 3.2 com uma mistura de 300 uL de reagente de transfeco. Incubar durante 20 min a te quartomperatura.
    4. Durante a incubação, preparar uma suspensão de células de 600.000 células EGFP + RD expressam EV ou GRHL2 criado na secção 2 em 2,4 mL (250 células / ml) de meio isento de soro por tratamento.
    5. Numa placa de 24 poços, adicionar 100 ul por poço de miR-200 mistura ou mistura de controlo negativo a partir do passo 3.3 em seis poços, e, em seguida, adicionar 400 uL de cada suspensão de células em três poços de cada mistura de miR.
    6. Incubar as células a 37 ° C em 5% de CO 2 durante a noite e meios de comunicação para alterar totalmente suplementado DMEM no dia seguinte. Recolher as células 2 dias mais tarde para análise utilizando o tampão adequado (ver abaixo). imagiologia de lapso de tempo de células de sarcoma RD submetidos a MET é disponível como material suplementar. Imagem cada poço a cada 2 h com uma objetiva de 10X usando um gerador de imagens ao vivo de células automatizado 27.

    4. extracção de ARN, transcrição reversa, e qPCR

    1. Extrair ARN de acordo com as instruções do fabricante, usando um padrão de RNAkit de extracção 24. ARN extraído pode ser armazenado a -80 ° C.
    2. Quantificar a concentração de ARN. Descongelar e trabalhar com ARN em gelo. Para quantificar as concentrações de ARN, medir a absorvância de UV a 260 nm com um espectrofotetro leitor de placas de acordo com o protocolo do fabricante. Dilui-se todas as amostras para a concentração mais baixa com água isenta de nuclease.
    3. Realizar a transcrição inversa de ARN total em ADN complementar (ADNc). Combinar não menos do que 100 ng de ARN total com tampão de PCR, de mistura de dNTP (100 mM), os iniciadores de hexâmeros aleatórios, transcriptase e água isenta de nuclease reversa num volume de reacção de 20 uL 24. Executar ciclos de RT de acordo com o protocolo do fabricante. ADNc pode ser armazenada a longo prazo a -20 ° C.
    4. Diluir 20 uL a reacções de 100 uL com 80 uL de livre de nuclease H 2 O.
    5. Dissolvem-se 5 mL de uma baseada em fluorescência corante intercalante 2x qPCR master mix, 0,06 L de cada iniciador a 10? M, umND 2? L de reaco de RT por amostra diluída.
    6. Run qPCR de acordo com o protocolo do fabricante para a mistura principal à base de fluorescência.
    7. Quantificar as quantidades relativas de ARNm pelo método CT delta e normalizar a GAPDH. Traça-se a expressão do mRNA média das réplicas biológicas ± desvio padrão para cada grupo de tratamento.
      NOTA: precauções especiais devem ser tomadas quando se trabalha com ARN a fim de evitar contacto com RNases, tais como a utilização de plásticos e reagentes isentos de RNase. equipamento não descartável deve ser tratada antes do uso para remover RNases.

    5. Imunofluorescência Coloração

    1. Seguindo o passo 3.6, meios aspirado por aspiração a partir de células RD em formato de 24 poços.
    2. Fixar as células por adição de 500 uL de paraformaldeído a 4% (PFA) por poço e incubar durante 15 min à temperatura ambiente (RT). Após a fixação, as células lugar em solução salina tamponada com fosfato (PBS) e armazenar a 4 ° C durante a noite se necessário.
    3. permeabilizaras células por adição de 500 ul de PBS + 0,2% de Triton-X100 e incubar 30 min a RT. Por aspiração de vácuo, remover o tampão de permeabilização e lavar três vezes com PBS.
    4. Bloco em 500 mL de 5% de albumina de soro bovino (BSA) / PBS e incubar as células durante 30 minutos à temperatura ambiente. As células podem ser armazenadas a 4 ° C durante a noite se necessário.
    5. Prepare uma diluição de anticorpo primário. Pipetar 200 L de 5% de BSA / PBS por poço num cónico de 15 mL (12 poços = 2,4 mL) e adicionar 1 mL de anticorpo primário por mL de BSA a 5% / PBS necessário. Remover o tampão de bloqueio por aspiração a vácuo e dispensar 200 uL de anticorpo primário diluído a cada poço.
      1. Incubar as células em 1: 1.000 de anticorpos diluídos primários em BSA a 5% / PBS durante 1 h à temperatura ambiente ou durante a noite a 4 ° C. Após a incubação, lavar as células duas vezes com PBS.
    6. Preparar uma diluição de anticorpo secundário no mesmo volume de BSA a 5% / PBS como acima. Adicionar o anticorpo secundário conjugado com corante vermelho-extremo usando uma diluição de 1: 2000. Além disso adicionar1 ug / mL de corante Hoechst à mistura. Remover o PBS e adicionar 200 mL da mistura para cada poço.
      1. Incubar à temperatura ambiente durante 1 h no escuro. Lavar 3 vezes com PBS, deixa as células em PBS, e proteger as células da luz utilizando folha metálica. As células podem ser armazenadas a 4 ° C, se necessário.
    7. células de imagem em ampliação total 400X num microscópio de epifluorescência invertido com excitao de comprimento de onda 594-650 nm.

    6. Western Blotting

    1. Lavar as células duas vezes com 3,6 de PBS gelado. Em gelo, as células lisam com 50 ul de 1x tampão RIPA suplementado com um cocktail inibidor de protease 1x.
    2. Os lisados ​​de rocha, a 4 ° C durante 15 minutos, recolher os lisados ​​para tubos de 1,5 ml e centrifugar a alta velocidade (20000 xg) durante 5 min para clarificar as amostras. Os lisados ​​celulares podem ser armazenadas a longo prazo a -80 ° C, se necessário.
    3. Quantificar a proteína total utilizando um ensaio de Bradford e aliquotar uma quantidade igual de proteína em novos tubos de microcentrifuga de 1,5 mL. BrinAs amostras de g para volume igual usando tampão RIPA e tampão de carga Laemmli 3x suplementado com 2-mercaptoetanol.
    4. Incubar as amostras em tamp de carga de Laemmli 1x amostra durante 5 minutos a 95 ° C e executado de SDS-PAGE utilizando um gel de Tris-glicina 4-12% a 200 V durante 45 min. A quantidade de faixas carregadas de proteína, dependendo da linha celular. Em alguns casos, 50-100 ug de proteína total é necessária para a detecção de E-caderina em linhas celulares mesenquimais.
    5. Transferência de proteínas para uma membrana de nitrocelulose durante 2 horas a 50 V em tampão de transferência 1x Tris-glicina.
    6. membrana bloco durante 1 h a temperatura ambiente ou durante a noite a 4 ° C em um tampão de bloqueio à base de BSA.
    7. Dilui-se os anticorpos primários em 1: 1000 de concentração em 5 mL de tampão de bloqueio, adicionar diluição para a membrana, e incubar com agitação suave durante 1 h a temperatura ambiente ou durante a noite a 4 ° C. membrana de lavagem 3 vezes em PBS com 0,05% de Tween-20.
    8. Incubar as membranas durante 1 h à RT com Secundaria acoplado-fluorescente no infravermelhoy anticorpo a 1: 20000 em tampão de bloqueio de diluição como acima.
    9. Lavar membrana duas vezes em PBS com 0,05% de Tween-20 e depois uma vez em PBS.
    10. membrana imagem utilizando detecção de fluorescência no infravermelho padrão.

    7. ensaios de crescimento independente da ancoragem

    NOTA: Para um protocolo de ensaio em agar mole detalhada, ver 28.

    1. Quente meios 2x DMEM estéril a 42 ° C em banho de água quente. Durante este tempo, o calor de pré-autoclavadas a 1% de agarose em microondas durante 3 minutos. Micro-ondas durante um período adicional de 30 segundos de cada vez conforme necessário, ou até estarem completamente fundidos. Mover de agarose para um banho de água a 42 ° C.
    2. Colocar um tubo de 50 mL cónico numa proveta com 42 ° C em água estéril um capuz e misturar 1% de agarose e meios 2x DMEM numa mistura 1: 1 proporção de contabilidade para 1,5 mL de mistura por poço numa placa de 6 poços. Sempre preparar extra de DMEM / agarose para dar conta de erro pipetagem e para evitar bolhas.
    3. Adicionar a mistura aoos lados do poço, assegurando que não se formem bolhas e deixar repousar durante 30 minutos à temperatura ambiente.
    4. Enquanto a camada inferior é solidificando, preparar a cada grupo de células RD transf ectadas no passo 3 aspirao por meios e lavagem uma vez com 1 mL de PBS. Aspirar PBS e adicionar 0,2 ml de 0,05% de tripsina e incubar a 37 ° C durante 5 min.
    5. Neutraliza-se a tripsina em 0,8 mL de meio e células Triturar para formar uma suspensão de célula única. Transferir a suspensão de células para um tubo cónico de 15 mL.
    6. Contagem de células e calcular o volume de suspensão de células necessário para a 10.000 células por poço.
    7. Aquecer 0,6% de agarose em microondas durante 3 minutos, seguido por 30 segundos de cada vez até que esteja completamente derretida. Mover de agarose a 42 ° C Banho de água.
    8. Colocar um tubo de 50 mL cónico numa proveta com 42 ° C em água estéril um capuz. Misturar 0,6% de agarose e suspensão de células diluída numa proporção de 1: 1 para se preparar 1,5 mL de mistura por poço numa placa de 6 poços. Sempre preparar suspensão de células de cama / agarose misturar para dar conta de erro pipetagem epara evitar bolhas.
      NOTA: É importante trabalhar a 42 ° C aqui. Se a temperatura é muito baixa a mistura vai solidificar antes do plaqueamento, e temperaturas acima de 42 ° C irá afectar a viabilidade celular.
    9. Misture bem por trituração células várias vezes e adicionar mistura de células aos poços, assegurando que não forma bolhas, e deixar solidificar durante 20 minutos a RT.
    10. Adicionar 2 ml de meio suplementado a cada poço e mover as placas para incubadora.
      1. Mudança de mídia uma vez por semana, durante 3-4 semanas ou até colônias multicelulares formar. Tenha cuidado para evitar tocar o agar ao remover a mídia por aspiração a vácuo. Em alternativa, usar um P1000 para remover a camada de topo do meio líquido.
      2. Manchar placas de agar mole por adição de 200 uL de solução de cloreto de azul de tetrazólio Nitro (1 mg / mL em PBS) e incubar a placa durante a noite a 37 ° C. Substituir meios no dia seguinte com PBS para imagiologia.
      3. poços de imagem em 40X ampliação total em um microscópio invertido.
      4. Realizar a análise em ImageJ para a área colónia e número. Lote número médio de colónias de réplicas biológicas ± desvio padrão.

    Subscription Required. Please recommend JoVE to your librarian.

    Representative Results

    or Start trial to access full content. Learn more about your institution’s access to JoVE content here

    Esquema para a indução de MET em células de sarcoma

    Uma linha do tempo geral para a indução de alterações MET-como em células de sarcoma é mostrado na Figura 1. O protocolo começa por transdução GRHL2 (Figura 1A), seguido por transfecção da família miR-200 (Figura 1B). membros da família GRHL2 ou miR-200 não foram capazes de afectar a aparência de células RD quando expressa sozinha, mas a expressão ectópica de GRHL2 e miR-200 em conjunto resulta em mudanças morfológicas tipo epitelial em culas RD. Células de transição a partir de uma forma em forma de fuso com uma aparência mais arredondada com maior contacto célula-célula (Figura 1C).

    A indução de alterações MET-como em células de sarcoma

    A mudança morfológica em células RD sobre GRHL2 e miR-200a sobre-expressão foi acompanhada por sobre-regulação do marcador epitelial de E-caderina (Figura 2A). A adição de miR-200s upregulated E-caderina por si só, mas combinada miR-200s e GRHL2 superexpressão sinergicamente aumentada expressão de E-caderina (Figura 2A; não log escala). Além disso, houve um aumento nas junções célula-célula epitelial de moléculas de adesão, de EpCAM e TJP1, setas brancas (também conhecido como occludens Zona 1, ZO-1) (Figura 2B).

    indução MET diminui a capacidade de formação de colónias de células de sarcoma

    A regulao positiva de proteínas epiteliais foi acompanhada pela regulação negativa dos genes mesenquimais Zeb1 e Notch1 (Figura 3A), que são conhecidos para alvos de miR-200. Indução de MET reduziu o crescimento independente de ancoragem de células RD conforme medido pelo número de colónias (Figura 3B). este groWth inibição foi conduzido por si só miR-200s; como a sobre-express de GRHL2 levou a um aumento no crescimento independente de ancoragem (Figura 3). Isto é consistente com relatórios anteriores que mostram a expressão GRHL2 induz o crescimento independente de ancoragem 22.

    figura 1
    Figura 1: tempo de vida do TEM de indução com GRHL2 Sobre-expressão e miR-200 A transfecção. (A) tempo de vida de expressão sobre-ectópica de GRHL2 em células alvo. (B) Linha de tempo de indução MET através de transfecção inversa de membros da família de miR-200 em células alvo. (C) GRHL2 e miR-200 sobre-expressão conduziu a alterações na morfologia das células alvo compatíveis com MET. Barra de escala = 75 mm Por favor clique aquipara ver uma versão maior desta figura.

    Figura 2
    Figura 2: Simultânea Sobre-expressão de GRHL2 e miR-200 Led para MET em células alvo. (A) Expressão de miR-200 conduziu a expressão de E-caderina elevada enquanto que a expressão combinada de GRHL2 e miR-200 produzido um efeito sinérgico sobre a expressão de E-caderina, tanto do ARNm (valores médios ± desvio padrão) e os níveis de proteína. (B) a expressão combinada de GRHL2 e miR-200 conduziu a um aumento da expressão de EpCAM e TJP1 em contactos cula-cula (setas). Escala da barra = 20 m. * Indica p <0,05 analisados utilizando ANOVA com a figura post-hoc de Tukey correction.This foi modificado a partir de referência 24. Copyright © American Society for Microbiology, Biologia Molecular Cell, Volume 36, Número 19, 2503-2513, 2016. Por favor clique aqui para ver uma versão maior desta figura.

    Figura 3
    Figura 3: Expressão de miR-200S Suprime mesenquimais marcadores e diminui o crescimento ancoragem independente em células de sarcoma. (A) sobre - expressão de miR-200, mas não inibiu a expressão GRHL2 Zeb1 e Notch1 ARNm (valores médios ± desvio padrão). (B) Sobre-expressão de miR-200, mas não GRHL2 anoikis inibidos resistência em células de sarcoma. Imagens representativas de colónias coradas (escala bar = 200 pm) e quantificação do número de colónias (valores médios ± desvio padrão) são mostrados. * Indica p <0,05 analisados ​​utilizando ANOVA com a figura post-hoc de Tukey correction.This foi modificado a partir de referência 24. Copyright © Sociedade Americana de Microbiologia, Biologia Molecular Cell, Volume 36, Issue 19, 2503-2513, 2016. Por favor, clique aqui para ver uma versão maior desta figura.

    Figura 3
    Vídeo suplementar: culas RD que expressam o vector vazio e miARNs de controlo negativo. Vídeos foram compilados a partir de imagens de células RD transf ectadas com vector vazio e miARNs controlo negativo adquiridos a cada duas horas, utilizando um gerador de imagens ao vivo de células automatizado. Por favor clique aqui para ver este vídeo. (Direito-clique para baixar).

    Figura 3 />
    Supplemental Vídeo 2: As células RD Expressando miRNAs Controlo Negativo GRHL2-EGFP e. Vídeos foram compilados a partir de imagens de células RD transf ectadas com miARNs controlo negativo GRHL2-EGFP e adquiridos a cada duas horas, utilizando um gerador de imagens ao vivo de células automatizado. Por favor clique aqui para ver este vídeo. (Direito-clique para baixar).

    Figura 3
    Suplementar Video 3: As células RD Expressando Vector vazio e miR200 miRNAs. Vídeos foram compilados a partir de imagens de células RD transf ectadas com vector vazio e miR200 miARNs adquiridos a cada duas horas, utilizando um gerador de imagens ao vivo de células automatizado. Por favor clique aqui para ver este vídeo. (Direito-clique para baixar).

    nt" fo: manter-together.within-page = "1"> Figura 3
    Suplementar vídeo 4: As células RD Expressando GRHL2-EGFP e miR200 miRNAs. Vídeos foram compilados a partir de imagens de células RD transfectadas com GRHL2-EGFP e miR200 miRNAs adquirida a cada duas horas, utilizando um gerador de imagens ao vivo de células automatizado. Por favor clique aqui para ver este vídeo. (Direito-clique para baixar).

    Subscription Required. Please recommend JoVE to your librarian.

    Discussion

    or Start trial to access full content. Learn more about your institution’s access to JoVE content here

    Sarcomas são cancros raros, mas altamente agressivas de uma linhagem mesenquimal. Apesar da sua linhagem mesenquimal, um subconjunto dos sarcomas parece sofrer uma transição fenotípica para um estado mais epitelial semelhante. Este interruptor MET-like tem relevância prognóstico, como pacientes com mais tumores epiteliais, como são menos agressivos 24. Apesar da sua relevância clínica, existem poucos estudos sobre os mecanismos moleculares de condução dessas transições fenotípicas em sarcomas.

    Para examinar as transições MET-como em células de sarcoma, desenvolvemos um modelo de indução MET através da combinação de expressão de fatores epiteliais GRHL2 ea família miR-200. Este método induz rapidamente as células de sarcoma de se tornar mais epitelial semelhante tal como medido por alterações na morfologia e na expressão do gene. Usando este protocolo para induzir MET em células de sarcoma facilita o estudo do impacto destas transições nos fenótipos que impulsionam sarcoma de agressão, talcomo a migração, invasão, proliferação e resistência a morte e como cada uma dessas mudanças na biologia podem afetar a resistência aos medicamentos.

    No contexto dos carcinomas derivados de epiteliais, a expressão de um factor de mesenquimal é muitas vezes suficiente para induzir EMT 14. No entanto, neste modelo de derivados de sarcoma de MET a expressão de dois factores epiteliais, GRHL2 e miR-200, são necessários. Curiosamente, o miR-200 sozinho tinha um efeito mais forte sobre a maioria dos biomarcadores de MET que GRHL2, enquanto GRHL2 foi capaz de activar de forma robusta genes epiteliais apenas na presença de repressão baseada-miR-200 de repressores de genes epiteliais, tais como ZEB1 24. É possível que, para alguns tipos de células mesenquimais genes epiteliais precisa ser tanto de-reprimido (por exemplo, através de miR-200s) e activado (por exemplo, através GRHL2) para conduzir MET.

    Temos experimentado variação nos níveis de expressão GRHL2 todo cel diferentel linhas. Para ultrapassar isto, foi utilizado um plasmídeo de expressão GRHL2 que também expressa EGFP 25 para classificar por citometria de fluxo de células positivas para EGFP antes das experiências. Também é crítico para validar a funcionalidade de miR-200s e GRHL2 em diferentes tipos de células. EMT é visto como um espectro com base na expressão de genes associados epitelial e mesenquimal, que pode ter uma variação dependente do contexto baseado na linha de células, tipo de cancro, tratamento, etc. Assim, analisou-se cinco genes regulados por miR-200 ou para GRHL2 contabilizar as alterações dependentes do contexto de células. Outra ressalva deste ensaio é a dependência de uma transfecção transiente de miR-200 para a indução de TEM. Assim, experimentos de longa duração pode tornar-se caro e complicado quando vários transfecções repetidas tornam-se necessárias. Isto pode ser ultrapassada pela utilização de plasmídeos de expressão de miR-200.

    Outros estudos também relataram evidências de MET em sarcomas. Por exemplo, MET foi observada em um subconjunto de leiomyosarcomas e foi associado com melhor sobrevida para os pacientes. Mecanisticamente, Yang et al. verificaram que, numa inibição linha celular de leiomiossarcoma Slug com siARN foi suficiente para induzir MET-29 como alterações. Da mesma forma, a depleção de ainda um outro factor de mesenquimais, Snail, em células estaminais mesenquimais reduzida formação do sarcoma em ratos 30. Assim, é evidente a partir da literatura que há vários caminhos para um fenótipo MET-like, que pode variar consoante o tipo de célula. Enquanto isso não é a única maneira de induzir a TEM, temos usado o nosso método para induzir MET em dois subtipos de sarcoma, incluindo rabdomiossarcoma (células RD) e osteossarcoma (células 143B). No futuro, seria interessante comparar esses métodos diferentes em uma ampla gama de células de sarcoma. Por exemplo, se certos subtipos de sarcoma têm alterações genéticas ou epigenéticas subjacentes que tornam mais ou menos suscetível à indução de TEM?

    Identificar o impacto do METsobre uma variedade de saídas biológicas em células de sarcomas poderia proporcionar uma melhor compreensão da razão pela qual os doentes com mais sarcomas tipo epitelial têm um melhor prognóstico. Além disso, a compreensão do impacto do tratamento em dirigir as transições fenotípicas entre os estados seria aprofundar nossa compreensão biológica e informar sobre a resposta às terapias atuais em pacientes com sarcoma.

    Subscription Required. Please recommend JoVE to your librarian.

    Disclosures

    Os autores não têm nada a revelar.

    Acknowledgments

    JAS reconhece o apoio do Instituto Duke Cancer, The Duke University Genitourinary Oncologia Laboratory, e do Departamento de Ortopedia da Universidade de Duke. HL foi apoiado pela National Science Foundation (NSF) Centro de Física Biológica Teórica (NSF PHY-1427654) e NSF DMS-1361411, e como CPRIT (Prevenção do Câncer e Instituto de Pesquisa do Texas) Scholar na Cancer Research do Estado do Texas na Universidade Rice. KEW foi apoiado pelo NIH F32 CA192630 MKJ e HL beneficiado a partir de discussões úteis com Mary C. Farach-Carson, JN Onuchic, Samir M. Hanash, Kenneth J. Pienta, e Donald S. Coffey.

    Materials

    Name Company Catalog Number Comments
    Countess automated counter Life technologies AMQAX1000
    Countess cell counting chamber slides Invitrogen C10283
    SimpliAmp Thermal Cycler Thermo Fisher A24811
    Odyssey Fc LI-COR Inc
    ViiA7 Real Time PCR System Thermo Fisher 4453536
    PCR microplate Corning 321-29-051
    KAPA SYBR Fast Universal qPCR Kit KAPA Biosystems KK4602
    Starting Block (PBS) Blocking Buffer Thermo Fisher 37538 BSA-based blocking buffer
    Agarose General Purpose LE Genesee Scientific 20-102
    10x Tris/Glycine/SDS Buffer Bio-Rad Laboratories Inc 161-0732 Running buffer
    10x Tris/Glycine Buffer Bio-Rad Laboratories Inc 161-0734 Transfer buffer
    RIPA Buffer Sigma Life Sciences SLBG8489
    Amersham Protran 0.45 μm nitrocellulose GE Healthcare Lifesciences 10600012
    Quick-RNA MiniPrep Kit Genesee Scientific 11-358
    Laemmli Sample Buffer (4X) Bio-Rad Laboratories Inc 1610747
    Mini Trans-Blot Cell Bio-Rad Laboratories Inc 1703930
    Mini-Protean Tetra Cell Bio-Rad Laboratories Inc 1658005EDU
    DPBS Life technologies 14190-144
    0.05% Trypsin-EDTA Life technologies 11995-065
    DMEM Life technologies 11995-065
    Lipofectamine RNAi Max Thermo Fisher 13778150
    Lipofectamine 2000 Ragents Thermo Fisher 11668019
    Penicillin Streptomycin Life technologies 15140-122
    miRVana miRNA mimic negative control #1 Thermo Fisher 4464058 neg miRNA
    hsa-miR-200 mirVana miRNA mimic Thermo Fisher 4464066 miR200A
    has-miR-200 mirVana miRNA mimic Thermo Fisher 4404066 miR200B
    has-miR-200 mirVana miRNA mimic Thermo Fisher 4404066 miR200C
    Opti-MEM Life technologies 11088-021 serum-free media
    anti-Ecadherin antibody BD Bioscience 610182
    anti-beta actin Santa Cruz Biotechnology sc-69879
    anti-EpCam Ab Serotec MCA18706
    anti-ZO1 Invitrogen 402200
    IRDye 800W LI-COR Inc 925-32210
    IRDye 680 LI-COR Inc 926-32223
    anti-mouse AlexaFluor 647 Thermo Fisher A211241
    anti-rabbit AlexaFluor 647 Thermo Fisher ab150075
    Halt Protease and Phosphatesse Inhibitor Thermo Fisher 1861281
    Precision Plus Protein Dual Color Bio-Rad Laboratories Inc 161-0374
    Partec CellTrics Sysmex 04-004-2326 30 μm filter for flow
    GAPDH-F IDT AGCCACATCGCTCAGACAC
    GAPDH-R IDT GCCCAATACGACCAAATCC
    Ecadherin-F IDT TGGAGGAATTCTTGCTTTGC
    Ecadherin-R IDT CGCTCTCCTCCGAAGAAAC
    ZEB1-F IDT GCATACAGAACCCAACTTGAACGTC
    ZEB1-R IDT CGATTACACCCAGACTGC
    NOTCH-F IDT GGCAATCCGAGGACTATGAG
    NOTCH-R IDT CTCAGAACGCACTCGTTGAT
    nitro blue tetrazolium  Sigma N5514
    hexadimethrine bromide Sigma H9268 polybrene
    3 mL syringe BD Bioscience 309657
    Sterile syringe filter VWR 28145-505
    5mL polypropylene round-bottom tube 352063 flow cytometry tubes
    High-Capacity cDNA Reverse Transcription Kit Thermo Fisher 4368814 reverse transcription kit
    4% paraformaldyhyde Santa Cruz Biotechnology sc-281612
    Triton-X100 Sigma 93443
    bovine serum albumin Sigma A7906

    DOWNLOAD MATERIALS LIST

    References

    1. Weber, C. E., Li, N. Y., Wai, P. Y., Kuo, P. C. Epithelial-mesenchymal transition, TGF-beta, and osteopontin in wound healing and tissue remodeling after injury. J Burn Care Res. 33, (3), 311-318 (2012).
    2. Galichon, P., Finianos, S., Hertig, A. EMT-MET in renal disease: should we curb our enthusiasm. Cancer Lett. 341, (1), 24-29 (2013).
    3. Carew, R. M., Wang, B., Kantharidis, P. The role of EMT in renal fibrosis. Cell Tissue Res. 347, (1), 103-116 (2012).
    4. Willis, B. C., Borok, Z. TGF-beta-induced EMT: mechanisms and implications for fibrotic lung disease. Am J Physiol Lung Cell Mol Physiol. 293, (3), L525-L534 (2007).
    5. Ye, X., Weinberg, R. A. Epithelial-Mesenchymal Plasticity: A Central Regulator of Cancer Progression. Trends Cell Biol. 25, (11), 675-686 (2015).
    6. Li, L., Li, W. Epithelial-mesenchymal transition in human cancer: comprehensive reprogramming of metabolism, epigenetics, and differentiation. Pharmacol Ther. 150, 33-46 (2015).
    7. Tsai, J. H., Yang, J. Epithelial-mesenchymal plasticity in carcinoma metastasis. Genes Dev. 27, (20), 2192-2206 (2013).
    8. Bitting, R. L., Schaeffer, D., Somarelli, J. A., Garcia-Blanco, M. A., Armstrong, A. J. The role of epithelial plasticity in prostate cancer dissemination and treatment resistance. Cancer Metastasis Rev. 33, (2-3), 441-468 (2014).
    9. Schaeffer, D., Somarelli, J. A., Hanna, G., Palmer, G. M., Garcia-Blanco, M. A. Cellular Migration and Invasion Uncoupled: Increased Migration Is Not an Inexorable Consequence of Epithelial-to-Mesenchymal Transition. Mol Cell Biol. 34, (18), 3486-3499 (2014).
    10. Mathow, D., et al. Zeb1 affects epithelial cell adhesion by diverting glycosphingolipid metabolism. EMBO Rep. 16, (3), 321-331 (2015).
    11. Ware, K. E., et al. A mechanism of resistance to gefitinib mediated by cellular reprogramming and the acquisition of an FGF2-FGFR1 autocrine growth loop. Oncogenesis. 2, e39 (2013).
    12. Yauch, R. L., et al. Epithelial versus mesenchymal phenotype determines in vitro sensitivity and predicts clinical activity of erlotinib in lung cancer patients. Clin Cancer Res. 11, (24 Pt 1), 8686-8698 (2005).
    13. Jolly, M. K., et al. Towards elucidating the connection between epithelial-mesenchymal transitions and stemness. J R Soc Interface. 11, (101), 20140962 (2014).
    14. Mani, S. A., et al. The epithelial-mesenchymal transition generates cells with properties of stem cells. Cell. 133, (4), 704-715 (2008).
    15. Chen, L., et al. Metastasis is regulated via microRNA-200/ZEB1 axis control of tumour cell PD-L1 expression and intratumoral immunosuppression. Nat Commun. 5, 5241 (2014).
    16. Nicolazzo, C., Gradilone, A. Significance of circulating tumor cells in soft tissue sarcoma. Anal Cell Pathol (Amst). 697395 (2015).
    17. Somarelli, J. A., et al. Mesenchymal-epithelial transition in sarcomas is controlled by the combinatorial expression of miR-200s and GRHL2. Mol Cell Biol. (2016).
    18. Bae, Y. K., Choi, J. E., Kang, S. H., Lee, S. J. Epithelial-Mesenchymal Transition Phenotype Is Associated with Clinicopathological Factors That Indicate Aggressive Biological Behavior and Poor Clinical Outcomes in Invasive Breast Cancer. J Breast Cancer. 18, (3), 256-263 (2015).
    19. Humphries, B., Yang, C. The microRNA-200 family: small molecules with novel roles in cancer development, progression and therapy. Oncotarget. 6, (9), 6472-6498 (2015).
    20. Renner, M., et al. MicroRNA profiling of primary high-grade soft tissue sarcomas. Genes Chromosomes Cancer. 51, (11), 982-996 (2012).
    21. Petrof, G., et al. Mutations in GRHL2 result in an autosomal-recessive ectodermal Dysplasia syndrome. Am J Hum Genet. 95, (3), 308-314 (2014).
    22. Werner, S., et al. Dual roles of the transcription factor grainyhead-like 2 (GRHL2) in breast cancer. J Biol Chem. 288, (32), 22993-23008 (2013).
    23. Werth, M., et al. The transcription factor grainyhead-like 2 regulates the molecular composition of the epithelial apical junctional complex. Development. 137, (22), 3835-3845 (2010).
    24. Somarelli, J. A., et al. Mesenchymal-Epithelial Transition in Sarcomas Is Controlled by the Combinatorial Expression of MicroRNA 200s and GRHL2. Mol Cell Biol. 36, (19), 2503-2513 (2016).
    25. Varma, S., et al. The transcription factors Grainyhead-like 2 and NK2-homeobox 1 form a regulatory loop that coordinates lung epithelial cell morphogenesis and differentiation. J Biol Chem. 287, (44), 37282-37295 (2012).
    26. Pruitt, S. C., Mielnicki, L. M., Stewart, C. C. Analysis of fluorescent protein expressing cells by flow cytometry. Methods Mol Biol. 263, 239-258 (2004).
    27. Zhao, Z., et al. A high-content morphological screen identifies novel microRNAs that regulate neuroblastoma cell differentiation. Oncotarget. 5, (9), 2499-2512 (2014).
    28. Borowicz, S., et al. The soft agar colony formation assay. J Vis Exp. (92), e51998 (2014).
    29. Yang, J., et al. Integrated proteomics and genomics analysis reveals a novel mesenchymal to epithelial reverting transition in leiomyosarcoma through regulation of slug. Mol Cell Proteomics. 9, (11), 2405-2413 (2010).
    30. Alba-Castellon, L., et al. Snail1 expression is required for sarcomagenesis. Neoplasia. 16, (5), 413-421 (2014).
    31. Takaishi, M., Tarutani, M., Takeda, J., Sano, S. Mesenchymal to Epithelial Transition Induced by Reprogramming Factors Attenuates the Malignancy of Cancer Cells. PLoS One. 11, (6), e0156904 (2016).

    Erratum

    Formal Correction: Erratum: Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells
    Posted by JoVE Editors on 07/03/2018. Citeable Link.

    An erratum was issued for: Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells. An author name was updated.

    One of the authors' names was corrected from:

    Shenghan Xu

    to:

    Shengnan Xu

    A indução de transições mesenquimais-epiteliais em células de sarcoma
    Play Video
    PDF DOI DOWNLOAD MATERIALS LIST

    Cite this Article

    Ware, K. E., Gilja, S., Xu, S., Shetler, S., Jolly, M. K., Wang, X., Bartholf Dewitt, S., Hish, A. J., Jordan, S., Eward, W., Levine, H., Armstrong, A. J., Somarelli, J. A. Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells. J. Vis. Exp. (122), e55520, doi:10.3791/55520 (2017).More

    Ware, K. E., Gilja, S., Xu, S., Shetler, S., Jolly, M. K., Wang, X., Bartholf Dewitt, S., Hish, A. J., Jordan, S., Eward, W., Levine, H., Armstrong, A. J., Somarelli, J. A. Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells. J. Vis. Exp. (122), e55520, doi:10.3791/55520 (2017).

    Less
    Copy Citation Download Citation Reprints and Permissions
    View Video

    Get cutting-edge science videos from JoVE sent straight to your inbox every month.

    Waiting X
    simple hit counter