Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Developmental Biology

Induktions av mesenkymala-Epithelial övergångar i sarkomceller

doi: 10.3791/55520 Published: April 7, 2017

ERRATUM NOTICE

Summary

Vi presenterar här ett cellodlings förfarande för inducering av mesenkymala-epitelial övergångar (MET) i sarkomceller baserade på kombinerad ektopiskt uttryck av microRNA-200 familjemedlemmar och grainyhead liknande 2 (GRHL2). Denna metod är lämplig för att bättre förstå den biologiska effekterna av fenotypisk plasticitet på cancer aggressivitet och behandlingar.

Abstract

Fenotypisk plasticitet refererar till ett fenomen i vilket celler transient få drag av annan härstamning. Under carcinoma progression driver fenotypisk plasticitet invasion, spridning och metastaser. I själva verket, medan de flesta av studierna av fenotypisk plasticitet har varit i samband med epitelceller härledda karcinom, visar det sig sarkom, som är mesenkymala ursprung, även uppvisar fenotypisk plasticitet, med en delmängd av sarkom genomgår ett fenomen som liknar en mesenchymal- epitelial övergång (MET). Här har vi utvecklat en metod som innefattar miR-200 familj och grainyhead liknande 2 (GRHL2) för att efterlikna denna MET-liknande fenomen observeras i sarkom patienten samples.We sekventiellt uttrycker GRHL2 och miR-200 familjen med cell transduktion och transfektion, respektive , att bättre förstå de molekylära grunderna för dessa fenotypiska övergångar i sarkomceller. Sarkomceller som uttrycker MIR-200s och GRHL2 demonstrerade förbättrad epitelial characteristics i cellmorfologin och ändring av epiteliala och mesenkymala biomarkörer. Framtida studier med användning av dessa metoder kan användas för att bättre förstå de fenotypiska konsekvenserna av MET-liknande processer på sarkomceller, som migration, invasion, metastatic benägenhet, och terapi beständighet.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Fenotypisk plasticitet avser en reversibel övergång mellan cellulära fenotyper, och är allmänt uppdelade i två typer, epitelial-till-mesenkymala (EMT) övergångar och mesenkymala-to-epitelial övergångar (MET). Denna fenotypisk plasticitet spelar en viktig roll i normala processer flercelliga organismer, såsom utveckling och sårläkning 1; emellertid, kan dessa samma reaktionsvägar och genuttryck program också leda till sjukdom, såsom fibros (översikt i 2, 3, 4) och karcinom metastas (översikt i referenserna 5, 6, 7, 8). Under metastas, till exempel, EMT stör cell polaritet, cell-cell-interaktioner, och främjar invasion 9, 10. Tillsammans EMT bidras till en fenotypisk tillstånd som underlättar cancer cell spridning. Dessutom leder EMT också tillsammans med många andra fenotypiska förändringar som driver en aggressiv fenotyp, inklusive avreglering av cancercellmetabolism 6, utveckling av läkemedelsresistens 11, 12, ökad tumör initiering förmåga 13, 14 och värdimmunundandragande 15.

Fenotypisk plasticitet har studerats i cancer progression; emellertid sarkom uppvisar även fenotypisk plasticitet. Intressant nog verkar det som om en del av samma förare av fenotypisk plasticitet i karcinom bidrar också till sarkom plasticitet och aggressivitet. Till exempel, har cirkulerande tumörceller (CTCs) från sarkom patienter visats uttrycka EpCAM, ett cellytprotein som typiskt påträffas på epitelceller 16. Addinellt, var 250 mjukdelssarkom prover kategoriseras som epitelial liknande eller mesenkymala liknande baserat på genuttryck. Patienter i epitel-liknande biomarkör signatur hade en bättre prognos än patienter med mesenkymala liknande biomarkör signatur 17. Detta är i linje med många karcinom, där patienter med mer epitelceller liknande karcinom har bättre resultat jämfört med patienter med mer mesenkymala liknande tumörer 18.

Medan vissa sarkom visa biomarkörer och genuttryck vägar överensstämmer med MET, förblir de molekylära grunderna för denna fenotypisk plasticitet dåligt kända. Att studera mekanismerna och förare av MET i sarkom vi utvecklat en modell för MET induktion med två epitelceller specifika faktorer, mikroRNA (MIR) -200 familj och grainyhead liknande 2 (GRHL2). De MIR-200s är en familj av små icke-kodande RNA som reglerar genuttryck genom bindning till de 3' UTR av MessenGER-RNA och förhindra translation till protein. Den miR-200-familjen består av två undergrupper - en som innehåller miR-141 och miR-200a, och den andra inklusive miR-200b, miR-200c, och miR-429. Medlemmar av miR-200 familjen anrikas i epitelvävnader, och förlusten av MIR-200s är associerad med metastas i karcinom 19. Den miR-200 familjen är också nedregleras i mjuka vävnadssarkom jämfört med normal vävnad 20. I likhet med de MIR-200s är GRHL2 en viktig regulator som är viktig för epitelial utveckling 21. Den GRHL2 transkriptionsfaktor verkar på två sätt att uppreglera epiteliala gener, såsom E-kadherin: 1) I epitelceller, GRHL2 undertrycker direkt EMT huvudregulatorn, ZEB1 22; och 2) GRHL2 aktiverar direkt transkription av epiteliala gener 23. Våra tidigare undersökningar har visat att kombinerad uttryck för MIR-200s och GRHL2 i sarkomcellerinducerar en MET-liknande fenotyp 24. Här presenterar vi ett detaljerat protokoll för att skapa en modell in vitro av MET-induktion i sarkomceller med användning av ektopiskt uttryck av MIR-200s och GRHL2.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Framställning av reagenser

  1. Förbereda DMEM för cellkultur genom att tillsätta 50 ml fetalt bovint serum (FBS) och 5 ml av penicillin-streptomycin (5000 U / ml) för att 500 ml DMEM. Detta medium kan förvaras vid 4 ° C i upp till sex månader.
  2. Resuspendera lyofiliserade primrar i nukleasfritt vatten till en slutlig koncentration av 10 uM. Butiks resuspenderas primrar vid -20 ° C.
  3. Förbereda radioimmunoprecipitation assay (RIPA) buffert (150 mM NaCl, 0,5% natriumdeoxikolat, 0,1% SDS, 50 mM Tris, pH 8,0). Komplettera med proteashämmare cocktail före användning och hålla buffert på is när den används. Lagra vid 4 ° C.
  4. Förbereda 10 mg / ml polybren (hexadimetrinbromid) i vatten och sprutfilter för att sterilisera med användning av ett 0,45 fim polyetersulfon filter. Lösningen kan lagras vid 4 ° C i upp till sex månader.
  5. Bered en 1 mg / ml arbetslösning av nitroblå tetrazoliumklorid genom upplösning av 10 mg i 10 ml PBS. Lagra vid 4 ° C.

2. Lentiviral Transduktion av GRHL2

Dag 1

  1. Plattan 3 x 10 5 HEK293T celler per brunn i en 6-brunnars platta i 2 ml kompletterat DMEM. Kvantifiera celler med användning av en automatiserad cellräknare. Celler bör vara 40 - 60% sammanflytande efter odling över natten vid 37 ° C med 5% CO2.

Dag 2

  1. Späd 2 pg av tom vektor (pCMV-UBC-EGFP) eller 2 | ig av pCMV-GRHL2-UBC-EGFP 24, 25 i 200 mikroliter av serumfria medier tillsammans med 1,8 ^ g av pΔ8.9 och 0,2 pg av pCMV-VSV -G hjälpar plasmider. I ett separat rör, späd 4 mikroliter av en lipidbaserad transfektion reagens i 200 mikroliter av serumfria medier per transfektion (8 | il i 400 | il för två prover). Tillsätt 200 pl av transfektion reagensblandningen för varje plasmid-lösning och inkubera under 20 min vid rumstemperatur.
  2. Under incubation, tvätta HEK293T celler genom avlägsnande av mediet genom vakuumsugning och sköljning celler med 1 mL PBS. Byt ut PBS med 800 mikroliter av serumfria medier. Efter 20 minuter, tillsätt 200 | il av transfektionsreagens: plasmid blandningen från steg 2,2 droppvis till varje brunn och inkubera cellerna under 2 h vid 37 ° C i 5% CO2.
  3. Försiktigt bort transfektion mediet genom vakuumaspiration och ersätta med 2 ml av kompletterat DMEM. Återgå cellerna till inkubatorn för övernattning kultur.
    OBS: HEK293T celler är löst vidhäftande. ersättningsmedia måste utföras med försiktighet för att begränsa avlägsnandet av celler från botten av skålen eller flaskan.

dag 3

  1. Uppdatera media på transfekterade HEK293T celler och plattan 3 x 10 5 RD-celler per brunn i en 6-brunnars platta i 2 ml kompletterat DMEM. Odlingsceller över natten. RD-celler är ett kommersiellt tillgängligt humant rabdomyosarkom-cellinje.

dag 4

  • Samla viral media från HEK293T celler. Pipettera DMEM medier ur HEK293T celler och plats i en ny 15 ml koniska. Försiktigt ersätta med nya DMEM media och plats HEK293T celler tillbaka i inkubatorn för nästa dag.
  • Lägg 2 mikroliter av 10 mg / ml polybren per ml av virala medier i två nya 50 ml koniska rör (en för den tomma vektorn transfektion och en annan för GRHL2 transfektion). Sprutfilter viral media genom avlägsnande av kolven från en 3 ml spruta och bifoga en 0,45 fim polyetersulfon filter till spetsen.
    1. Lägga de virala media som samlats in i steg 2,6 in i sprutan, och störta på material i de nya 50 ml koniska rör som innehåller polybren. Avlägsna media från RD-celler genom vakuumaspiration och lägga filtrerades viral media till RD-celler.
  • dag 5

    1. Upprepa Dag 4. HEK293T celler kan kastas efter den virala media har samlats.

    dag 7

    1. Wash RD-celler med 1 mL PBS och tillsätt 200 | il av 0,05% trypsin per brunn. Inkubera vid 37 ° C under 5 minuter, tillsätt 2 ml av kompletterat medium, och flytta cellsuspensionen till ett nytt 15 ml koniskt. Centrifugera cellerna vid 250 xg under 5 min vid rumstemperatur och aspirera media. Återsuspendera i 1 ml DMEM (kompletterat med 5% FBS och 1% penicillin-streptomycin).
      OBS: Med hjälp av en högre andel av FBS kan orsaka igensättning under flödescytometri
      1. Filterceller för flödescytometri. Använda en pipett för att tillämpa ett mL RD cellsuspension genom ett 30 pm filter in i flödescytometri rör och placera rören på is.
      2. Sorterings EGFP + celler 26 in i 1,5 ml mikrocentrifugrör innehållande 0,5 ml DMEM kompletterat med 10% FBS och 1% penicillin-streptomycin och placera på is. Plattan EGFP + sorterade celler i totalt 1 ml kompletterat DMEM till en enda brunn i en 12-brunnsplatta och placera i inkubator för kulturen.
        ; OBS: Utbytet av EGFP + -celler från flödescytometri efter denna transduktion vanligtvis är låga (50,000-100,000 celler). Celler kan behöva odlas i 10 - 14 dagar innan du fortsätter till steg 3.

    3. Omvänd Transfektion av MIR-200s

    1. Förbereda 50 pM lager av miR-200 härmar användning nukleasfritt H 2 O. Alikvotera bestånd och förvara vid -20 ° C för att undvika upprepade frysnings / tiningscykler.
    2. Lägg 3 mikroliter av varje 50 | iM miR-200 härma (miR-200a, miR-200b, och miR-200c) till 300 mikroliter av serumfria medier eller 9 mikroliter av 50 jiM negativ kontroll miRNA till 300 mikroliter serumfritt medium.
    3. Tillsätt 6 mikroliter av siRNA-specifik transfektionsreagens till 600 mikroliter av serumfria medier och dela upp 300 mikroliter av denna blandning i två rör, en för vardera av de två mir blandningar från steg 3,2. Kombinera de 300 mikroliter av varje miR blandningen från steg 3,2 med en blandning av 300 mikroliter av transfektionsreagens. Inkubera i 20 min vid rums temperature.
    4. Medan inkubering, bereda en cellsuspension av 600.000 EGFP + RD-celler som uttrycker EV eller GRHL2 skapas i avsnitt 2 i 2,4 ml (250 celler / pl) av serumfritt medium per behandling.
    5. I en 24-brunnsplatta, tillsätt 100 pl per brunn av miR-200 blandning eller negativ kontroll blandningen från steg 3,3 i sex brunnar, och sedan lägga till 400 mikroliter av varje cellsuspension in i tre brunnar av varje miR mix.
    6. Inkubera cellerna vid 37 ° C i 5% CO 2 över natten och ändra media för att fullt kompletterat DMEM följande dag. Samla upp celler 2 dagar senare för analys med användning av lämplig buffert (se nedan). Time-lapse avbildning av RD-sarkomceller som genomgår MET finns som kompletterande material. Bild varje brunn var 2 timmar med en 10X mål med hjälp av en automatiserad live-cell kameran 27.

    4. RNA-extraktion, omvänd transkription, och qPCR

    1. Utdrag RNA enligt tillverkarens anvisningar med hjälp av en standard RNAextraktion kit 24. Extraherade RNA kan lagras vid -80 ° C.
    2. Kvantifiera RNA-koncentration. Tina och arbeta med RNA på is. Att kvantifiera RNA-koncentrationer, mäta UV-absorbans vid 260 nm med en plattläsare spektrofotometer enligt tillverkarens protokoll. Späd alla prover till den lägsta koncentrationen med nukleasfritt vatten.
    3. Utföra omvänd transkription av total-RNA till komplementärt DNA (cDNA). Kombinera inte mindre än 100 ng av totalt RNA med PCR-buffert, dNTP-blandning (100 mM), slumpmässiga hexamerprimrar, omvänt transkriptas och nukleasfritt vatten i en 20 | il reaktionsvolym 24. Köra RT cykler enligt tillverkarens protokoll. cDNA kan lagras lång sikt vid -20 ° C.
    4. Späd 20 pl reaktioner på 100 mikroliter med 80 mikroliter av nukleasfritt H 2 O.
    5. Blanda 5 | il av en fluorescensbaserad interkalerande färg 2x qPCR huvudblandning, 0,06 | il av varje 10 pM primer, ennd 2 mikroliter av utspädd RT-reaktion per prov.
    6. Kör qPCR enligt tillverkarens protokoll för fluorescens-baserade Master Mix.
    7. Kvantifiera relativa mängder av mRNA av delta CT metoden och normalisera till GAPDH. Plotta den genomsnittliga mRNA-uttryck av biologiska replikat ± standardavvikelse för varje behandlingsgrupp.
      OBS: Särskilda försiktighetsåtgärder bör vidtas när man arbetar med RNA för att undvika kontakt med RNaser, som att använda RNas-fri plast och reagens. Återanvändbar utrustning bör behandlas före användning för att avlägsna RNaser.

    5. immunofluorescensfärgning

    1. Efter steg 3,6, aspirera media genom vakuumsugning från RD-celler i 24-brunnsformat.
    2. Fixera celler genom att tillsätta 500 mikroliter av 4% paraformaldehyd (PFA) per brunn och inkubera under 15 min vid rumstemperatur (RT). Efter fixering, placera cellerna i fosfatbuffrad saltlösning (PBS) och förvara vid 4 ° C över natten om nödvändigt.
    3. permeabiliseraceller genom tillsats av 500 mikroliter av PBS + 0,2% Triton-X100 och inkubera 30 minuter vid RT. Genom vakuumsugning, avlägsna permeabilization buffert och tvätta tre gånger med PBS.
    4. Block i 500 mikroliter av 5% bovint serumalbumin (BSA) / PBS och inkubera cellerna under 30 min vid RT. Celler kan lagras vid 4 ° C över natten om nödvändigt.
    5. Förbereda primär antikropp utspädning. Pipettera 200 mikroliter av 5% BSA / PBS per brunn i en 15 ml konisk (12 brunnar = 2,4 ml) och till 1 mikroliter av primär antikropp per ml av 5% BSA / PBS behövs. Avlägsna blockerande buffert genom vakuumsugning och dispensera 200 | il utspädd primär antikropp till varje brunn.
      1. Inkubera celler i en: 1000 utspädda primära antikroppar i 5% BSA / PBS under 1 h vid RT eller över natten vid 4 ° C. Efter inkubation, tvätta cellerna två gånger med PBS.
    6. Förbereda den sekundära antikroppsutspädning i samma volym av 5% BSA / PBS som ovan. Lägga den bortre-rött färgämne-konjugerad sekundär antikropp med användning av en 1: 2000 utspädning. dessutom lägga1 | j, g / ml Hoechst färgämne till mixen. Ta bort PBS och tillsätt 200 mikroliter av blandningen till varje brunn.
      1. Inkubera vid RT under 1 h i mörker. Tvätta 3 gånger med PBS, lämna cellerna i PBS, och skyddar cellerna från ljus med användning av folie. Celler kan lagras vid 4 ° C om nödvändigt.
    7. Bild celler vid 400 gångers total förstoring på ett inverterat epifluorescensmikroskop med excitationsvåglängd 594-650 nm.

    6. Western Blotting

    1. Tvätta celler från 3,6 två gånger med iskall PBS. På is, lyserar celler med 50 mikroliter av 1x RIPA-buffert kompletterad med 1x proteasinhibitorcocktail.
    2. Berg lysat vid 4 ° C i 15 minuter, samla lysat i 1,5 ml rör och centrifugera vid hög hastighet (20 tusen xg) i 5 min för att klargöra prover. Cellysat kan lagras lång sikt vid -80 ° C om nödvändigt.
    3. Kvantifiera totalt protein med användning av en Bradford-analys och delprov en lika stor mängd protein i nya 1,5 ml mikrocentrifugrör. Bring prover till lika stor volym med hjälp av RIPA-buffert och 3x Laemmli laddningsbuffert som kompletterats med 2-merkaptoetanol.
    4. Inkubera prover i 1x Laemmli-provladdningsbuffert i 5 minuter vid 95 ° C och kördes SDS-PAGE med användning av en 4-12% Tris-glycin-gel vid 200 V under 45 min. Mängden av proteinladdade områden beroende på cellinjen. I vissa fall behövs 50-100 | ig av totalt protein för att detektera E-cadherin i mesenkymala cellinjer.
    5. Överföring proteiner till ett nitrocellulosamembran i 2 h vid 50 V i 1 x Tris-glycin överföringsbuffert.
    6. Blocket membranet under 1 h vid rumstemperatur eller över natten vid 4 ° C i en BSA-baserad blockeringsbuffert.
    7. Späd primära antikroppar vid 1: 1000 koncentration i 5 ml blockeringsbuffert, till utspädning till membranet, och inkubera under försiktig skakning under 1 h vid rumstemperatur eller över natten vid 4 ° C. Tvättmembran 3 gånger i PBS med 0,05% Tween-20.
    8. Inkubera membran för 1 h vid RT med infraröd fluorescerande kopplade secondary antikropp vid 1: 20 tusen spädning i blockeringsbuffert som ovan.
    9. Tvätta membran två gånger i PBS med 0,05% Tween-20 och därefter en gång i PBS.
    10. Bildmembran med användning av standard infraröd fluorescensdetektering.

    7. förankringsoberoende tillväxt Analyser

    OBS: För en detaljerad mjuk agar analysprotokoll, se 28.

    1. Varm steril 2x DMEM media till 42 ° C i varmvattenbad. Under denna tid, värme förväg autoklaverat 1% agaros i mikron i 3 min. Mikrovågsugn under ytterligare 30 s vid en tidpunkt efter behov eller tills fullständigt smält. Flytta agaros till en 42 ° C vattenbad.
    2. Placera ett 50 ml koniskt rör i en bägare med 42 ° C vatten i en steril huva och blanda 1% agaros och 2x DMEM-medium i en 1: 1-förhållande står för 1,5 ml blandning per brunn i en 6-brunnsplatta. förbereda alltid extra DMEM / agaros att redogöra för pipettering fel och för att undvika bubblor.
    3. Lägg blandningen tillsidor av brunnen, vilket garanterar inga bubblor bildas och låt stå i 30 min vid RT.
    4. Medan bottenskiktet stelnar, förbereda varje grupp av RD-celler transfekterade i steg 3 genom att aspirera media och tvättning en gång med 1 ml PBS. Aspirera PBS och till 0,2 ml av 0,05% trypsin och inkubera vid 37 ° C under 5 min.
    5. Neutralisera trypsin i 0,8 ml av media och finfördela celler för att bilda en enkelcellsuspension. Överföra cellsuspensionen till en 15 ml koniskt rör.
    6. Räkna celler och beräkna volymen av cellsuspension som krävs för 10.000 celler per brunn.
    7. Värma 0,6% agaros i mikron i 3 min, följt av 30 s i taget tills fullständigt smält. Flytta agaros till 42 ° C vattenbad.
    8. Placera ett 50 ml koniskt rör i en bägare med 42 ° C vatten i en steril huva. Blanda 0,6% agaros och späddes cellsuspensionen i en 1: 1-förhållande för att framställa 1,5 ml blandning per brunn i en 6-brunnsplatta. förbereda alltid extra cellsuspensionen / agaros blanda redogöra för pipettering fel ochför att undvika bubblor.
      OBS: Det är viktigt att arbeta vid 42 ° C här. Om temperaturen är alltför låg blandningen stelnar innan plätering, och temperaturer över 42 ° C kommer att påverka cellviabilitet.
    9. Blanda väl genom triturering celler flera gånger och tillsätt cellblandning till brunnarna, vilket garanterar ingen bubblor form, och låt stelna i 20 min vid RT.
    10. Tillsätt 2 ml av kompletterat medium till varje brunn och flytta plattor att inkubator.
      1. Ändra media gång i veckan under 3-4 veckor eller tills flercelliga kolonier bildas. Var noga med att undvika att röra agar när du tar bort media genom vakuumsugning. Alternativt använda en P1000 för att ta bort det översta lagret av flytande media.
      2. Färga mjuka agarplattor genom att tillsätta 200 mikroliter av Nitro Blue Tetrazolium kloridlösning (1 mg / ml i PBS) och inkubera plattan över natten vid 37 ° C. Byt media nästa dag med PBS för avbildning.
      3. Bild brunnar vid 40X total förstoring på ett inverterat mikroskop.
      4. Utför analys på ImageJ för koloniområde och nummer. Plot menar koloni antal biologiska replikat ± standardavvikelse.

    Subscription Required. Please recommend JoVE to your librarian.

    Representative Results

    or Start trial to access full content. Learn more about your institution’s access to JoVE content here

    Schemat för MET-induktion i sarkomceller

    En allmän tidslinje för induktionen av MET-liknande förändringar i sarkomceller visas i figur 1. Protokollet börjar genom att transducera GRHL2 (figur 1 A), följt av transfektion av miR-200 familjen (Figur 1B). GRHL2 eller miR-200 familjemedlemmar kunde inte påverka uppkomsten av RD-celler när de uttrycks ensamma, men ektopisk uttryck för GRHL2 och MIR-200s tillsammans resulterar i epitelceller liknande morfologiska förändringar i RD-celler. Celler övergång från en spolformad form till en mer rundad utseende med ökad cell-cellkontakt (Figur 1C).

    Induktion av MET-liknande förändringar i sarkomceller

    Den morfologiska förändringen i RD-celler på GRHL2 och miR-200överuttryck åtföljdes av uppreglering av den epiteliala markör E-cadherin (figur 2A). Tillsats av MIR-200s uppreglerad E-cadherin ensam, men kombinerat MIR-200s och GRHL2 överuttryck synergistiskt förhöjd E-cadherin-uttryck (figur 2A; inte logga skala). Dessutom fanns det en ökning vid cell-cell junctions av epitelial adhesionsmolekyler, EpCAM och TJP1, vita pilar (även känd som zona occludens 1, ZO-1) (Figur 2B).

    MET induktion minskar kolonibildningsförmåga sarkomceller

    Uppreglering av epiteliala proteiner åtföljdes av nedreglering av mesenkymala gener Zeb1 och NOTCH1 (figur 3A), vilka är kända mål för miR-200. Induktion av MET reducerade förankringsoberoende tillväxt av RD-celler mätt genom koloniantal (figur 3B). detta growth hämning drevs av enbart MIR-200s; som överuttryck av GRHL2 ledde till en ökning av förankringsoberoende tillväxt (figur 3). Detta är i överensstämmelse med tidigare rapporter som visar GRHL2 uttryck inducerar förankringsoberoende tillväxt 22.

    Figur 1
    Figur 1: Tidslinje för MET Induktion med GRHL2 Överuttryck och miR-200 Transfektion. (A) Tidslinje av ektopisk överexpression av GRHL2 i målceller. (B) Tidslinje för MET-induktion via omvänd transfektion av miR-200 familjemedlemmar i målceller. (C) GRHL2 och miR-200 överuttryck lett till förändringar i morfologin av målceller som överensstämmer med MET. Skala bar = 75 pm Klicka härför en större version av denna figur.

    figur 2
    Figur 2: Samtidig Överuttryck av GRHL2 och MIR-200s Led till MET i målceller. (A) Expression av MIR-200s ledde till förhöjd E-cadherin expression medan kombinerad expression av GRHL2 och MIR-200s producerade en synergistisk effekt på E-cadherin expression vid både mRNA (medelvärden ± standardavvikelse) och proteinnivåer. (B) Kombinerat uttryck av GRHL2 och MIR-200s lett till ökat uttryck av EpCAM och TJP1 vid cell-cellkontakter (pilar). Scale bar = 20 | im. * Indikerar p <0,05 analyserades med användning av ANOVA med Tukeys post hoc correction.This figur har modifierats 24 referens. Copyright © American Society for Microbiology, Molecular Cell Biology, volym 36, Issue 19, 2503-2513, 2016. Klicka här för att se en större version av denna siffra.

    figur 3
    Figur 3: Expression av MIR-200S trycker Mesenkymala markörer och Minskningar förankringsoberoende tillväxt i sarkomceller. (A) över - expression av MIR-200s men inte GRHL2 inhiberade Zeb1 och NOTCH1 mRNA-uttryck (medelvärden ± standardavvikelse). (B) Överuttryck av MIR-200s men inte GRHL2 inhiberade anoikis motstånd i sarkomceller. Representativa bilder av färgade kolonier (Skalstreck = 200 | im) och kvantifiering av koloniantalet (medelvärden ± standardavvikelse) visas. * Indikerar p <0,05 analyserades med användning av ANOVA med Tukeys post hoc correction.This figur har modifierats referens 24. Copyright © American Society for Microbiology, Molecular Cell Biology, volym 36, Issue 19, 2503-2513, 2016. Klicka här för att se en större version av denna siffra.

    figur 3
    Kompletterande Video: RD celler som uttrycker tom vektor och negativa kontroll miRNA. Videor sammanställdes från bilder av RD-celler transfekterade med tom vektor och negativa kontroll miRNA förvärvade varannan timme med hjälp av en automatiserad live-cell kameran. Klicka här för att se filmen. (Högerklicka för att ladda ner.)

    figur 3 />
    Kompletterande Video 2: e celler som uttrycker GRHL2-EGFP och negativa kontroll miRNA. Videor sammanställdes från bilder av RD-celler transfekterade med GRHL2-EGFP och negativa kontroll miRNA förvärvade varannan timme med hjälp av en automatiserad live-cell kameran. Klicka här för att se filmen. (Högerklicka för att ladda ner.)

    figur 3
    Kompletterande Video 3: e celler som uttrycker tom vektor och miR200 miRNA. Videor sammanställdes från bilder av RD-celler transfekterade med tom vektor och miR200 miRNA förvärvade varannan timme med hjälp av en automatiserad live-cell kameran. Klicka här för att se filmen. (Högerklicka för att ladda ner.)

    nt" fo: keep-together.within-page = "1"> figur 3
    Kompletterande Video 4: e celler som uttrycker GRHL2-EGFP och miR200 miRNA. Videoklipp sammanställts från bilder av RD-celler transfekterade med GRHL2-EGFP och miR200 miRNA förvärvade varannan timme med hjälp av en automatiserad live-cell kameran. Klicka här för att se filmen. (Högerklicka för att ladda ner.)

    Subscription Required. Please recommend JoVE to your librarian.

    Discussion

    or Start trial to access full content. Learn more about your institution’s access to JoVE content here

    Sarkom är sällsynta, men mycket aggressiv cancer i en mesenkymal härstamning. Trots deras mesenkymala härstamning visas en delmängd av sarkom att genomgå en fenotypisk övergång till en mer epitelial liknande tillstånd. Detta MET-liknande brytare har prognos relevans, eftersom patienter med mer epitelceller liknande tumörer är mindre aggressiv 24. Trots deras kliniska relevans, det finns få studier som behandlar de molekylära mekanismer som driver dessa fenotypiska övergångar i sarkom.

    För att undersöka MET-liknande övergångar i sarkomceller, har vi utvecklat en MET-induktion modell genom att kombinera uttryck för epiteliala faktorer GRHL2 och miR-200 familj. Denna metod inducerar snabbt sarkomceller för att bli mer epitelliknande mätt genom förändringar i morfologi och genuttryck. Med hjälp av detta protokoll för att framkalla MET i sarkomceller underlättar studier av effekterna av dessa övergångar på fenotyper som driver sarkom aggression, till exempelsåsom migration, invasion, proliferation och död beständighet och hur var och en av dessa förändringar i biologi kan påverka läkemedelsresistens.

    I samband med epitelceller härledda karcinom, är uttryck av en mesenkymal faktor ofta tillräcklig för att inducera EMT 14. Emellertid i detta sarkom härrörande modell av MET uttrycket av två epiteliala faktorer, GRHL2 och MIR-200s, erfordras. Intressant, MIR-200s ensamt hade en starkare effekt på de flesta biomarkörer för MET än GRHL2, medan GRHL2 kunde kraftigt aktivera epiteliala gener endast i närvaro av miR-200-baserade repression av epiteliala gen repressorer, såsom ZEB1 24. Det är möjligt att för vissa mesenkymala celltyper epiteliala gener måste vara både de-tryckt (t.ex. via MIR-200s) och aktiverad (t.ex. via GRHL2) för att driva MET.

    Vi har upplevt variation i nivåerna av GRHL2 uttryck i olika cell linjer. Att övervinna detta använde vi en GRHL2 expressionsplasmid som också uttrycker EGFP 25 att sortera med flödescytometri EGFP positiva celler före experiment. Det är också viktigt att validera funktionalitet MIR-200s och GRHL2 i olika celltyper. EMT ses som ett spektrum baserat på uttryck av epitel- och mesenkymala associerade gener, som kan ha kontextberoende variation baserad på cellinje, cancertypen, behandling, etc. Därför analyserade vi fem gener som regleras av miR-200 eller GRHL2 till redogöra för cellkontextberoende förändringar. En annan nackdel med denna analys är att det bygger på en transient transfektion av MIR-200s för MET induktion. Således kan långtidsförsök blir kostsamma och komplicerade när flera upprepade transfektioner blir nödvändiga. Detta kan övervinnas genom användning av miR-200-expressionsplasmider.

    Andra studier har också rapporterat bevis på MET i sarkom. Till exempel var MET observerats i en delmängd av leiomyosarcomas och associerades med bättre överlevnad för patienterna. Mekanistiskt, Yang et al. fann att i en leiomyosarcoma cellinje hämning av Slug med siRNA var tillräcklig för att inducera MET-liknande förändringar 29. Likaledes, utarmning av ännu en mesenkymala faktor, snigel, i mesenkymala stamceller reducerade sarkom bildning hos möss 30. Sålunda är det uppenbart från litteraturen att det finns flera vägar till en MET-liknande fenotyp, vilket kan variera beroende på celltypen. Även om detta är inte det enda sättet att förmå MET, har vi använt vår metod för att framkalla MET i två sarkom subtyper, inklusive rabdomyosarkom (RD celler) och osteosarkom (143B-celler). I framtiden skulle det vara intressant att jämföra dessa olika metoder i ett bredare spektrum av sarkomceller. Till exempel, vissa sarkom subtyper har bakomliggande genetiska eller epigenetiska förändringar som gör dem mer eller mindre känsliga för MET induktion?

    Identifiera effekten av METpå en mängd olika biologiska utgångar i sarkom celler skulle kunna ge en bättre förståelse för varför patienter med mer epitelceller liknande sarkom har en förbättrad prognos. Dessutom förstå effekten av behandlingen på att driva fenotypiska övergångar mellan stater skulle fördjupa vår biologiska förståelsen och informera på svar på nuvarande terapier i sarkom patienter.

    Subscription Required. Please recommend JoVE to your librarian.

    Disclosures

    Författarna har ingenting att lämna ut.

    Acknowledgments

    JAS erkänner stöd från Duke Cancer Institute, The Duke University Genitourinary Oncology Laboratory och Duke University Department of Orthopaedics. HL stöddes av National Science Foundation (NSF) Centrum för teoretisk biologisk fysik (NSF PHY-1.427.654) och NSF DMS-1.361.411, och som en CPRIT (Cancer Prevention och Forskningsinstitut Texas) Scholar i Cancer Research i delstaten Texas vid Rice University. KEW stöddes av NIH F32 CA192630 MKJ och HL gynnats av användbara diskussioner med Mary C. Farach-Carson, JN Onuchic, Samir M. Hanash, Kenneth J. Pienta, och Donald S. Coffey.

    Materials

    Name Company Catalog Number Comments
    Countess automated counter Life technologies AMQAX1000
    Countess cell counting chamber slides Invitrogen C10283
    SimpliAmp Thermal Cycler Thermo Fisher A24811
    Odyssey Fc LI-COR Inc
    ViiA7 Real Time PCR System Thermo Fisher 4453536
    PCR microplate Corning 321-29-051
    KAPA SYBR Fast Universal qPCR Kit KAPA Biosystems KK4602
    Starting Block (PBS) Blocking Buffer Thermo Fisher 37538 BSA-based blocking buffer
    Agarose General Purpose LE Genesee Scientific 20-102
    10x Tris/Glycine/SDS Buffer Bio-Rad Laboratories Inc 161-0732 Running buffer
    10x Tris/Glycine Buffer Bio-Rad Laboratories Inc 161-0734 Transfer buffer
    RIPA Buffer Sigma Life Sciences SLBG8489
    Amersham Protran 0.45 μm nitrocellulose GE Healthcare Lifesciences 10600012
    Quick-RNA MiniPrep Kit Genesee Scientific 11-358
    Laemmli Sample Buffer (4X) Bio-Rad Laboratories Inc 1610747
    Mini Trans-Blot Cell Bio-Rad Laboratories Inc 1703930
    Mini-Protean Tetra Cell Bio-Rad Laboratories Inc 1658005EDU
    DPBS Life technologies 14190-144
    0.05% Trypsin-EDTA Life technologies 11995-065
    DMEM Life technologies 11995-065
    Lipofectamine RNAi Max Thermo Fisher 13778150
    Lipofectamine 2000 Ragents Thermo Fisher 11668019
    Penicillin Streptomycin Life technologies 15140-122
    miRVana miRNA mimic negative control #1 Thermo Fisher 4464058 neg miRNA
    hsa-miR-200 mirVana miRNA mimic Thermo Fisher 4464066 miR200A
    has-miR-200 mirVana miRNA mimic Thermo Fisher 4404066 miR200B
    has-miR-200 mirVana miRNA mimic Thermo Fisher 4404066 miR200C
    Opti-MEM Life technologies 11088-021 serum-free media
    anti-Ecadherin antibody BD Bioscience 610182
    anti-beta actin Santa Cruz Biotechnology sc-69879
    anti-EpCam Ab Serotec MCA18706
    anti-ZO1 Invitrogen 402200
    IRDye 800W LI-COR Inc 925-32210
    IRDye 680 LI-COR Inc 926-32223
    anti-mouse AlexaFluor 647 Thermo Fisher A211241
    anti-rabbit AlexaFluor 647 Thermo Fisher ab150075
    Halt Protease and Phosphatesse Inhibitor Thermo Fisher 1861281
    Precision Plus Protein Dual Color Bio-Rad Laboratories Inc 161-0374
    Partec CellTrics Sysmex 04-004-2326 30 μm filter for flow
    GAPDH-F IDT AGCCACATCGCTCAGACAC
    GAPDH-R IDT GCCCAATACGACCAAATCC
    Ecadherin-F IDT TGGAGGAATTCTTGCTTTGC
    Ecadherin-R IDT CGCTCTCCTCCGAAGAAAC
    ZEB1-F IDT GCATACAGAACCCAACTTGAACGTC
    ZEB1-R IDT CGATTACACCCAGACTGC
    NOTCH-F IDT GGCAATCCGAGGACTATGAG
    NOTCH-R IDT CTCAGAACGCACTCGTTGAT
    nitro blue tetrazolium  Sigma N5514
    hexadimethrine bromide Sigma H9268 polybrene
    3 mL syringe BD Bioscience 309657
    Sterile syringe filter VWR 28145-505
    5mL polypropylene round-bottom tube 352063 flow cytometry tubes
    High-Capacity cDNA Reverse Transcription Kit Thermo Fisher 4368814 reverse transcription kit
    4% paraformaldyhyde Santa Cruz Biotechnology sc-281612
    Triton-X100 Sigma 93443
    bovine serum albumin Sigma A7906

    DOWNLOAD MATERIALS LIST

    References

    1. Weber, C. E., Li, N. Y., Wai, P. Y., Kuo, P. C. Epithelial-mesenchymal transition, TGF-beta, and osteopontin in wound healing and tissue remodeling after injury. J Burn Care Res. 33, (3), 311-318 (2012).
    2. Galichon, P., Finianos, S., Hertig, A. EMT-MET in renal disease: should we curb our enthusiasm. Cancer Lett. 341, (1), 24-29 (2013).
    3. Carew, R. M., Wang, B., Kantharidis, P. The role of EMT in renal fibrosis. Cell Tissue Res. 347, (1), 103-116 (2012).
    4. Willis, B. C., Borok, Z. TGF-beta-induced EMT: mechanisms and implications for fibrotic lung disease. Am J Physiol Lung Cell Mol Physiol. 293, (3), L525-L534 (2007).
    5. Ye, X., Weinberg, R. A. Epithelial-Mesenchymal Plasticity: A Central Regulator of Cancer Progression. Trends Cell Biol. 25, (11), 675-686 (2015).
    6. Li, L., Li, W. Epithelial-mesenchymal transition in human cancer: comprehensive reprogramming of metabolism, epigenetics, and differentiation. Pharmacol Ther. 150, 33-46 (2015).
    7. Tsai, J. H., Yang, J. Epithelial-mesenchymal plasticity in carcinoma metastasis. Genes Dev. 27, (20), 2192-2206 (2013).
    8. Bitting, R. L., Schaeffer, D., Somarelli, J. A., Garcia-Blanco, M. A., Armstrong, A. J. The role of epithelial plasticity in prostate cancer dissemination and treatment resistance. Cancer Metastasis Rev. 33, (2-3), 441-468 (2014).
    9. Schaeffer, D., Somarelli, J. A., Hanna, G., Palmer, G. M., Garcia-Blanco, M. A. Cellular Migration and Invasion Uncoupled: Increased Migration Is Not an Inexorable Consequence of Epithelial-to-Mesenchymal Transition. Mol Cell Biol. 34, (18), 3486-3499 (2014).
    10. Mathow, D., et al. Zeb1 affects epithelial cell adhesion by diverting glycosphingolipid metabolism. EMBO Rep. 16, (3), 321-331 (2015).
    11. Ware, K. E., et al. A mechanism of resistance to gefitinib mediated by cellular reprogramming and the acquisition of an FGF2-FGFR1 autocrine growth loop. Oncogenesis. 2, e39 (2013).
    12. Yauch, R. L., et al. Epithelial versus mesenchymal phenotype determines in vitro sensitivity and predicts clinical activity of erlotinib in lung cancer patients. Clin Cancer Res. 11, (24 Pt 1), 8686-8698 (2005).
    13. Jolly, M. K., et al. Towards elucidating the connection between epithelial-mesenchymal transitions and stemness. J R Soc Interface. 11, (101), 20140962 (2014).
    14. Mani, S. A., et al. The epithelial-mesenchymal transition generates cells with properties of stem cells. Cell. 133, (4), 704-715 (2008).
    15. Chen, L., et al. Metastasis is regulated via microRNA-200/ZEB1 axis control of tumour cell PD-L1 expression and intratumoral immunosuppression. Nat Commun. 5, 5241 (2014).
    16. Nicolazzo, C., Gradilone, A. Significance of circulating tumor cells in soft tissue sarcoma. Anal Cell Pathol (Amst). 697395 (2015).
    17. Somarelli, J. A., et al. Mesenchymal-epithelial transition in sarcomas is controlled by the combinatorial expression of miR-200s and GRHL2. Mol Cell Biol. (2016).
    18. Bae, Y. K., Choi, J. E., Kang, S. H., Lee, S. J. Epithelial-Mesenchymal Transition Phenotype Is Associated with Clinicopathological Factors That Indicate Aggressive Biological Behavior and Poor Clinical Outcomes in Invasive Breast Cancer. J Breast Cancer. 18, (3), 256-263 (2015).
    19. Humphries, B., Yang, C. The microRNA-200 family: small molecules with novel roles in cancer development, progression and therapy. Oncotarget. 6, (9), 6472-6498 (2015).
    20. Renner, M., et al. MicroRNA profiling of primary high-grade soft tissue sarcomas. Genes Chromosomes Cancer. 51, (11), 982-996 (2012).
    21. Petrof, G., et al. Mutations in GRHL2 result in an autosomal-recessive ectodermal Dysplasia syndrome. Am J Hum Genet. 95, (3), 308-314 (2014).
    22. Werner, S., et al. Dual roles of the transcription factor grainyhead-like 2 (GRHL2) in breast cancer. J Biol Chem. 288, (32), 22993-23008 (2013).
    23. Werth, M., et al. The transcription factor grainyhead-like 2 regulates the molecular composition of the epithelial apical junctional complex. Development. 137, (22), 3835-3845 (2010).
    24. Somarelli, J. A., et al. Mesenchymal-Epithelial Transition in Sarcomas Is Controlled by the Combinatorial Expression of MicroRNA 200s and GRHL2. Mol Cell Biol. 36, (19), 2503-2513 (2016).
    25. Varma, S., et al. The transcription factors Grainyhead-like 2 and NK2-homeobox 1 form a regulatory loop that coordinates lung epithelial cell morphogenesis and differentiation. J Biol Chem. 287, (44), 37282-37295 (2012).
    26. Pruitt, S. C., Mielnicki, L. M., Stewart, C. C. Analysis of fluorescent protein expressing cells by flow cytometry. Methods Mol Biol. 263, 239-258 (2004).
    27. Zhao, Z., et al. A high-content morphological screen identifies novel microRNAs that regulate neuroblastoma cell differentiation. Oncotarget. 5, (9), 2499-2512 (2014).
    28. Borowicz, S., et al. The soft agar colony formation assay. J Vis Exp. (92), e51998 (2014).
    29. Yang, J., et al. Integrated proteomics and genomics analysis reveals a novel mesenchymal to epithelial reverting transition in leiomyosarcoma through regulation of slug. Mol Cell Proteomics. 9, (11), 2405-2413 (2010).
    30. Alba-Castellon, L., et al. Snail1 expression is required for sarcomagenesis. Neoplasia. 16, (5), 413-421 (2014).
    31. Takaishi, M., Tarutani, M., Takeda, J., Sano, S. Mesenchymal to Epithelial Transition Induced by Reprogramming Factors Attenuates the Malignancy of Cancer Cells. PLoS One. 11, (6), e0156904 (2016).

    Erratum

    Formal Correction: Erratum: Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells
    Posted by JoVE Editors on 07/03/2018. Citeable Link.

    An erratum was issued for: Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells. An author name was updated.

    One of the authors' names was corrected from:

    Shenghan Xu

    to:

    Shengnan Xu

    Induktions av mesenkymala-Epithelial övergångar i sarkomceller
    Play Video
    PDF DOI DOWNLOAD MATERIALS LIST

    Cite this Article

    Ware, K. E., Gilja, S., Xu, S., Shetler, S., Jolly, M. K., Wang, X., Bartholf Dewitt, S., Hish, A. J., Jordan, S., Eward, W., Levine, H., Armstrong, A. J., Somarelli, J. A. Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells. J. Vis. Exp. (122), e55520, doi:10.3791/55520 (2017).More

    Ware, K. E., Gilja, S., Xu, S., Shetler, S., Jolly, M. K., Wang, X., Bartholf Dewitt, S., Hish, A. J., Jordan, S., Eward, W., Levine, H., Armstrong, A. J., Somarelli, J. A. Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells. J. Vis. Exp. (122), e55520, doi:10.3791/55520 (2017).

    Less
    Copy Citation Download Citation Reprints and Permissions
    View Video

    Get cutting-edge science videos from JoVE sent straight to your inbox every month.

    Waiting X
    simple hit counter