Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

CAPRRESI: Chimera Assembly ved Plasmid Recovery og Restriction Enzyme Site Insertion

doi: 10.3791/55526 Published: June 25, 2017

Summary

Her præsenterer vi chimera-samling ved plasmidgenvinding og restriktionsenzym site insertion (CAPRRESI), en protokol baseret på indsættelsen af ​​restriktionsenzymsteder i synonym-DNA-sekvenser og funktionel plasmidgenvinding. Denne protokol er en hurtig og billig metode til fusion af proteinkodende gener.

Abstract

Her præsenterer vi chimera samling ved plasmidgenvinding og restriktionsenzym site insertion (CAPRRESI). CAPRRESI drager fordel af mange styrker af den oprindelige plasmidgenvindingsmetode og introducerer restriktionsenzymfordøjelse for at lette DNA-ligeringsreaktioner (kræves til chimera-samling). For denne protokol klonerer brugere wildtype gener i det samme plasmid (pUC18 eller pUC19). Efter det i silico- udvalg af aminosyresekvensregioner, hvor kimærerne skal samles, får brugerne alle de synonym-DNA-sekvenser, der koder for dem. Ad hoc Perl scripts giver brugerne mulighed for at bestemme alle synonym DNA sekvenser. Efter dette trin søger et andet Perl-script for restriktionsenzymsteder på alle synonym-DNA-sekvenser. Dette ved siliconanalyse udføres også under anvendelse af ampicillinresistensgenet ( ampR ) fundet på pUC18 / 19 plasmider. Brugere designer oligonukleotider indenfor synonymområder for at forstyrre vildtype- og ampR- gener ved hjælp af PCR. Efter obtAining og oprensning af komplementære DNA-fragmenter, opnås restriktionsenzymfordøjelse. Kimamasamling opnås ved at ligere passende komplementære DNA-fragmenter. PUC18 / 19 vektorer er valgt til CAPRRESI, fordi de tilbyder tekniske fordele, såsom lille størrelse (2.686 basepar), højt kopiantal, fordelagtige sekvenseringsreaktionsfunktioner og kommerciel tilgængelighed. Anvendelsen af ​​restriktionsenzymer til chimærsamling eliminerer behovet for DNA-polymeraser, der giver stumpede produkter. CAPRRESI er en hurtig og billig metode til fusion af proteinkodende gener.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Kimære gensamlinger er blevet anvendt i vid udstrækning i molekylærbiologi til at belyse proteinfunktion og / eller bioteknologiske formål. Forskellige fremgangsmåder eksisterer for fusionsgener, såsom overlappende PCR-produktamplifikation 1 , plasmidgenvinding 2 , homolog rekombination 3 , CRISPR-Cas9-systemer 4 , site-rettet rekombination 5 og Gibson-samling 6 . Hver af disse tilbyder forskellige tekniske fordele; For eksempel fleksibiliteten af ​​overlappende PCR-design, in vivo- udvælgelsen af ​​konstruktioner under plasmidgenvinding eller den høje effektivitet af CRISPR-Cas9 og Gibson-systemer. På den anden side kan der opstå nogle vanskeligheder under udførelse af nogle af disse metoder; For eksempel afhænger de to første tilgange på stumpede DNA-fragmenter, og ligering af disse typer produkter kan være teknisk udfordrende sammenlignet med stikKy-ended ligation. Site-directed rekombination kan efterlade spor af ekstra DNA-sekvenser (ar) på originalen, ligesom i CrexxP- systemet 5 . CRISPR-Cas9 kan undertiden ændre andre genomregioner ud over målstedet 4 .

Her introducerer vi chimera-samling ved hjælp af plasmidgendannelse og restriktionsenzym site insertion (CAPRRESI), en protokol til fusion af proteinkodende gener, der kombinerer plasmidåbningsmetoden (PRM) med indsættelsen af ​​restriktionsenzymsteder på synonym-DNA-sekvenser, forbedrende ligeringseffektivitet . For at sikre aminosyresekvensintegriteten indsættes restriktionsenzymsteder på synonym-DNA-sekvensstrækninger. Blandt fordelene ved CAPPRESI er, at den kan udføres med almindelige laboratoriereagenser / værktøjer ( f.eks . Enzymer, kompetente celler, opløsninger og termocykler), og at det kan give hurtige resultater (når de relevante enzymer anvendes). Stole på begrænsningEnzym sites, der kommer fra synonym DNA sekvenser kan begrænse udvælgelsen af ​​de nøjagtige fusionspunkter inden for proteiner af interesse. I sådanne tilfælde bør målgener fusioneres under anvendelse af overlappende oligonukleotider, og restriktionsenzymsteder bør indsættes på vektorens resistensgen.

CAPRRESI består af syv enkle trin ( figur 1 ): 1) udvælgelse af kloningsvektoren, pUC18 eller pUC196; 2) i silicoanalyse af vildtype-sekvenserne, der skal smeltes; 3) udvælgelse af brydningsområder for chimær samling og plasmidforstyrrelse; 4) i silico- generering af synonym-DNA-sekvenser indeholdende restriktionsenzymsteder; 5) uafhængig kloning af vildtype-generne i det valgte plasmid; 6) plasmidforstyrrelse ved PCR efterfulgt af restriktionsenzymfordøjelse; Og 7) plasmidgenvinding under anvendelse af DNA-ligering og bakteriel transformation. Kimære gener fremstillet ved denne teknik skal verificeres wEfter sekventering.

PUC18 / 19-vektorerne tilbyder tekniske fordele ved kloning og kimærsamling, såsom lille størrelse ( dvs. 2.686 basepar), højt kopiantal, fordelagtige sekvenseringsreaktionsfunktioner og kommerciel tilgængelighed 7 . Her blev en Escherichia coli vært brugt til at samle og håndtere chimærerne, fordi bakteriekulturer er billige og vokser hurtigt. På denne baggrund vil efterfølgende kloning af fusionsfragmenterne i de endelige målplasmider være nødvendige ( fx ekspressionsvektorer som pRK415 i bakterier eller pCMV i pattedyrsceller).

CAPRRESI blev testet for at fusionere to primære sigmafaktorgener: E. colirpoD og Rhizobium etlisigA . Primære sigmafaktorer er RNA-polymerasubenheder, der er ansvarlige for transkriptionsinitiering, og de består af fire domæner ( dvs. σ1, σ2, σ3 og σ4) 8 . Aminosyresekvensen længesH af proteiner kodet af rpoD og sigA er henholdsvis 613 og 685. RpoD og SigA deler 48% identitet (98% dækning). Disse primære sigmafaktorer blev opdelt i to komplementære fragmenter mellem regionerne σ2 og σ3. To kimære gener blev samlet ifølge dette design: chimera 01 (RpoDσ1-σ2 + SigAσ3-σ4) og chimær 02 (SigAσ1-σ2 + RpoDσ3-σ4). DNA-fusionsprodukter blev verificeret ved sekventering.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. CAPRRESI-protokollen

BEMÆRK: Figur 1 repræsenterer den samlede CAPRRESI-protokol. Denne teknik er baseret på en silico- design og den efterfølgende konstruktion af de ønskede kimærer.

  1. Udvælgelse af kloningsplasmidet, pUC18 eller pUC19.
    1. Vælg den pUC vektor, som bedst passer til tekniske krav.
      BEMÆRK: Begge vektorer har samme sekvens, undtagen orienteringen af ​​det multiple kloningssted. Dette er vigtigt for udformningen af ​​oligonukleotider og PCR-plasmidforstyrrelsen.
  2. I silicoanalyse af wildtype-generne og pUC18 / 19-sekvenserne.
    1. Hent DNA-sekvenserne af vildtype-generne og gem dem i en FASTA-formatfil ( f.eks. Genes.fas).
      BEMÆRK: Sekvenserne af pUC18 / 19 vektorer er indeholdt i pUC.fas-filen ( figur 1 , trin 1).
    2. Bestem hvilken begrænsning osvYmes skærer ikke wildtype gener og pUC18 / 19 sekvenser ved at køre REsearch.pl scriptet. Alternativt kan du udføre en restriktionsenzymsitesøgning med et online værktøj ( figur 1 , trin 2).
      1. Indtast følgende i en terminal:
        Perl REsearch.pl genes.fas
        Perl REsearch.pl pUC.fas
        BEMÆRK: Disse kommandoer vil oprette følgende outputfiler: genes_lin.fas, genes_re.fas, pUC_lin.fas og pUC_re.fas.
      2. Vælg de relevante restriktionsenzymer til kloning af vildtype-generne i det multiple kloningssted for den valgte pUC18 / 19-vektor ved at sammenligne genene_re.fas- og pUC.fas-filerne. Vælg orienteringen af ​​indsatsen i forhold til ampicillinresistensgenet ( ampR ) af pUC18 / 19-vektoren.
    3. Design fremad og omvendt oligonukleotider for at amplificere den kodende region af vildtype-generne (eksterne oligonukleotider). Inkluder det rette restriktionsenzymsted ved hver 5'-endeAf oligonukleotiderne; Dette vil definere indsatsorienteringen.
      1. Inkluder et funktionelt ribosombindingssted i de fremadrettede oligonukleotider.
      2. Indsæt begge wildtype-gener i samme orientering inde i vektoren.
  3. Udvælgelse af brydningsområderne for chimærsamling og plasmidforstyrrelse.
    1. Hent aminosyresekvensen af ​​vildtypen og ampR- generne ved at køre translate.pl-scriptet ( figur 1 , trin 3).
      1. Indtast følgende i en terminal:
        Perl translate.pl genes.fas
        Perl translate.pl ampR.fas

        BEMÆRK: Dette script vil oprette følgende outputfiler: genes_aa.fas og ampR_aa.fas.
    2. Globalt justere de to wildtype-aminosyresekvenser med en passende software ( f.eks. MUSCLE) 9 .
    3. Vælg de ønskede pauseområder (3-6 aminosyrer) til chimera asseMbly baseret på sekvensjusteringen. Gem dem i en fil i FASTA-format ( f.eks . Regions.fas).
    4. Find DNA-sekvenserne, der koder for den valgte aminosyre, strækker sig på begge vildtype-gener.
  4. I silico- generering af synonym-DNA-sekvenser indeholdende restriktionsenzymsteder.
    1. Få alle de synonym-DNA-sekvenser, der koder for hver aminosyresekvens, strækket udvalgt som brydningsregioner ( figur 1 , trin 4); Disse sekvenser blev gemt i region.fas-filen.
      1. Indtast følgende i en terminal:
        Perl synonym.pl regions.fas
        BEMÆRK: Dette script skaber output_filen regions_syn.fas.
    2. Søg efter restriktionsenzymsteder fundet på synonym-DNA-sekvenser.
      1. Indtast følgende i en terminal: perl REsynonym.pl regions_syn.fas
        BEMÆRK: Dette script skaber output_filen regions_syn-re.fas.
    3. Vælg et restriktionsenzym, der deles mellem synonym sekvenser af begge vildtype gener; Dette websted vil blive brugt til at samle chimærer via restriktionsenzym fordøjelse. Bekræft, at det valgte restriktionsenzym ikke skar hverken vildtype-generne eller pUC18 / 19-vektorsekvenserne.
      1. Sammenlign de restriktionsenzymer, der findes på genene_re.fas, pUC_re.fas og regions_syn-re.fas-filer.
    4. I silico erstatter originalerne for deres synonym DNA-sekvenser på de tilsvarende steder på begge vildtype-gener. Tilføj synonyme DNA-sekvenser i wildtype-sekvensfilen (genes.fas).
    5. Få aminosyresekvensen af ​​gener indeholdt i genes.fas filen ( perl translate.pl genes.fas ).
    6. Juster de aminosyresekvenser, der er translateret fra vildtype og synonym-DNA-sekvenser. Kontroller, at begge sekvenser er de samme.
    7. Gentag alle trin i dette afsnit med det ampR- gen, som findes på pU'enC18 / 19 vektor.
      BEMÆRK: Målet er at forstyrre ampR- genet (fil ampR.fas) i to komplementære dele. Restriktionsenzymet, der er valgt til at forstyrre ampR- genet, skal være forskelligt fra det, der anvendes til chimera-samling.
  5. Uafhængig kloning af de to vildtype-gener i den valgte pUC18 / 19-vektor (figur 1, trin 3).
    1. Oprens det valgte pUC18 / 19 plasmid DNA ved anvendelse af et plasmid DNA rensning kit.
      1. For eksempel transformerer E. coli DH5a med pUC18 plasmid og dyrker transformanterne natten over ved 37 ° C på fast LB-0,3 mg / ml ampicillin (Amp). Vælg en transformantkoloni, pod en ny LB-0.3 mg / mL Amp-plade og vokse natten over ved 37 ° C.
      2. Tag del af den tidligere kultur og dyrk den i flydende LB-0,3 mg / ml Amp i 6-8 timer ved 37 ° C. Ekstraher plasmid DNA ved anvendelse af et kit.
    2. PCR amplificerer vildtype-gener fra det totale genomiske DNA ved anvendelse af appropRiske eksterne oligonukleotider. Anvend en højfidelitets-DNA-polymerase, hvis det er muligt. Vælg DNA-polymerasen, der maksimerer udbyttet. Udfør PCR i henhold til producentens retningslinjer og oligonukleotidernes smeltetemperatur.
      1. Kør PCR-cyklusser, afhængigt af DNA-polymerasen, ampliconstørrelsen, skabelonen og de anvendte oligonukleotider. For eksempel for at amplificere rpoD- DNA fremstilles en 50 μl reaktion: 5 μl 10x buffer, 2 μl 50 mM MgS04, 1 μl 10 mM dNTP-blanding, 2 μl af hvert 10 μM oligonukleotid (tabel 2), 2 Μl template DNA ( E. coli DH5a total DNA), 35,8 μL ultra rent vand og 0,2 μl højfidelitets DNA polymerase. Kør følgende PCR-cyklusser: 1 minut ved 94 ° C til den oprindelige denaturering efterfulgt af 30 cyklusser med amplifikation (30 s ved 94 ° C til denaturering, 30 s ved 60 ° C for at annealere oligonukleotiderne og 2 min ved 68 ° C At udvide).
      2. Opløs 1,2 gAgarose i 100 ml dobbeltdestilleret vand ved at opvarme dem i mikrobølgeovnen. Saml en gelbakke og kam og læg dem i vandret gelaster. Fyld gelbakken med den smeltede agaroseopløsning og lad den størkne. Fjern kammen.
      3. Placer gelen i elektroforesekammeret. Fyld kammer med 1x Tris-acetat-EDTA buffer. Indsæt 50 μl PCR-produkter i gelbrøndene. Elektroforese prøverne ( f.eks . Ved 110 V i 1 time).
      4. Efter elektroforese pletteres gelen i 100 ml dobbeltdestilleret vand indeholdende 100 μl 1 mg / ml ethidiumbromidopløsning i 10 minutter med langsom rystning. Vask gelen i dobbeltdestilleret vand i yderligere 10 minutter ved langsom rystning; Brug en vandret ryster.
        Forsigtig: Ethidiumbromid er en giftig forbindelse; Brug beskyttelseshandsker og et bomuldslaboratoriumjakke.
      5. Rens vildtype-gen-DNA fra de tilsvarende bånd af gelen under anvendelse af et kit. Visualiser båndene ved at placere den farvede gel i et UV-kammer (Anbefalet bølgelængde: 300 nm). Hold gens eksponering til et minimum. Brug et DNA rensningssæt og følg producentens anvisninger.
        Forsigtig: UV-stråling er farlig; Brug et beskyttende skjold, briller og et bomuldslaboratoriumjakke.
    3. Fordøjes rensede vildtypegener og pUC18 / 19 plasmid-DNA med restriktionsenzymerne i overensstemmelse med producentens instruktioner. Brug hurtig fordøjelsesenzymer, når det er muligt. For eksempel fordøjes 6 μl pUC18 DNA (300 ng / μl) i 10 μl ultrapure vand, 2 μl 10X buffer, 1 μl Kpn I restriktionsenzym og 1 μl Xba I restriktionsenzym. Lad reaktionen stå ved 37 ° C i 30 minutter.
      1. Inaktivere restriktionsenzymerne i overensstemmelse med producentens retningslinjer. For eksempel inaktivere dobbeltfordøjelsesreaktionen Kpn I- Xba I ved 80 ° C i 5 minutter.
    4. Mix indsæt: vektor DNA ved en volumetrisk ratiO af 3: 1. Følg producentens anvisninger for en ligeringsreaktion. Brug hurtig ligeringsenzymer, når det er muligt (lad reaktionen stå ved 25 ° C i 10 minutter).
      BEMÆRK: DNA-koncentrationen efter rensning under anvendelse af kittene er typisk god til fordøjelses- og ligeringsreaktioner. F.eks. Tilsæt 6 μL rpoD DNA ( Kpn I- Xba I, 150 ng / μl), 3 μl pUC18 DNA ( Kpn I- Xba I, 150 ng / μl), 10 μl 2x buffer, 1 μl ultrapure Vand og 1 μl T4 DNA ligase. Forlad ligeringsreaktion ved 25 ° C i 10 minutter.
    5. Transformér E. coli DH5a med 2-4 μl af ligeringsreaktionen som beskrevet i de Supplerende Materialer. Plad de transformerede celler til faste LB / Amp / X-gal / IPTG plader. Lad pladerne natten over ved 37 ° C.
    6. Vælg hvidfarvede transformant E. coli kolonier og strejf dem på en ny LB / Amp plade. Lad pladerne natten over være ved 37 ° C. </ Li>
    7. Udfør en koloni-PCR for at vælge kandidater til sekventering af reaktionen som beskrevet i de Supplerende Materialer. Ekstraher plasmid DNA fra kandidater. Alternativt fordøjes kandidatplasmid-DNA med de samme restriktionsenzymer, der anvendes til kloning af indsatserne.
    8. Sekvenskandidatkonstruktioner med en sekventeringsudbyder 10 . Saml sekvensen i silico ved hjælp af en DNA-samler 11 ( figur 1 , trin 5).
  6. Plasmidforstyrrelse ved PCR efterfulgt af restriktionsenzymfordøjelse.
    1. Design i silico fremad og omvendt oligonukleotider i pauseområder for henholdsvis vildtype og ampR- gener. Substitue i silico vildtype-fragmentet for dets tilsvarende synonym-DNA-sekvens (opnået i trin 1.4).
      BEMÆRK: Denne synonym-DNA-sekvens indeholder et restriktionsenzymsted. Fremad og omvendt oligonukleotider overlapper ved tHan restriktionsenzymsted. Oligonukleotider bør ligge fra 21-27 nukleotider, slutter med en cytosin eller guanin og indeholder et restriktionsenzymsted. Et fremad oligonukleotid har samme sekvens som dets målområde på template DNA. Et omvendt oligonukleotid er den omvendte komplementære sekvens af målområdet på template DNA.
    2. Brug de to vildtype-genkonstruktioner som DNA-skabelonen til PCR-reaktioner ( fx pUC18 rpoD og pUC18 sigA ). Find to komplementære dele af hver konstruktion (pUC18 rpoD σ1-σ2, pUC18 rpoD σ3-σ4, pUC18 sigA σ1-σ2 og pUC18 sigA σ3-σ4) ( Figur 1 , trin 6).
    3. Indlæs DNA-prøver i en agarosegel 1-1,2% [w / v]. Separat PCR-produkterne fra DNA-skabelonen ved elektroforese ( f.eks. 110 V i 1 time). Alternativt fordøjes PCR-reaktionerne med Dpn I for at bryde DNA-skabelonen.
      BEMÆRK: DpnJeg enzym genkender kun methylerede DNA-sekvenser (5'-GATC-3 ').
      1. Rens prøverne ved hjælp af et DNA rensningssæt. Følg producentens retningslinjer.
    4. Dobbeltfordel alle de komplementære DNA-fragmenter med de passende restriktionsenzymer i overensstemmelse med producentens anvisninger. Brug hurtigt fordøjelsesbegrænsende enzymer, når det er muligt. For eksempel dobbelt fordøjes pUC18rpoDσ1-σ2 DNA fragmentet med Afl II og Spe I ved hjælp af producentens protokol. Lad fordøjelsesreaktionen ved 37 ° C i 15 minutter.
    5. Inaktivere restriktionsenzymerne i overensstemmelse med producentens retningslinjer. For eksempel inaktivere Afl II- Spe I ved 80 ° C i 20 minutter.
  7. Plasmidgenvinding ved anvendelse af DNA-ligering og bakteriel transformation.
    1. Bland de korrekte DNA-fragmenter i et volumetrisk forhold på 1: 1 for at samle det ønskede kimære gen ( figur1, trin 7).
      BEMÆRK: På denne måde genoprettes integriteten af ampR- genet, hvilket producerer et funktionelt protein.
      1. Bland f.eks. 4 μl pUC18 rpoD σ1-σ2 DNA (fordøjet med Afl II- Spe I, 150 ng / μl), 4 μl pUC18 sigA σ3-σ4 DNA ( Afl II- Spe I, 150 ng / μl) 10 μl 2x buffer, 2 μl ultrapure vand og 1 μl T4 DNA ligase; DNA-koncentrationen efter kittens oprensning er god nok til fordøjelse og efterfølgende ligering. Lad ligeringsreaktionen ved 25 ° C i 10 minutter.
    2. Transformér E. coli DH5a med 3-5 μl af kimærsamlingsligationsreaktionen (supplerende materialer). Væk transformantcellerne i LB / Amp / X-gal / IPTG-plader natten over ved 37 ° C natten over.
    3. Vælg hvidfarvede transformant E. coli kolonier og strejf dem på en ny LB / Amp plade. Lad pladerne overnatte på 37° C.
    4. Udfør en koloni-PCR for at vælge kandidater til en sekventeringsreaktion som beskrevet i de supplerende materialer. Visualiser bånd i en 1-1,2% (w / v) agarosegel ved at udføre elektroforese (beskrevet i trin 2.3.2.1).
    5. Voks kulturer fra positive kandidater. Ekstraher plasmid DNA fra dem ved anvendelse af et plasmid DNA rensning kit.

2. Sekvenskandidat-kimære konstruktioner

  1. Sørg for, at kvaliteten af ​​plasmid-DNA'et er god nok til sekventeringsreaktionen ved at følge retningslinjer fra sekvensudbyderen. Ekstraher DNA ved anvendelse af rensningssæt. F.eks. Skal der på internettsiden for sekvensudbyderen være særlig opmærksom på den anbefalede DNA-koncentration for prøverne. Hent koncentrationen af ​​prøver ved hjælp af et DNA-kvantificeringsinstrument.
  2. Sekvenskandidat-kimære konstruktioner med en sekventeringsudbyder 10 .
  3. Samle se Quencing læser med en i silico DNA assembler 11 .
  4. Juster monteret versus i silico- designede kimære sekvenser ved brug af sekvensjusteringsværktøjer 9 , 12 . Bekræft, at det kimære gen blev smeltet sammen med succes.

3. Forberedelser

BEMÆRK: Alle trin, der involverer levende celler, skal udføres i en ren laminær flowhætte med Bunsen-brænderen på.

  1. Fremstilling af E. coli DH5a-kompetente celler.
    1. For at producere E. coli- kompetente celler skal du følge offentliggjorte protokoller 13 eller se supplerende materialer . Alternativt kan du bruge kommercielt tilgængelige kompetente celler.
  2. Transformering af E. coli DH5a-kompetente celler.
    1. Til den kemiske transformation af E. coli kulturer, følg offentliggjorte protokollerClass = "xref"> 13 eller se supplerende materialer . Alternativt kan du bruge elektroporation til bakteriel transformation. Hvis der anvendes kommercielt tilgængelige kompetente celler, skal du følge producentens retningslinjer.
  3. Oprensning af genomisk og plasmid-DNA fra E. coli DH5a.
    1. Udfør nukleinsyreekstraktion som angivet i de supplerende materialer ved anvendelse af kommercielt tilgængelige kits eller efterfølgende offentliggjorte protokoller 13 .
  4. Udfør koloni-PCR.
    1. Brug denne teknik til at identificere kandidattransformantkolonier til efterfølgende sekventeringsreaktion.
      BEMÆRK: Denne metode repræsenterer ikke en endelig verifikation af sekvensernes integritet. En detaljeret beskrivelse af denne teknik er tilgængelig i Supplerende Materialer .
  5. Forberedelse af løsningerne.
    1. Se
  6. Download de scripts og sekvensfiler, der kræves til CAPRRESI-protokollen.
    1. Download genbankfiler indeholdende den komplette genomsekvens af den ønskede art, ekstraher DNA-sekvensen af ​​det valgte gen ved hjælp af en genom browser, og gem det i fasta filformat. Download de Perl-scripts, der kræves til CAPRRESI-protokollen. Opbevar scripts og sekvensfiler i samme mappe.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Figur 1 viser CAPRRESI. Ved anvendelse af denne metode blev to kimære gener samlet ved at udveksle domænerne af to bakterielle primære sigmafaktorer ( dvs. E. coli RpoD og R. etli SigA). DNA-sekvenserne af rpoD- og sigA- gener blev opnået ved anvendelse af Artemis Genome Browser 14 fra henholdsvis GenBank-genomfiler NC_000913 og NC_007761. DNA-sekvensen af ​​pUC18-vektoren blev opnået fra nukleotiddatabasen for NCBI-serveren. I silico- analyser af restriktionsenzymsteder blev der udført på DNA-sekvenser ved at køre Perl-scriptet REsearch.pl (se trin 1.2.2). Disse resultater blev anvendt til oligonukleotiddesign (trin 1.2.3). Eksterne oligonukleotider indbefattede genkendelsessteder for Xba I og Kpn I restriktionsenzymer for at klone vildtypegener i pUC18-multipelkloningsstedet. Det fremadrettede oligonukleotid indbefattede også en riboNoget bindingssted ( tabel 2 ). Genomisk DNA blev ekstraheret fra E. coli DH5a celler dyrket i LB / Nal bouillon (37 ° C, 220-250 rpm) og R. etli CFN42 celler dyrket i PY / Nal / CaCl2 bouillon (30 ° C, 220-250 omdr./min. ). Disse prøver blev anvendt som DNA-skabeloner til vildtype-genamplifikation (trin 1.5.2).

Wildtype-gener blev amplificeret under anvendelse af en Taq -højfidelitets-DNA-polymerase, som blev oprenset fra agarosegeler (DNA-oprensningssæt), dobbeltfordøjet med Kpn I- Xba I-restriktionsenzymer og klonet ind i pUC18-vektoren. Kemisk kompetente E. coli DH5a-celler blev transformeret med 5 μl af ligeringsreaktionen svarende til vildtypekonstruktioner pUC18 rpoD og pUC18 sigA (trin 1.5.5). Transformante celler blev valgt på faste LB / Amp / X-gal / IPTG plader dyrket ved 37 ° C. Wildtype-konstruktioner blev verificeret af Sanger-sekvensIng 10 . Sanger sekvens læser var i silico samlet ved hjælp af MIRA 11 (trin 1.5.8).

Aminosyresekvenser fra vildtype-gener blev opnået ved at køre translate.pl-scriptet (trin 1.3.1). Efter tilpasning af vildtype-gener med Clustal 12 blev aminosyreregionerne TLV og NLR udvalgt på henholdsvis ampicillinresistensgenet ( ampR ) og vildtype-primære sigmafaktorer (trin 1.3.3). Disse aminosyreregioner blev anvendt til beregning af alle de mulige DNA-synonymsekvenser, der koder for dem ved at køre synonym.pl scriptet (trin 1.4.1). REsynonym.pl-scriptet søgte efter restriktionsenzymsteder fundet på de tidligere genererede synonym-DNA-sekvenser (trin 1.4.2). Disse synonymområder, der introducerede det laveste antal ændringer i forhold til vildtypesekvenserne, blev valgt. For de primære sigmafaktorgener er wildtype-sekvenser af RpOD (AACTTACGT) og SigA (AACCTTCGC) blev udvekslet for AA CTTAAG G. Sidstnævnte indeholdt et Afl II-site (fed). For ampR- genet blev vildtypesekvensen ACGCTGGTG udvekslet for sit synonym, AC ACTAGT G. Den synonym-DNA-sekvens indsat i ampR- genet indeholdt et SpeI- site (fed). Silikon- substitutionen af ​​vildtypen for de tilsvarende synonymsekvenser blev udført for at verificere sekvensintegriteten og oligonukleotiddesignen (trin 1.2-1.4).

Synonym sekvensændringer blev indført ved PCR under anvendelse af de egnede oligonukleotider ( tabel 2 ) og vildtypekonstruktioner som DNA-skabeloner (trin 1.5.2). Amplificeringsreaktioner frembragte fire komplementære dele: pUC18 rpoD σ1-σ2, pUC18 rpoD σ3-σ4, pUC18 sigA σ1-σ2 og pUC18 sigA σ3-σ4. De komplementære dele disBrækkede ikke kun sigmafaktorer, men også ampR- generne. Komplementære dele blev oprenset under anvendelse af et DNA-oprensningssæt (trin 1.6.3).

Disse komplementære DNA-fragmenter blev dobbeltfordøjet med Afl II- og Spel- restriktionsenzymer (trin 1.6.4). Ifølge CAPRRESI-design blev DNA-fragmenter pUC18 rpoD σ1-σ2 ligeret med pUC18 sigA σ3-σ4 for at opnå chimera 01, og pUC18 sigA σ1-σ2 blev ligeret med pUC18 rpoD σ3-σ4 for at samle chimera 02 (trin 1.7.1-1.7 .3). Kemisk kompetente E. coli DH5a-celler blev transformeret med 5 μl af ligeringsreaktionen af ​​pUC18 chim01 og pUC18 chim02 (trin 1.7.4). Transformante celler blev valgt på faste LB / Amp / X-gal / IPTG-plader dyrket ved 37 ° C (trin 1.7.5). Kimære konstruktioner blev verificeret ved Sanger-sekventering 10 (trin 2). Sanger sekvens rEads blev samlet ved hjælp af MIRA 11 , og dets resulterende filer er angivet i tabel 3 . Figur 2 viser justeringer (udført ved anvendelse af MUSCLE) 9 af samlede sekvenser af vildtype og kimære gener ved brudområder.

figur 1
Figur 1: CAPRRESI oversigt. Repræsentationer: gener (tykke pile), funktionelle plasmider (lukkede cirkler) og oligonukleotider (tynde, sortpipede pile). Restriktionsenzymsteder indsat i oligonukleotider fremgår af farver. Forkortelser: Wt (vildtype), FWD (fremad oligonukleotid), REV (omvendt oligonukleotid), ampR (ampicillinresistensgen), RES (restriktionsenzymsted), RE (restriktionsenzym). Klik her for at se en større versPå denne figur.

Figur 2
Figur 2: Justering af samlede vildtype og kimære gensekvenser. Samlede DNA-sekvenser blev justeret under anvendelse af MUSCLE 9 . Sekvenser blev samlet med MIRA 11 . Synonym sekvenser vises i sort. Afl II anerkendelsesstedet fremhæves. IUPAC-nukleotidkode: R (A eller G) og K (G eller T). Konstruktioner: rpoD (rød), sigA (blå), chimera 01 sekvens ( rpoD σ1-σ2- sigA σ3-σ4) og chimera 02 sekvens ( sigA σ1-σ2- rpoD σ3-σ4). Klik her for at se en større version af denne figur.

Løsning komponenter Instruktioner
Antal Forbindelse
Luria-Bertani (LB) bouillon 5 g gærekstrakt Opløs alle komponenter i vand. Autoklave. Opbevares ved stuetemperatur indtil brug. Til fast LB bouillon tilsættes 15 g bakteriologisk agar til opskriften.
10 g Caseinpepton
10 g NaCl
Op til 1 liter Dobbeltdestilleret vand
LB / Amp / X-gal / IPTG plader 100 ml Smeltet fast LB bouillon Tilføj alle komponenter til tempereret LB bouillon. Fyld Petriskål og vent, indtil de størkner. Udfør trin i en ren laminær flowhætte med Bunsen-brænderen på.
100 μl Ampicillin (Amp) [100 mg / ml]
100 μl X-gal [20 mg / ml]
50 μl 1 M IPTG opløsning
Peptongær (PY) bouillon 3 g gærekstrakt Opløs alle komponenter i vand. Autoklave. Opbevares ved stuetemperatur indtil brug. Til fast PY bouillon tilsættes 15 g bakteriologisk agar til opskriften. Til R. etli-kultur tilsættes 700 μl 1 M CaCl2-opløsning før brug.
5 g Caseinpepton
Op til 1 liter Dobbeltdestilleret vand
PY / CaCl2 / Nal plader 100 ml Smeltet fast PY bouillon Tilsæt alle komponenter til tempereret PY bouillon. Fyld Petriskålene og vent, indtil de størkner. Udfør trin i en ren laminær flowhætte med Bunsen-brænderen på.
700 μl 1 M CaCl2 opløsning
100 μl Nalidixinsyre (Nal) [20 mg / ml]
1 M calciumchlorid (CaCl2) opløsning 11,1 g CaCl2 Opløs CaCl2 i vand. Autoklave. Opbevares ved stuetemperatur.
Op til 100 ml Dobbeltdestilleret vand
Tris-EDTA (TE) 10: 1 pH 8,0 1 ml 1 M Tris opløsning Bland alle komponenter. Autoklave. Opbevares ved stuetemperatur.
400 μl 0,25 M EDTA-opløsning
Op til 100 ml Dobbeltdestilleret vand
TE 50:20 pH 8,0 5 ml 1 M Tris opløsning Bland alle komponenter. Autoklave. Opbevares ved stuetemperatur. </ Td>
8 ml 0,25 M EDTA-opløsning
Op til 100 ml Dobbeltdestilleret vand
TE 10: 1 10 mM NaCl-opløsning 58,4 mg NaCl Opløs NaCl i TE 10: 1. Autoklave. Opbevares ved stuetemperatur.
Op til 100 ml TE 10: 1 pH 8,0 opløsning
Lysisopløsning I 80 mg lysozym Opløs og bland alle komponenter i vand. Filtrer steriliseres ved anvendelse af et 0,22 μm filter. Opbevares ved stuetemperatur.
2 ml 0,5 M glucoseopløsning
400 μl 0,5 M EDTA-opløsning
500 μl 1 M Tris opløsning
Op til 20 ml Steriliseret dobbeltdestilleret vand
Lysisopløsning II 1,2 ml 5 M natriumhydroxid (NaOH) opløsning Opløs alle komponenter i vand. Filtrer steriliseres ved anvendelse af et 0,22 μm filter. Opbevares ved stuetemperatur.
3 ml 10% natriumdodecylsulfatopløsning (SDS)
Op til 30 ml Steriliseret dobbeltdestilleret vand
Lysisopløsning III 29,4 g Kaliumacetat (CH3 COOK) Opløs og bland alle komponenter i vand. Filtrer steriliseres ved anvendelse af et 0,22 μm filter. Opbevares ved stuetemperatur.
11,5 ml Absolut eddikesyre (CH3COOH)
Op til 100 ml Steriliseret dobbeltdestilleret vand
1 M magnesiumchlorid (MgCl2) opløsning 9,5 g MgCl2 Opløs MgCl2 i water. Autoklave. Opbevares ved stuetemperatur.
Op til 100 ml Dobbeltdestilleret vand
3 M natriumacetat (CH3 COONa) opløsning 24,6 g CH3 COONa Opløs CH3 COONa i vand. Autoklave. Opbevares ved stuetemperatur
Op til 100 ml Dobbeltdestilleret vand
10% SDS-opløsning 10 g SDS Opløs SDS i vand med en magnetisk omrøringsstang ved lav hastighed. Autoklave. Opbevares ved stuetemperatur.
Op til 100 ml Dobbeltdestilleret vand
3 M CH3 COOK opløsning 29,4 g CH 3 COOK Opløs CH3 COOK i vand. Filtrer steriliseres ved anvendelse af et 0,22 μm filter. Opbevares ved stuetemperatur. Op til 100 ml Steriliseret dobbeltdestilleret vand
Proteinase K-opløsning 5 mg Proteinase K Opløs proteinase K i TE 50:20 opløsning. Varm ved 37 ºC i 1 time. Opbevares ved -20 ºC.
Op til 1 ml TE 50:20 pH 8,0 opløsning
RNase-opløsning 10 mg RNase Opløs RNase i vand. Varm ved 95 ºC i 10 min. Opbevares ved -20 ºC.
Op til 1 ml Steriliseret ultrapure vand
1 M isopropyl-β-D-thiogalactosid (IPTG) opløsning 238,3 mg IPTG Opløs IPTG i vand. Filtrer steriliseres ved anvendelse af et 0,22 μm filter. Opbevares ved -20 ºC.
Op til 1 ml Steriliseret ultrapure vand
20 mg X-gal Opløs X-gal i vand. Filtrer steriliseres ved anvendelse af et 0,22 μm filter. Opbevares ved -20 ºC.
Op til 1 ml Steriliseret ultrapure vand
Phenol: chloroform: isoamylalkohol 24: 24: 1 opløsning 24 ml phenol Bland alle komponenter. Opbevares i en gulbrændt flaske ved 4 ºC. ADVARSEL! Farligt materiale. Brug beskyttelsesbriller, handsker og bomuldslaboratorisk kjole. Brug en udsugningshætte. Tænd ikke Bunsen-brænderen eller nogen anden brændeovn under håndtering. Alternativ: Brug kommercielt phenol: chloroform: isoamylalkohol 25: 24: 1 opløsning
24 ml chloroform
1 ml Isoamylalkohol
0,5 M glucoseopløsning 9 g glucose Opløs glukose i vand. Filtrer steriliseres ved anvendelse af et 0,22 μm filter. Opbevares ved stuetemperatur.
Op til 100 ml Steriliseret ultrapure vand
0,5 M ethylendiamintetraeddikesyre (EDTA) pH 8,0 opløsning 14,6 g EDTA Opløs EDTA i vand. Juster pH med 5 M NaOH opløsning. Autoklave. Opbevares ved stuetemperatur.
Op til 100 ml Dobbeltdestilleret vand
0,25 M EDTA pH 8,0 opløsning 7,3 g EDTA Opløs EDTA i vand. Juster pH med 5 M NaOH opløsning. Autoklave. Opbevares ved stuetemperatur.
Op til 100 ml Dobbeltdestilleret vand
1 M Tris pH 8,0 opløsning 12,1 g tris Opløs Tris i vand. Juster pH medAbsolut saltsyre (HCI). Autoklave. Opbevares ved stuetemperatur.
Op til 100 ml Dobbeltdestilleret vand
5 M natriumhydroxid (NaOH) opløsning 19,9 g NaOH Opløs NaOH i vand. Opbevares ved stuetemperatur. ADVARSEL! Caustisk forbindelse.
Op til 100 ml Steriliseret dobbeltdestilleret vand
0,1 M NaOH opløsning 399 mg NaOH Opløs NaOH i vand. Opbevares ved stuetemperatur.
Op til 100 ml Steriliseret dobbeltdestilleret vand
Nalidixinsyre (Nal) stamopløsning 60 mg Nalidixinsyre Opløs Nal i vand. Filtrer steriliseres ved anvendelse af et 0,22 μm filter. Opbevares ved 4 ºC.
Op til 3 ml 0,1 MNAOH-opløsning
Ampicillin (Amp) stamopløsning 300 mg ampicillin Opløs Amp i vand. Filtrer steriliseres ved anvendelse af et 0,22 μm filter. Opbevares ved 4 ºC.
Op til 3 ml Steriliseret dobbeltdestilleret vand
10x tris-acetat-EDTA buffer 48,4 g tris Opløs alle komponenter i vand. Autoklave. Opbevares ved stuetemperatur.
20 ml 0,5 M EDTA-opløsning
11,44 ml Iseddikesyre
Op til 1 liter Dobbeltdestilleret vand

Tabel 1: Løsningspræparation. Instruktioner til løsning af opløsning.

Ingen. Kode sekvens Længde (nt) Funktioner
1 RpoD-FWD GC TCTAGA GA AGGAGA TATCATATGGAGCAAAACCCGCAGTCA 43 Xbal site; Vildtype-genamplifikation og vektorkloning
2 ROD-REV GG GGTACC TTAATCGTCCAGGAAGCTACG 29 Kpnl- site; Vildtype-genamplifikation og vektorkloning
3 SigA-FWD GC TCTAGA GA AGGAGA TATCATATGGCAACCAAGGTCAAAGAG 43 Xbal site; Vildtype-genamplifikation og vektorkloning
4 SigA-REV GG GGTACC TTAGCTGTCCAGAAAGCTTCT </ Td> 29 Kpnl- site; Vildtype-genamplifikation og vektorkloning
3 AmpR-FWD AC ACTAGT GAAAGTAAAAGAT 21 SpeI site indsat, synonym mutation. Forstyrrelse af ampR- genet
4 AmpR-REV TC ACTAGT GTTTCTGGGTGAG 21 SpeI site indsat, synonym mutation. Forstyrrelse af ampR- genet
5 σ2RpoD-FWD AA CTTAAG GCTGGTTATTTCTATCGCT 27 AflII site indsat, synonym mutation. Konstruktion af chim01-02
6 σ2RpoD-REV GC CTTAAG TTCGCTTCAACCATCTCTT 27 AflII site indsat, synonym mutation. Konstruktion af chim01-02
7 σ2SigA-FWD AA CTTAAG GCTCGTCATTTCAATCGCC 27 AflII site indsat, synonym mutation. Konstruktion af chim01-02
8 σ2SigA-REV GC CTTAAG TTCGCTTCGACCATTTCCT 27 AflII site indsat, synonym mutation. Konstruktion af chim01-02

Tabel 2: Oligonukleotidsekvenser. Restriktionsenzymsteder fremhæves. Ribosom bindingssted: fed.

Konstruktion Sekvensfil Kvalitetsfil
chimera01 chim01_out.unpadded.fasta chim01_out.unpadded.fasta.qual
chim01_A3 / B3 / E2 / F2 / G2 /H2.pdf
chimera02 chim02_out.unpadded.fasta chim02_out.unpadded.fasta.qual
chim02_C3 / D3 / E3 / F3 / G3 / H3.pdf
rpoD rpod_out.unpadded.fasta rpod_out.unpadded.fasta.qual
sigA siga_out.unpadded.fasta siga_out.unpadded.fasta.qual

Tabel 3: Sekvensfiler opnået med MIRA assembler og DNA sequencer. Sanger-sekventering læser fra kimære og wildtype-konstruktioner blev samlet med MIRA 11- software ved hjælp af kortlægningsindstillingen. Kromatogrammer af kimær sekventering vises som PDF-filer.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

CAPRRESI blev designet som et alternativ til PRM 2 . Den oprindelige PRM er en kraftfuld teknik; Det tillader fusion af DNA-sekvenser langs enhver del af de valgte gener. For PRM bør vildtype-gener klones ind i det samme plasmid. Herefter udformes oligonukleotider inde i vildtype og antibiotikaresistensgener fundet på plasmidet. Plasmidforstyrrelse opnås ved PCR under anvendelse af stump-endede højfidelitets-DNA-polymeraser og tidligere udformede oligonukleotider. Ligeringen af ​​komplementære PCR-produkter samler kimære gener og genopretter antibiotikaresistenskassetten, hvilket resulterer i funktionel plasmidgenvinding. PRM muliggør konstruktionen af ​​kimære genbiblioteker på den samme plasmidbakgrund. Uheldigvis kunne ligeringen af ​​stumpede DNA-sekvenser være teknisk vanskelig. Chimera-samling ved overlappende PCR-fragmenter 1 kræver også, at DNA-polymeraser giver stumpede produkter ogDNA-oprensning for hver reaktion. De kimære gener, der er samlet ved denne teknik, er lineære DNA-produkter. Kloning af hver konstruktion i målvektoren kunne forsinke yderligere analyse.

CAPRRESI nyder godt af mange af styrken af ​​PRM og forenkler også ligeringen af ​​komplementære DNA-fragmenter ved anvendelse af restriktionsenzymsteder på synonym-DNA-sekvensområder. Af disse grunde kræver CAPRRESI ikke stump-endede DNA-polymeraser. Anvendelsen af ​​synonym-DNA-sekvenser begrænser fusionssteder til chimærsamling, men forbedrer ligeringseffektiviteten. En anden vigtig ændring indført i CAPRRESI er, at kimærerne samles og håndteres i pUC18 / 19 vektorer. Disse vektorer har flere fordelagtige træk, som tidligere angivet. Kimært DNA kunne opnås ved udbredelse af konstruktionsvektoren i E. coli værter. Efterfølgende kloning af kimære gener i det endelige plasmid ( f.eks . En ekspressionsvektor) er nogle gangepåkrævet.

CAPRRESI er også afhængig af silikabehandlingen af ​​DNA- og aminosyresekvenser. Ad hoc Perl scripts muliggør udvælgelsen af ​​de passende restriktionsenzymer til klon vildtype-gener, beregningen af ​​alle synonym-DNA-sekvenser svarende til pauseområder (til chimærsamling) og identifikation af restriktionsenzymer til forenkling af plasmidgenvinding. Under disse betingelser er CAPRRESI et alternativ til fusion af proteinkodende gener. Kritiske trin i CAPRRESI-protokollen er: 1) udvælgelsen af ​​brudområder og 2) oprensningen af ​​PCR-produkter. Brydningsregioner er strækninger, hvor synonyme sekvenser beregnes, producerende restriktionsenzymsteder, der ikke findes på vildtypesekvenser. Anvendelsen af ​​restriktionsenzymsteder til kimærsammenstilling eliminerer behovet for DNA-polymeraser, der giver stumpede produkter og letter ligeringsreaktionen. Ikke alle regioner vil have brugbare restriktionsenzymsteder; foAf denne årsag anbefales det at flytte brydningsområder med en aminosyre ad gangen, indtil den bedste sekvensstrækning er fundet. Hvis det i silico- design ikke tillader bevægelse af brydningsområderne eller sekvensstrækningerne mangler synonym-DNA-sekvenser med egnede restriktionsenzymsteder, anbefales det at smelte målgener ved anvendelse af overlappende oligonukleotider og at indføre synonym-DNA-sekvenser i ampicillinresistensgenet (Findes kun på vektoren). På denne måde kan generne fusioneres på nogen måde, og plasmidgenvindingen afhænger af ligeringen af ​​et unikt sted (fordøjet med kun et restriktionsenzym). Fleksibiliteten af ​​CAPPRESI gør det muligt at udføre det i kombination med andre teknikker.

Oprensningen af ​​PCR-produkter udføres for at eliminere template-DNA, hvilket reducerer chancerne for forældreplasmidforurening efter ligering af komplementære DNA-fragmenter. Opfyldelse af disse to kritiske trin forbedrer bacTerial transformationseffektivitet (antallet af korrekt monterede konstruktioner), hvilket tillader CAPRRESI at udføres med enten kemisk kompetent (CaCl2) eller elektrokompetente E. coli- celler. Den første type kompetente celler repræsenterer den billigste kilde til E. coli- kulturer, der anvendes til bakteriel transformation i de fleste laboratorier. På grund af alle de tidligere viste funktioner repræsenterer CAPRRESI en nyttig mulighed for montering af kimærer.

Endvidere kunne CAPRRESI arbejde i kombination med overlappende PCR-fragmenter eller plasmidgendannelsesteknikker. I stedet for at indsætte to synonymsekvenser pr. Komplementær DNA-del kan for eksempel det ønskede brydningsområde (på mål-vildtype-generne) anvende overlappende oligonukleotider til at smelte intervenerende sekvenser. Indførelsen af synonymsekvenser kunne begrænses til ampR genet af pUC18 / 19 vektorer, hvilket fører til brugen af ​​kun ét restriktionsenzym til genoprettelse af plasmiD integritet. Disse fremtidige applikationer kunne styrke CAPRRESI ved at tillade sammensmeltning af enhver form for DNA-sekvenser ( dvs. ikke kun proteinkodende gener) uden at gå på kompromis med ligeringseffektiviteten.

For at teste CAPRRESI blev to kimære sigmafaktorer samlet ved at udveksle regioner af to vildtype primære sigmafaktorgener: rpoD ( E. coli ) og sigA ( R. etli ). Alle kendte primære sigmafaktorer har fire domæner, σ1 til σ4 8 . Chimera 01 består af RpoDσ1-σ2 og SigAσ3-σ4, mens chimera 02 har SigAσ1-σ2 og RpoDσ3-σ4. Integriteten af ​​de kimære konstruktioner blev verificeret ved Sanger-sekventering 10 ( figur 2 ).

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne erklærer, at de ikke har nogen konkurrerende finansielle interesser.

Acknowledgments

Dette arbejde blev støttet af Consejo Nacional de Ciencia og Tecnología, CONACYT, México (tilskud nr. 154833) og Universidad Nacional Autónoma de México. Forfatterne ønsker at takke Víctor González, Rosa I. Santamaría, Patricia Bustos og Soledad Juárez for deres administrative og tekniske rådgivning.

Materials

Name Company Catalog Number Comments
Platinum Taq DNA polymerase High Fidelity Thermo Fisher 11304011 Produces a mix of blunt/3’-A overhang ended PCR products
High pure plasmid isolation kit Roche 11754785001 Used for all plasmid purification reactions
High pure PCR product purification kit Roche 11732676001 Used for all PCR purification reactions from agarose gels
AflII restriction enzyme New England Biolabs R0520L Recognizes sequence 5’-CTTAAG-3’ and cuts at 37 °C
KpnI-HF restriction enzyme New England Biolabs R3142L Recognizes sequence 5’-GGTACC-3’ and cuts at 37 °C
SpeI-HF restriction enzyme New England Biolabs R3133L Recognizes sequence 5’-ACTAGT-3’ and cuts at 37 °C
XbaI restriction enzyme New England Biolabs R0145L Recognizes sequence 5’-TCTAGA-3’ and cuts at 37 °C
Ampicillin sodium salt Sigma Aldrich A0166-5G Antibiotics
Nalidixic acid Sigma Aldrich N8878-5G Antibiotics
Yeast Extract Sigma Aldrich Y1625-1KG Bacterial cell culture
Casein peptone Sigma Aldrich 70171-500G Bacterial cell culture
NaCl Sigma Aldrich S9888-1KG Sodium chloride
Agar Sigma Aldrich 05040-1KG Bacterial cell culture
XbaI restriction enzyme Thermo Fisher FD0684 Fast digest XbaI enzyme
KpnI restriction enzyme Thermo Fisher FD0524 Fast digest KpnI enzyme
Quick Ligation Kit New England Biolabs M2200S Fast DNA ligation kit
AflII restriction enzyme Thermo Fisher FD0834 Fast digest AflII enzyme
SpeI restriction enzyme Thermo Fisher FD1253 Fast digest SpeI enzyme

DOWNLOAD MATERIALS LIST

References

  1. Horton, R. M., Hunt, H. D., Ho, S. N., Pullen, J. K., Pease, L. R. Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene. 77, (1), 61-68 (1989).
  2. Vos, M. J., Kampinga, H. H. A PCR amplification strategy for unrestricted generation of chimeric genes. Anal. Biochem. 380, (2), 338-340 (2008).
  3. Hawkins, N. C., Garriga, G., Beh, C. T. Creating Precise GFP Fusions in Plasmids Using Yeast Homologous Recombination. Biotechniques. 34, (1), 1-5 (2003).
  4. Sander, J. D., Joung, J. K. CRISPR-Cas systems for editing, regulating and targeting genomes. Nat Biotechnol. 32, (4), 347-355 (2014).
  5. Nagy, A. Cre recombinase: The universal reagent for genome tailoring. Genesis. 26, (2), 99-109 (2000).
  6. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods. 6, (5), 343-345 (2009).
  7. Norrander, J., Kempe, T., Messing, J. Construction of improved M13 vectors using oligodeoxynucleotide-directed mutagenesis. Gene. 26, (1), 101-106 (1983).
  8. Gruber, T. M., Gross, C. A. Multiple sigma subunits and the partitioning of bacterial transcription space. Annu Rev Microbiol. 57, 441-466 (2003).
  9. Edgar, R. C. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 32, (5), 1792-1797 (2004).
  10. Macrogen Inc. Seoul, Rep. Of Korea. Available from: http://dna.macrogen.com/eng/index.jsp (2016).
  11. Chevreux, B. MIRA: an automated genome and EST assembler. Available from: http://www.chevreux.org/thesis/index.html 1-161 (2005).
  12. Thompson, J. D., Gibson, T. J., Higgins, D. G. Multiple sequence alignment using ClustalW and ClustalX. Curr Protoc Bioinformatics. Chapter 2 (Unit 2.3) 1-22 (2002).
  13. Sambrook, J., Russell, D. W. Molecular Cloning: A laboratory manual. CSHLP. (2001).
  14. Rutherford, K., et al. Artemis: sequence visualization and annotation. Bioinformatics. 16, (10), 944-945 (2000).
CAPRRESI: Chimera Assembly ved Plasmid Recovery og Restriction Enzyme Site Insertion
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Santillán, O., Ramírez-Romero, M. A., Dávila, G. CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion. J. Vis. Exp. (124), e55526, doi:10.3791/55526 (2017).More

Santillán, O., Ramírez-Romero, M. A., Dávila, G. CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion. J. Vis. Exp. (124), e55526, doi:10.3791/55526 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter