Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

CAPRRESI: Chimera Assembly Door Plasmide Recovery En Restriction Enzyme Site Insertion

doi: 10.3791/55526 Published: June 25, 2017

Summary

Hier presenteren we chimera assemblage door plasmideherstel en restrictie-enzymplaatsinzending (CAPRRESI), een protocol gebaseerd op de invoeging van restrictie-enzymplaatsen in synoniem-DNA-sequenties en functioneel plasmideherstel. Dit protocol is een snelle en goedkope methode voor het smelten van proteïne-coderende genen.

Abstract

Hier presenteren we chimera assemblage door plasmide recovery en restriction enzyme site insertion (CAPRRESI). CAPRRESI profiteert van vele sterke punten van de oorspronkelijke plasmide herstel methode en introduceert restrictie enzym digestie om DNA ligatie reacties te vereenvoudigen (vereist voor chimera assemblage). Voor dit protocol, klonen gebruikers wildtype genen in hetzelfde plasmide (pUC18 of pUC19). Na de in silico selectie van aminozuursequentie gebieden waar chimera's moeten worden samengesteld, krijgen gebruikers alle synoniem-DNA-sequenties die ze coderen. Adhoc Perl scripts stellen gebruikers in staat om alle synonieme DNA sequenties te bepalen. Na deze stap zoekt een ander Perl-script naar restrictie-enzymplaatsen op alle synoniem-DNA-sequenties. Dit in silico analyse wordt ook uitgevoerd met behulp van het ampicilline resistentie gen ( ampR ) gevonden op pUC18 / 19 plasmiden. Gebruikers ontwerpen oligonucleotiden in synoniemregio's om wildtype- en ampR- genen door PCR te verstoren. Na obtAining en zuiverende complementaire DNA-fragmenten, wordt het verteren van restrictie-enzym verwezenlijkt. Chimera assemblage wordt bereikt door gelijke complementaire DNA fragmenten te ligeren. PUC18 / 19-vectoren worden geselecteerd voor CAPRRESI omdat ze technische voordelen bieden, zoals kleine grootte (2,686 basisparen), hoge kopieën, voordelige sequentie-reactie-eigenschappen en commerciële beschikbaarheid. Het gebruik van restrictie-enzymen voor chimera-assemblage elimineert de noodzaak van DNA-polymerasen die stompe producten leveren. CAPRRESI is een snelle en goedkope methode voor het smelten van proteïne-coderende genen.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Chimerische gensamenstelling is veel gebruikt in moleculaire biologie om eiwitfunctie en / of biotechnologische doeleinden te verklaren. Verschillende methoden bestaan ​​voor het smelten van genen, zoals overlappende PCR product amplificatie 1 , plasmide recovery 2 , homologe recombinatie 3 , CRISPR-Cas9 systemen 4 , site gerichte recombinatie 5 en Gibson assemblage 6 . Elk van deze biedt verschillende technische voordelen; Bijvoorbeeld de flexibiliteit van overlappende PCR-ontwerpen, de in vivo selectie van constructies tijdens plasmideherstel, of het hoge efficiëntie van CRISPR-Cas9 en Gibson systemen. Aan de andere kant kunnen sommige moeilijkheden optreden tijdens het uitvoeren van sommige van deze methoden; Bijvoorbeeld zijn de eerste twee benaderingen gebaseerd op stompe DNA-fragmenten, en ligatie van deze typen producten kan technisch uitdagend zijn in vergelijking met sticKy-ended ligatie. Site-gerichte recombinatie kan sporen van extra DNA-sequenties (littekens) op het origineel achterlaten, zoals in het CrexloP-systeem 5 . CRISPR-Cas9 kan in aanvulling op de doelplaats 4 soms andere genoomgebieden wijzigen.

Hier introduceren we chimera assemblage door plasmideherstel en restrictie-enzymplaatsinvoeging (CAPRRESI), een protocol voor het smelten van proteïne-coderende genen die de plasmideherstelmethode (PRM) combineren met de insertie van restrictie-enzymplaatsen op synoniem-DNA-sequenties, het verbeteren van de ligatie-efficiëntie . Om de aminozuursequentie integriteit te waarborgen, worden restrictie-enzymplaatsen ingevoegd op synoniem-DNA-sequentiestrektes. Onder de voordelen van CAPPRESI is dat het kan worden uitgevoerd met behulp van gewone laboratoriumreagentia / gereedschappen ( bijv . Enzymen, bevoegde cellen, oplossingen en thermocycler) en dat het snelle resultaten kan geven (wanneer de juiste enzymen worden gebruikt). Vertrouwen op beperkingEnzym sites die voortkomen uit synonieme DNA sequenties kunnen de selectie van de exacte fusiepunten binnen de eiwitten van belang beperken. In dergelijke gevallen moeten doelgenen worden gefuseerd met behulp van overlappende oligonucleotiden, en restrictie-enzymplaatsen moeten op het weerstandgen van de vector worden ingebracht.

CAPRRESI bestaat uit zeven eenvoudige stappen ( Figuur 1 ): 1) selectie van de kloningsvector, pUC18 of pUC196; 2) in silico analyse van de wildtype sequenties die gefuseerd moeten worden; 3) selectie van breekgebieden voor chimera assemblage en plasmid ontwrichting; 4) in silico generatie van synoniem-DNA sequenties die restrictie-enzym sites bevatten; 5) onafhankelijk klonen van de wildtype genen in het geselecteerde plasmide; 6) plasmidestoring door PCR, gevolgd door restrictie-enzymvertering; En 7) plasmideherstel met behulp van DNA-ligatie en bacteriële transformatie. Chimerische genen geproduceerd door deze techniek moeten worden gecontroleerd wIn sequentiebepaling.

De vectoren pUC18 / 19 bieden technische voordelen voor het klonen en chimera assemblage, zoals kleine grootte ( dwz 2,686 basisparen), hoge kopieën, voordelige sequentie-reactie-eigenschappen en commerciële beschikbaarheid 7 . Hier werd een Escherichia coli gastheer gebruikt om de chimera's te monteren en te behandelen, omdat bacteriële culturen goedkoop zijn en snel groeien. Gezien dit, zal verdere cloning van de fusiefragmenten in de uiteindelijke doelplasmiden nodig zijn ( bijv. Expressievectoren als pRK415 in bacteriën of pCMV in zoogdiercellen).

CAPRRESI werd getest op het fuseren van twee primaire sigma-factor genen: E. colirpoD en Rhizobium etlisigA . Primaire sigma factoren zijn RNA polymerase subunits die verantwoordelijk zijn voor transcriptie initiatie, en bestaan ​​uit vier domeinen ( dwz σ1, σ2, σ3 en σ4) 8 . De aminozuursequentie verlengtH van eiwitten gecodeerd door rpoD en sigA zijn respectievelijk 613 en 685. RpoD en SigA delen 48% identiteit (98% dekking). Deze primaire sigma factoren werden gesplitst in twee complementaire fragmenten tussen regio's σ2 en σ3. Twee chimere genen werden samengesteld volgens dit ontwerp: chimera 01 (RpoDσ1-σ2 + SigAσ3-σ4) en chimera 02 (SigAσ1-σ2 + RpoDσ3-σ4). DNA-fusieproducten werden geverifieerd door sequencing.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. CAPRRESI Protocol

OPMERKING: Figuur 1 staat voor het algemene CAPRRESI protocol. Deze techniek is gebaseerd op een silico- ontwerp en de daaropvolgende constructie van de gewenste chimeras.

  1. Selectie van het kloneringsplasmide, pUC18 of pUC19.
    1. Selecteer de pUC vector die het beste past bij de technische eisen.
      OPMERKING: Beide vectoren hebben dezelfde volgorde, behalve de oriëntatie van de meervoudige kloneringsplaats. Dit is belangrijk voor het ontwerpen van oligonucleotiden en de PCR plasmidestoring.
  2. In silico analyse van de wildtype genen en pUC18 / 19 sequenties.
    1. Verkrijg de DNA sequenties van de wildtype genen en sla ze op in een FASTA formaat bestand ( bv genes.fas).
      OPMERKING: De sequenties van pUC18 / 19 vectoren bevinden zich in het pUC.fas bestand ( Figuur 1 , stap 1).
    2. Bepaal welke beperking enzYmes snijd de wildtype genen en pUC18 / 19 sequenties niet door het script REsearch.pl te draaien. Alternatief, voer een zoekopdracht met restrictie-enzym site uit met een online tool ( Figuur 1 , stap 2).
      1. Typ het volgende in een terminal:
        Perl REsearch.pl genes.fas
        Perl REsearch.pl pUC.fas
        OPMERKING: Deze commando's maken de volgende uitvoerbestanden: genes_lin.fas, genes_re.fas, pUC_lin.fas en pUC_re.fas.
      2. Selecteer de juiste restrictie-enzymen voor het klonen van de wildtype genen in de meerdere kloneringsplaats van de gekozen pUC18 / 19-vector door de genes_re.fas- en pUC.fas-bestanden te vergelijken. Kies de oriëntatie van het inzetstuk in relatie tot het ampicilline resistentie gen ( ampR ) van de pUC18 / 19 vector.
    3. Ontwerp voorwaartse en omgekeerde oligonucleotiden om het coderende gebied van de wildtype genen (externe oligonucleotiden) te amplificeren. Inclusief de juiste restrictie-enzymplaats bij elk 5'-uiteindeVan de oligonucleotiden; Hiermee wordt de invoeghoek geformuleerd.
      1. Inclusief een functionele ribosoom bindingsplaats in de voorwaartse oligonucleotiden.
      2. Leg beide wildtype genen in dezelfde richting in de vector in.
  3. Selectie van de breekgebieden voor chimera assemblage en plasmid ontwrichting.
    1. Verkrijg de aminozuursequentie van de wildtype en de ampR genen door het translate.pl script te gebruiken ( Figuur 1 , stap 3).
      1. Typ het volgende in een terminal:
        Perl translate.pl genes.fas
        Perl translate.pl ampR.fas

        OPMERKING: dit script creëert de volgende uitvoerbestanden: genes_aa.fas en ampR_aa.fas.
    2. Globaal uitlijnen de twee wildtype aminozuursequenties met een passende software ( bijvoorbeeld MUSCLE) 9 .
    3. Selecteer de gewenste pauze gebieden (3-6 aminozuren) voor chimera asMbly op basis van de volgorde uitlijning. Sla ze op in een bestand in FASTA-formaat ( bijv . , Regions.fas).
    4. Bepaal de DNA sequenties die codeert voor het geselecteerde aminozuur op beide wildtype genen.
  4. In silico generatie van synoniem DNA sequenties die restrictie-enzym sites bevatten.
    1. Verkrijg alle synoniem-DNA-sequenties die codeert voor elke aminozuursequentie die is geselecteerd als breekstreken ( Figuur 1 , stap 4); Deze sequenties werden opgeslagen in het regions.fas bestand.
      1. Typ het volgende in een terminal:
        Perl synonym.pl regions.fas
        OPMERKING: dit script zal het output_bestand regions_syn.fas maken.
    2. Zoek naar restrictie-enzymplaatsen die gevonden worden op synoniem-DNA-sequenties.
      1. Typ het volgende in een terminal: perl REsynonym.pl regions_syn.fas
        OPMERKING: dit script zal het output_bestand regions_syn-re.fas maken.
    3. Kies een restrictie-enzym dat wordt gedeeld tussen synonieme sequenties van beide wildtype genen; Deze site zal worden gebruikt om chimeren te construeren via restrictie enzym digestie. Controleer dat het gekozen restrictie-enzym geen van de wildtype genen noch de pUC18 / 19 vectorsequenties snijdt.
      1. Vergelijk de restrictie-enzymen die gevonden zijn in de genes_re.fas-, pUC_re.fas- en regions_syn-re.fas-bestanden.
    4. In silico vervangt de originelen voor hun synoniem DNA sequenties op de overeenkomstige loci op beide wildtype genen. Voeg synoniem-DNA-sequenties toe in het wildtype sequentiebestand (genes.fas).
    5. Krijg de aminozuursequentie van genen die aanwezig zijn op het genes.fas bestand ( perl translate.pl genes.fas ).
    6. Richt de aminozuursequenties die zijn vertaald van wildtype- en synoniem-DNA-sequenties uit. Controleer of beide sequenties hetzelfde zijn.
    7. Herhaal alle stappen van dit gedeelte met het aanwezige ampR- gen op de pUC18 / 19 vector.
      OPMERKING: Het doel is om het ampR- gen (bestand ampR.fas) te verstoren in twee complementaire onderdelen. Het restrictie-enzym dat is geselecteerd om het ampR- gen te verstoren, moet verschillen van die welke gebruikt wordt voor chimera-assemblage.
  5. Onafhankelijke kloning van de twee wildtype genen in de geselecteerde pUC18 / 19 vector (Figuur 1, stap 3).
    1. Zuiver het gekozen pUC18 / 19 plasmide DNA met behulp van een plasmide DNA zuiveringsset.
      1. Bijvoorbeeld transformeer E. coli DH5a met pUC18 plasmide en groei de transformanten 's nachts bij 37 ° C op vaste LB-0,3 mg / ml ampicilline (Amp). Kies een transformantkolonie, injecteer een nieuwe LB-0.3 mg / mL Amp-plaat, en groei het overnacht bij 37 ° C.
      2. Neem deel uit van de vorige cultuur en groei het in vloeibare LB-0.3 mg / mL Amp gedurende 6-8 uur bij 37 ° C. Extracteer het plasmide-DNA met behulp van een kit.
    2. PCR amplificeert wildtype genen uit het totale genomische DNA met behulp van de appropRiate externe oligonucleotiden. Gebruik zo mogelijk een hoogwaardig DNA-polymerase. Selecteer het DNA-polymerase dat de opbrengst maximaliseert. Voer PCR uit volgens de richtlijnen van de fabrikant en de smeltemperatuur van de oligonucleotiden.
      1. Run PCR cycli, afhankelijk van het DNA polymerase, amplicon grootte, template en oligonucleotiden gebruikt. Om bijvoorbeeld rpoD DNA te amplificeren, berekent u een 50 μL reactie: 5 μl 10x buffer, 2 μl 50 mM MgS04, 1 μl 10 mM dNTP-mix, 2 μl van elk 10 μM oligonucleotide (tabel 2), 2 ΜL template DNA ( E. coli DH5a totaal DNA), 35,8 μl ultrazuiver water en 0,2 μl hoogwaardig DNA-polymerase. Voer de volgende PCR cycli uit: 1 minuut bij 94 ° C voor de initiële denaturatie gevolgd door 30 cycli van amplificatie (30 s bij 94 ° C tot denaturatie, 30 s bij 60 ° C om de oligonucleotiden te ontlasten en 2 min bij 68 ° C uit te breiden).
      2. Oplossen 1,2 g vanAgarose in 100 ml dubbel gedestilleerd water door ze te verwarmen in de magnetron. Monteer een gelbak en kam en zet ze in de horizontale gelaster. Vul de gelbak met de gesmolten agaroseoplossing en laat het stollen. Verwijder de kam.
      3. Plaats de gel in de elektroforese kamer. Vulkamer met 1x Tris-acetaat-EDTA buffer. Laad 50 μl PCR-producten in de gelputten. Elektroforeseer de monsters ( bijv . Bij 110 V gedurende 1 uur).
      4. Na elektroforese vlek de gel in 100 ml dubbel gedestilleerd water met 100 μl 1 mg / ml ethidiumbromide oplossing gedurende 10 minuten met langzaam schudden. Was de gel in tweedestilleerde water gedurende nog eens 10 minuten in trage schudden; Gebruik een horizontale shaker.
        Let op: Ethidiumbromide is een giftige verbinding; Draag beschermende handschoenen en een katoen laboratoriumjas.
      5. Reinig wildtype gen DNA uit de overeenkomstige banden van de gel met behulp van een kit. Visualiseer de bands door de gekleurde gel in een UV-kamer te plaatsen (Aanbevolen golflengte: 300 nm). Bewaar de blootstelling van de gel tot een minimum. Gebruik een DNA-zuiveringsset en volg de instructies van de fabrikant.
        Let op: UV-straling is gevaarlijk; Draag een beschermend schild, een bril en een katoenlaboratoriumjas.
    3. Digest gezuiverde wildtype genen en pUC18 / 19 plasmide DNA met de restrictie enzymen volgens de instructies van de fabrikant. Gebruik zo snel mogelijk spijsverteringsenzymen. Bijvoorbeeld verteer 6 μL pUC18 DNA (300 ng / μL) in 10 μl ultrauw water, 2 μl 10X buffer, 1 μl Kpn I restrictie enzym en 1 μl Xba I restrictie enzym. Laat de reactie gedurende 30 minuten bij 37 ° C achter.
      1. De restrictie-enzymen inactiveren volgens de richtlijnen van de fabrikant. Bijvoorbeeld, de dubbele spijsvertering reactie Kpn I- Xba I bij 80 ° C gedurende 5 minuten inactiveren.
    4. Mix insert: vector DNA bij een volumetrische ratiO van 3: 1. Volg de instructies van de fabrikant voor een ligatie reactie. Gebruik zo snel mogelijke ligatie enzymen (laat de reactie bij 25 ° C gedurende 10 minuten).
      OPMERKING: Typisch is de DNA-concentratie na zuivering met behulp van de kits goed genoeg voor spijsvertering en ligatie reacties. Voeg bijvoorbeeld 6 μL rpoD DNA ( Kpn I- Xba I, 150 ng / μl), 3 μl pUC18 DNA ( Kpn I- Xba I, 150 ng / μl), 10 μl 2x buffer, 1 μl ultrapure Water en 1 μl T4 DNA ligase. Laat de ligatie reactie bij 25 ° C gedurende 10 minuten.
    5. Transformeer de E. coli DH5a met 2-4 μl van de ligeringsreactie, zoals beschreven in het Aanvullende Materialen. Platte de getransformeerde cellen in solide LB / Amp / X-gal / IPTG platen. Laat de platen overnacht bij 37 ° C.
    6. Selecteer witkleurige transformant E. coli kolonies en streep ze op een nieuwe LB / Amp plaat. Laat de borden overnacht bij 37 ° C liggen. </ Li>
    7. Voer een koloniale PCR uit om kandidaten te kiezen voor het sequentiëren van de reactie, zoals beschreven in het Aanvullende Materialen. Extracteer plasmide DNA uit kandidaten. Alternatief verteer kandidaat plasmide DNA met dezelfde restrictie enzymen gebruikt voor het klonen van de inserts.
    8. Sequentie kandidaat constructies met een sequencing service provider 10 . Monteer de sequentie in silico met behulp van een DNA assembler 11 ( Figuur 1 , stap 5).
  6. Plasmidafbreking door PCR, gevolgd door restrictie-enzymvertering.
    1. Ontwerp in silico voorwaartse en omgekeerde oligonucleotiden bij pauze gebieden voor respectievelijk wildtype en ampR genen. Vervang in silico het wildtype fragment voor de overeenkomstige synoniem-DNA-sequentie (verkregen in stap 1.4).
      OPMERKING: Deze synoniem-DNA-sequentie bevat een restrictie-enzymplaats. Voorwaartse en omgekeerde oligonucleotiden overlappen bij tHij restrictie enzym site. Oligonucleotiden moeten variëren van 21-27 nucleotiden, eindigen met een cytosine of guanine, en bevatten een restrictie-enzymplaats. Een voorwaartse oligonucleotide heeft dezelfde sequentie als zijn doelgebied op het template DNA. Een omgekeerd oligonucleotide is de omgekeerde complementaire sequentie van het doelgebied op het template DNA.
    2. Gebruik de twee wildtype genconstructies als het DNA-sjabloon voor PCR-reacties ( bijv. PUC18 rpoD en pUC18 sigA ). Verkrijg twee complementaire delen van elke constructie (pUC18 rpoD σ1 -σ2, pUC18 rpoD σ3 -σ4, pUC18 sigA σ1 -σ2 en pUC18 sigA σ3-σ4) ( Figuur 1 , stap 6).
    3. Laad DNA-monsters in een agarosegel 1-1,2% [w / v]. De PCR-producten scheiden van de DNA-sjabloon door elektroforese ( bijv. 110 V gedurende 1 uur). Alternatief, verteer de PCR-reacties met Dpn I om de DNA-sjabloon te breken.
      OPMERKING: DpnIk enzym herken slechts gemethyleerde DNA sequenties (5'-GATC-3 ').
      1. Zuiver de monsters met behulp van een DNA zuiveringsset. Volg de richtlijnen van de fabrikant.
    4. Dubbele verteer alle complementaire DNA-fragmenten met de juiste restrictie-enzymen volgens de richtlijnen van de fabrikant. Gebruik, indien mogelijk, snel-verterende restrictie-enzymen. Dubbele verteer het pUC18rpoDσ1-σ2 DNA fragment met Afl II en Spe I met behulp van het protocol van de fabrikant. Laat de spijsverteringsreactie bij 37 ° C gedurende 15 minuten.
    5. De restrictie-enzymen inactiveren volgens de richtlijnen van de fabrikant. Bijvoorbeeld, inactiveer Afl II- Spe I bij 80 ° C gedurende 20 minuten.
  7. Plasmideherstel met behulp van DNA-ligatie en bacteriële transformatie.
    1. Meng de juiste DNA-fragmenten in een volumetrische verhouding van 1: 1 om het gewenste chimere gen te assembleren ( Figuur1, stap 7).
      OPMERKING: Op deze manier wordt de integriteit van het ampR- gen hersteld, waardoor een functioneel eiwit wordt geproduceerd.
      1. Meng bijvoorbeeld 4 μL pUC18 rpoD σ1 -σ2 DNA (verteerd met Afl II- Spe I, 150 ng / μl), 4 μl pUC18 sigA σ3-σ4 DNA ( Afl II- Spe I, 150 ng / μl), 10 μl 2x buffer, 2 μl ultrapure water en 1 μl T4 DNA ligase; De DNA-concentratie na de zuivering van de kit is goed genoeg voor de spijsvertering en de daaropvolgende ligatie. Laat de ligeringsreactie bij 25 ° C gedurende 10 minuten.
    2. Transformeer E. coli DH5a met 3-5 μl van de chimera assemblage ligatie reactie (Aanvullende Materialen). Groei de transformantcellen in LB / Amp / X-gal / IPTG-platen overnacht bij 37 ° C overnacht.
    3. Selecteer witkleurige transformant E. coli kolonies en streep ze op een nieuwe LB / Amp plaat. Laat de borden overnacht op 37° C.
    4. Voer een kolonie-PCR uit om kandidaten te kiezen voor een sequentierespons, zoals beschreven in de aanvullende materialen. Visualiseer bands in een 1-1,2% (w / v) agarosegel door elektroforese te verrichten (beschreven in stap 2.3.2.1).
    5. Kweek culturen van positieve kandidaten. Extract plasmide DNA van hen met behulp van een plasmide DNA zuivering kit.

2. Sequence Kandidaat Chimere Constructies

  1. Zorg ervoor dat de kwaliteit van het plasmide-DNA goed genoeg is voor de sequentiereactie door richtlijnen van de sequentie dienstverlener te volgen. Extract DNA met behulp van zuiverings kits. Bijvoorbeeld, op de internetpagina van de sequentieverlener, speciale aandacht besteden aan de aanbevolen DNA-concentratie voor de monsters. Verkrijg de concentratie van monsters met behulp van een DNA-kwantificeringsinstrument.
  2. Sequentie kandidaat chimere constructies met een sequencing service provider 10 .
  3. Assemble se Quencing leest met een in silico DNA assembler 11 .
  4. Uitgelijnd gemonteerd versus in silico- ontworpen chimere sequenties met behulp van sequentie-uitlijngereedschappen 9 , 12 . Controleer of het chimere gen succesvol is gesmolten.

3. Voorbereidingen maken

OPMERKING: Alle stappen die levende cellen betreffen, dienen in een schone laminarstroomkap met de Bunsen-brander te worden uitgevoerd.

  1. Het produceren van E. coli DH5a-bevoegde cellen.
    1. Om E. coli -competente cellen te produceren, volgt u gepubliceerde protocollen 13 of zie de aanvullende materialen . Alternatief gebruik commercieel beschikbare bevoegde cellen.
  2. Transformeren van E. coli DH5a-bevoegde cellen.
    1. Voor de chemische transformatie van E. coli culturen, volg de gepubliceerde protocollenClass = "xref"> 13 of zie de aanvullende materialen . Alternatief gebruik elektroporatie voor bacteriële transformatie. Als er gebruik wordt gemaakt van commercieel beschikbare bevoegde cellen, volg de richtlijnen van de fabrikant.
  3. Het zuiveren van genomisch en plasmide DNA van E. coli DH5a.
    1. Voer nucleïnezuurxtractie uit, zoals vermeld in de aanvullende materialen , met gebruik van commercieel verkrijgbare kits of volgende gepubliceerde protocollen 13 .
  4. Voer kolonie-PCR uit.
    1. Gebruik deze techniek om kandidaat-transformantkolonies te identificeren voor de volgende sequentiereactie.
      OPMERKING: Deze methode vertegenwoordigt geen definitieve verificatie van de integriteit van de sequenties. Een gedetailleerde beschrijving van deze techniek is beschikbaar in de aanvullende materialen .
  5. De oplossingen voorbereiden.
    1. Zien
  6. Download de scripts en volgordebestanden die nodig zijn voor het CAPRRESI-protocol.
    1. Download genbank bestanden die de volledige genoomsequentie van de gewenste soort bevatten, verwijder de DNA sequentie van het gekozen gen met behulp van een genoom browser en sla het op in fasta bestandsformaat. Download de Perl-scripts die nodig zijn voor het CAPRRESI-protocol. Bewaar de scripts en de volgordebestanden in dezelfde map.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Figuur 1 toont CAPRRESI. Met behulp van deze methode werden twee chimere genen samengesteld door de domeinen van twee bacteriële primaire sigma factoren ( dwz E. coli RpoD en R. etli SigA) uit te wisselen. De DNA sequenties van de rpoD- en sigA- genen werden verkregen met behulp van de Artemis Genome Browser 14 van respectievelijk GenBank genoombestanden NC_000913 en NC_007761. De DNA sequentie van de pUC18 vector werd verkregen uit de nucleotide database van de NCBI server. In silico werden analyses van restrictie-enzymplaatsen uitgevoerd op DNA-sequenties door het Perl-script REsearch.pl te besturen (zie stap 1.2.2). Deze resultaten werden gebruikt voor oligonucleotide ontwerp (stap 1.2.3). Externe oligonucleotiden omvatten herkenningsplaatsen voor XbaI- en KpnI- restrictie-enzymen om wildtypegenen in de pUC18-veelvoudige kloneringsplaats te kloonen. Het voorwaartse oligonucleotide omvatte ook een riboEnige bindingsplaats ( tabel 2 ). Genomisch DNA werd geëxtraheerd uit E. coli DH5a cellen die werden gegroeid in LB / Nal bouillon (37 ° C, 220-250 rpm) en R. etli CFN42 cellen gegroeid in PY / Nal / CaCl2 bouillon (30 ° C, 220-250 rpm ). Deze monsters werden gebruikt als DNA templates voor wildtype gen amplificatie (stap 1.5.2).

Wildtype genen werden geamplificeerd met behulp van een Taq high-fidelity DNA polymerase, dat werd gezuiverd uit agarose gels (DNA zuiveringsset), dubbel verteerd met Kpn I- Xba I restrictie enzymen en gekloneerd in de pUC18 vector. Chemisch bevoegde E. coli DH5a cellen werden getransformeerd met 5 μl van de ligeringsreactie die overeenkomt met wildtype constructies pUC18 rpoD en pUC18 sigA (stap 1.5.5). Transformante cellen werden geselecteerd op vaste LB / Amp / X-gal / IPTG platen gegroeid bij 37 ° C. Wildtype constructies werden geverifieerd door Sanger sequencIng 10 . Sanger sequentie lezingen waren in silico gemonteerd met behulp van MIRA 11 (stap 1.5.8).

Aminozuursequenties van wildtype genen werden verkregen door het translate.pl script te gebruiken (stap 1.3.1). Na het aanpassen van wildtypegenen met Clustal 12 werden de aminozuurregio's TLV en NLR geselecteerd op respectievelijk de ampicilline resistentie gen ( ampR ) en de primaire sigma factoren van de wildtype (stap 1.3.3). Deze aminozuurregio's werden gebruikt voor het berekenen van alle mogelijke DNA-synoniemsequenties die ze coderen door het synonym.pl script te gebruiken (stap 1.4.1). Het REsynonym.pl script werd gezocht naar restrictie-enzym sites die gevonden werden op de eerder gegenereerde synoniem-DNA sequenties (stap 1.4.2). Die synoniemregio's die het laagste aantal veranderingen invoerden in vergelijking met de wildtype sequenties werden geselecteerd. Voor de primaire sigmafactorgenen, wildtype sequenties van RpOD (AACTTACGT) en SigA (AACCTTCGC) werden uitgewisseld voor AA CTTAAG G. Deze laatste omvatte een Afl II site (vetgedrukt). Voor het ampR- gen werd de wildtype-sequentie ACGCTGGTG uitgewisseld voor zijn synoniem, AC ACTAGT G. De synoniem-DNA-sequentie die in het ampR- gen werd ingebracht, bevatte een Spe I-site (vetgedrukt). De silico- substitutie van de wildtype voor de overeenkomstige synoniemsequenties werd gedaan om de sequentieintegriteit en het oligonucleotide-ontwerp te verifiëren (stappen 1.2-1.4).

Synoniemsequentieveranderingen werden geïntroduceerd door PCR onder toepassing van de geschikte oligonucleotiden ( Tabel 2 ) en wildtypeconstructies als DNA-templates (stap 1.5.2). Versterkingsreacties produceerden vier complementaire delen: pUC18 rpoD σ1 -σ2, pUC18 rpoD σ3 -σ4, pUC18 sigA σ1 -σ2 en pUC18 sigA σ3-σ4. De complementaire onderdelen disRupted niet alleen sigma factoren, maar ook de ampR genen. Aanvullende delen werden gezuiverd onder toepassing van een DNA-zuiveringsset (stap 1.6.3).

Deze complementaire DNA-fragmenten werden dubbel verteerd met Afl II- en SpeI- restrictie-enzymen (stap 1.6.4). Volgens CAPRRESI-ontwerp werden DNA-fragmenten pUC18 rpoD σ1 - σ2 geligeerd met pUC18 sigA σ3-σ4 om chimera 01 te verkrijgen en pUC18 sigA σ1 -σ2 geligeerd met pUC18 rpoD σ3 -σ4 om chimera 02 te assembleren (stappen 1.7.1-1.7 0,3). Chemisch bevoegde E. coli DH5a cellen werden getransformeerd met 5 μl van de ligeringsreactie van pUC18 chim01 en pUC18 chim02 (stap 1.7.4). Transformante cellen werden geselecteerd op vaste LB / Amp / X-gal / IPTG-platen die werden gewekt bij 37 ° C (stap 1.7.5). Chimere constructies werden geverifieerd door Sanger sequencing 10 (stap 2). Sanger volgorde rEads werden samengesteld met behulp van MIRA 11 , en de resulterende bestanden zijn vermeld in tabel 3 . Figuur 2 toont de uitlijningen (uitgevoerd met behulp van MUSCLE) 9 van gemonteerde sequenties van wildtype en chimere genen bij breekstreken.

Figuur 1
Figuur 1: CAPRRESI overzicht. Vertegenwoordigingen: genen (dikke pijlen), functionele plasmiden (gesloten cirkels) en oligonucleotiden (dunne, zwarte pijltjes). Restrictie-enzymplaatsen die in oligonucleotiden zijn ingevoegd, verschijnen in kleuren. Afkortingen: Wt (wildtype), FWD (voorwaarts oligonucleotide), REV (omgekeerd oligonucleotide), ampR (ampicilline resistentie gen), RES (restrictie enzym site), RE (restrictie enzym). Klik hier om een ​​grotere versie te zienOp van deze figuur.

Figuur 2
Figuur 2: Uitlijning van gemonteerde wildtype- en chimere gensequenties. Gemonteerde DNA sequenties werden uitgelijnd met behulp van MUSCLE 9 . Sequenties werden gemonteerd met MIRA 11 . Synonieme sequenties verschijnen in zwart. De Afl II herkenningssite wordt onderstreept. IUPAC nucleotide code: R (A of G) en K (G of T). Constructies: rpoD (rood), sigA (blauw), chimera 01 sequentie ( rpoD σ1 -σ2- sigA σ3-σ4) en chimera 02 sequentie ( sigA σ1-σ2-rpoD σ3 -σ4). Klik hier om een ​​grotere versie van deze figuur te bekijken.

Oplossing Components Instructions
Aantal stuks samenstelling
Luria-Bertani (LB) bouillon 5 g gist extract Los alle componenten op in water. Autoclaaf. Bewaar bij kamertemperatuur tot gebruik. Voor een solide LB bouillon voeg 15 g bacteriologische agar toe aan het recept.
10 g Caseïnepepton
10 g NaCl
Tot 1 liter Dubbel gedistilleerd water
LB / Amp / X-gal / IPTG platen 100 ml Gesmolten vaste LB bouillon Voeg alle componenten toe aan gematigde LB bouillon. Vul Petrischalen en wacht tot ze stollen. Voer stappen uit in een schone laminaatvloeikap met de Bunsen-brander aan.
100 μl Ampicilline (Amp) [100 mg / ml]
100 μl X-gal [20 mg / ml]
50 μl 1 M IPTG oplossing
Pepton gist (PY) bouillon 3 g gist extract Los alle componenten op in water. Autoclaaf. Bewaar bij kamertemperatuur tot gebruik. Voor een vaste PY bouillon voeg 15 g bacteriologische agar toe aan het recept. Voor R. etli-cultuur voegt u 700 μL 1 M CaCl2-oplossing voor gebruik toe.
5 g Caseïnepepton
Tot 1 liter Dubbel gedistilleerd water
PY / CaCl2 / Nal platen 100 ml Gesmolten vaste PY bouillon Voeg alle componenten toe aan gematigde PY bouillon. Vul de petrischalen en wacht tot ze stollen. Voer stappen uit in een schone laminaatvloeikap met de Bunsen-brander aan.
700 μl 1 M CaCl2 oplossing
100 μl Nalidixzuur (Nal) [20 mg / ml]
1 M calciumchloride (CaCl2) oplossing 11,1 g CaCl2 Los CaCl2 op in water. Autoclaaf. Bewaar op kamertemperatuur.
Tot 100 ml Dubbel gedistilleerd water
Tris-EDTA (TE) 10: 1 pH 8,0 1 ml 1 M Tris oplossing Meng alle componenten. Autoclaaf. Bewaar op kamertemperatuur.
400 μl 0,25 M EDTA oplossing
Tot 100 ml Dubbel gedistilleerd water
TE 50:20 pH 8,0 5 ml 1 M Tris oplossing Meng alle componenten. Autoclaaf. Bewaar bij kamertemperatuur. </ Td>
8 ml 0,25 M EDTA oplossing
Tot 100 ml Dubbel gedistilleerd water
TE 10: 1 10 mM NaCl oplossing 58,4 mg NaCl Los NaCl op TE 10: 1 op. Autoclaaf. Bewaar op kamertemperatuur.
Tot 100 ml TE 10: 1 pH 8,0 oplossing
Lysis oplossing I 80 mg lysozym Oplossen en meng alle componenten in water. Filter steriliseren met behulp van een 0,22 μm filter. Bewaar op kamertemperatuur.
2 ml 0,5 M glucose oplossing
400 μl 0,5 M EDTA oplossing
500 μl 1 M Tris oplossing
Tot 20 ml Gesteriliseerd dubbel gedestilleerd water
Lysis oplossing II 1,2 ml 5 M natriumhydroxide (NaOH) oplossing Los alle componenten op in water. Filter steriliseren met behulp van een 0,22 μm filter. Bewaar op kamertemperatuur.
3 ml 10% natriumdodecylsulfaatoplossing (SDS)
Tot 30 ml Gesteriliseerd dubbel gedestilleerd water
Lysis oplossing III 29,4 g Kaliumacetaat (CH3 COOK) Oplossen en meng alle componenten in water. Filter steriliseren met behulp van een 0,22 μm filter. Bewaar op kamertemperatuur.
11,5 ml Absoluut azijnzuur (CH3COOH)
Tot 100 ml Gesteriliseerd dubbel gedestilleerd water
1 M magnesiumchloride (MgCl2) oplossing 9,5 g MgCl2 MgCl2 oplossen in water. Autoclaaf. Bewaar op kamertemperatuur.
Tot 100 ml Dubbel gedistilleerd water
3 M natriumacetaat (CH3COONa) oplossing 24,6 g CH 3 COONa Los CH3 COONa op in water. Autoclaaf. Bewaar op kamertemperatuur
Tot 100 ml Dubbel gedistilleerd water
10% SDS oplossing 10 g SDS Los SDS in water op met een magnetische roerbar bij lage snelheid. Autoclaaf. Bewaar op kamertemperatuur.
Tot 100 ml Dubbel gedistilleerd water
3 M CH 3 COOK oplossing 29,4 g CH 3 COOK CH 3 COOK in water oplossen. Filter steriliseren met behulp van een 0,22 μm filter. Bewaar op kamertemperatuur. Tot 100 ml Gesteriliseerd dubbel gedestilleerd water
Proteinase K oplossing 5 mg Proteinase K Los proteïnease K op in TE 50:20 oplossing. Verhit bij 37 ºC gedurende 1 uur. Bewaren bij -20 ºC.
Tot 1 ml TE 50:20 pH 8,0 oplossing
RNase oplossing 10 mg RNase Los RNase op in water. Verhit bij 95 ºC gedurende 10 minuten. Bewaren bij -20 ºC.
Tot 1 ml Gesteriliseerd ultrapure water
1 M isopropyl-P-D-thiogalactoside (IPTG) oplossing 238,3 mg IPTG Los IPTG op in water. Filter steriliseren met behulp van een 0,22 μm filter. Bewaren bij -20 ºC.
Tot 1 ml Gesteriliseerd ultrapure water
20 mg X-gal Oplos X-gal in water. Filter steriliseren met behulp van een 0,22 μm filter. Bewaren bij -20 ºC.
Tot 1 ml Gesteriliseerd ultrapure water
Fenol: chloroform: isoamylalcohol 24: 24: 1 oplossing 24 ml fenol Meng alle componenten. Bewaar in een amber afgedekte fles bij 4 ºC. VOORZICHTIGHEID! Gevaarlijk materiaal. Draag beschermende bril, handschoenen en katoenen laboratoriumjurk. Gebruik een afzuigkap. Zet de Bunsen-brander of andere brandbranden niet aan tijdens het hanteren. Alternatief: gebruik commercieel fenol: chloroform: isoamylalcohol 25: 24: 1 oplossing
24 ml chloroform
1 ml Isoamylalcohol
0,5 M glucose oplossing 9 g glucose Los glucose op in water. Filter steriliseren met behulp van een 0,22 μm filter. Bewaar op kamertemperatuur.
Tot 100 ml Gesteriliseerd ultrapure water
0,5 M ethylendiaminetetraazijnzuur (EDTA) pH 8,0 oplossing 14,6 g EDTA Los EDTA op in water. Pas de pH aan met 5 M NaOH oplossing. Autoclaaf. Bewaar op kamertemperatuur.
Tot 100 ml Dubbel gedistilleerd water
0,25 M EDTA pH 8,0 oplossing 7,3 g EDTA Los EDTA op in water. Pas de pH aan met 5 M NaOH oplossing. Autoclaaf. Bewaar op kamertemperatuur.
Tot 100 ml Dubbel gedistilleerd water
1 M Tris pH 8,0 oplossing 12,1 g Tris Tris oplossen in water. Pas de pH aan metAbsoluut zoutzuur (HCl). Autoclaaf. Bewaar op kamertemperatuur.
Tot 100 ml Dubbel gedistilleerd water
5 M natriumhydroxide (NaOH) oplossing 19,9 g NaOH Los NaOH op in water. Bewaar op kamertemperatuur. VOORZICHTIGHEID! Caustische verbinding.
Tot 100 ml Gesteriliseerd dubbel gedestilleerd water
0,1 M NaOH oplossing 399 mg NaOH Los NaOH op in water. Bewaar op kamertemperatuur.
Tot 100 ml Gesteriliseerd dubbel gedestilleerd water
Nalidixzuurzuur (Nal) stock oplossing 60 mg Nalidixzuur Los Nal in water op. Filter steriliseren met behulp van een 0,22 μm filter. Bewaren bij 4 ºC.
Tot 3 ml 0,1 MNAOH oplossing
Ampicilline (Amp) voorraadoplossing 300 mg ampicilline Los amp in water. Filter steriliseren met behulp van een 0,22 μm filter. Bewaren bij 4 ºC.
Tot 3 ml Gesteriliseerd dubbel gedestilleerd water
10x tris-acetaat-EDTA buffer 48,4 g Tris Los alle componenten op in water. Autoclaaf. Bewaar op kamertemperatuur.
20 ml 0,5 M EDTA oplossing
11,44 ml ijsazijn
Tot 1 liter Dubbel gedistilleerd water

Tabel 1: Oplossingspreparatie. Instructies voor het oplossen van de oplossing.

Nee. Code Volgorde Lengte (nt) Kenmerken
1 RpoD-FWD GC TCTAGA GA AGGAGA TATCATATGGAGCAAAACCCGCAGTCA 43 XbaI site; Wild type gen amplificatie en vector kloning
2 RoD-REV GG GGTACC TTAATCGTCCAGGAAGCTACG 29 Kpnl- plaats; Wild type gen amplificatie en vector kloning
3 SigA-FWD GC TCTAGA GA AGGAGA TATCATATGGCAACCAAGGTCAAAGAG 43 XbaI site; Wild type gen amplificatie en vector kloning
4 SigA-REV GG GGTACC TTAGCTGTCCAGAAAGCTTCT </ Td> 29 Kpnl- plaats; Wild type gen amplificatie en vector kloning
3 AmpR-FWD AC ACTAGT GAAAGTAAAAGAT 21 SpeI site ingevoegd, synoniem mutatie. Ontwrichting van het ampR- gen
4 AmpR-REV TC ACTAGT GTTTCTGGGTGAG 21 SpeI site ingevoegd, synoniem mutatie. Ontwrichting van het ampR- gen
5 σ2RpoD-FWD AA CTTAAG GCTGGTTATTTCTATCGCT 27 AflII site ingevoegd, synoniem mutatie. Bouw van chim01-02
6 σ2RpoD-REV GC CTTAAG TTCGCTTCAACCATCTCTT 27 AflII site ingevoegd, synoniem mutatie. Bouw van chim01-02
7 σ2SigA-FWD AA CTTAAG GCTCGTCATTTCAATCGCC 27 AflII site ingevoegd, synoniem mutatie. Bouw van chim01-02
8 σ2SigA-REV GC CTTAAG TTCGCTTCGACCATTTCCT 27 AflII site ingevoegd, synoniem mutatie. Bouw van chim01-02

Tabel 2: Oligonucleotide sequenties. Restrictie-enzym sites lijken onderstreept. Ribosome bindingsplaats: vetgedrukt.

Bouw Sequence-bestand Kwaliteitsbestand
chimera01 chim01_out.unpadded.fasta chim01_out.unpadded.fasta.qual
chim01_A3 / B3 / E2 / F2 / G2 /H2.pdf
chimera02 chim02_out.unpadded.fasta chim02_out.unpadded.fasta.qual
chim02_C3 / D3 / E3 / F3 / G3 / H3.pdf
rpoD rpod_out.unpadded.fasta rpod_out.unpadded.fasta.qual
sigA siga_out.unpadded.fasta siga_out.unpadded.fasta.qual

Tabel 3: Volgordebestanden verkregen bij de MIRA assembler en DNA sequencer. Sanger sequencing leest van chimere en wildtype constructies werden samengevoegd met MIRA 11 software met behulp van de mapping optie. Chromatogrammen van chimera sequencing verschijnen als PDF-bestanden.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

CAPRRESI is ontworpen als een alternatief voor de PRM 2 . De originele PRM is een krachtige techniek; Het maakt het mogelijk de DNA-sequenties te combineren langs elk deel van de geselecteerde genen. Voor PRM moeten wildtype genen in hetzelfde plasmide worden gekloneerd. Daarna worden oligonucleotiden ontworpen binnen wildtype en antibiotica resistentie genen gevonden op het plasmide. Plasmidafbreking wordt bereikt door PCR met behulp van stompe, hoogwaardige DNA-polymerasen en eerder ontworpen oligonucleotiden. De ligatie van complementaire PCR producten assembleert chimere genen en herstelt de antibiotica weerstandscassette, wat resulteert in functioneel plasmide herstel. PRM maakt de constructie van chimere genbibliotheken mogelijk op dezelfde plasmidachtergrond. Helaas kan de ligatie van stompe DNA sequenties technisch lastig zijn. Chimera-assemblage door overlappende PCR-fragmenten 1 vereist ook dat DNA-polymerasen stompe eindproducten leveren enDNA zuivering voor elke reactie. De chimere genen die door deze techniek zijn samengesteld zijn lineaire DNA-producten. Het klonen van elke constructie in de doelvector kan verdere analyse vertragen.

CAPRRESI profiteert van veel van de sterke punten van PRM en vereenvoudigt ook de ligatie van complementaire DNA-fragmenten door gebruik te maken van restrictie-enzymplaatsen op synoniem-DNA-sequentieregio's. Om deze redenen vereist CAPRRESI geen stompe DNA-polymerasen. Het gebruik van synoniem-DNA-sequenties beperkt fusieplaatsen voor chimera assemblage, maar verbetert ligatie-efficiëntie. Een andere belangrijke wijziging die in CAPRRESI is ingevoerd, is dat chimera's worden gemonteerd en behandeld in pUC18 / 19-vectoren. Deze vectoren beschikken over meerdere voordelige eigenschappen, zoals eerder vermeld. Chimere DNA kon verkregen worden door de constructievector te vermenigvuldigen in E. coli hosts. Het daaropvolgende klonen van chimere genen in het uiteindelijke plasmide ( bijvoorbeeld een expressievector) is somsvereist.

CAPRRESI vertrouwt ook op de in silico behandeling van DNA- en aminozuursequenties. Ad hoc Perl scripts maken de selectie van de juiste restrictie-enzymen mogelijk om wildtypegenen te kloonen, de berekening van alle synoniem-DNA-sequenties die overeenkomen met breukregio's (voor chimera-assemblage) en de identificatie van restrictie-enzymen voor het vereenvoudigen van plasmideherstel. Gezien deze voorwaarden is CAPRRESI een alternatief voor het smelten van eiwitcoderende genen. Kritieke stappen van het CAPRRESI protocol zijn: 1) de selectie van breekstreken en 2) de zuivering van PCR-producten. Breekregio's zijn strekken waar synonieme sequenties worden berekend, waardoor restrictie-enzymplaatsen die niet gevonden worden op wildtype sequenties. Het gebruik van restrictie-enzymplaatsen voor chimera-assemblage elimineert de noodzaak van DNA-polymerasen die stompe producten leveren en vergemakkelijkt de ligatie-reactie. Niet alle regio's hebben bruikbare restrictie-enzymplaatsen; foOm deze reden is het aan te raden om breekgebieden met één aminozuur per keer te verplaatsen tot de beste sequentie strekking wordt gevonden. Als het in siliconontwerp niet de beweging van de breekgebieden toelaat of de sequentiestrektjes geen synonieme DNA-sequenties ontbreekt met geschikte restrictie-enzymplaatsen, wordt het aanbevolen om doelgenen te smelten met behulp van overlappende oligonucleotiden en het introduceren van synoniem-DNA sequenties in het ampicilline resistentie gen (Alleen op de vector) gevonden. Op deze manier kunnen de genen op elk onderdeel worden gefuseerd en het plasmideherstel berust op de ligatie van één unieke site (verteerd met slechts één restrictie-enzym). De flexibiliteit van CAPPRESI zorgt ervoor dat het in combinatie met andere technieken kan worden uitgevoerd.

De zuivering van PCR-producten wordt uitgevoerd om template-DNA te elimineren, waardoor de kans op verontreiniging van ouderlijke plasmiden wordt verminderd na de ligatie van complementaire DNA-fragmenten. Het voldoen aan deze twee kritieke stappen verbetert bacTeriaal transformatie-efficiëntie (het aantal correct samengestelde constructies), waardoor CAPRRESI uitgevoerd kan worden met ofwel chemisch bevoegde (CaCl2) of elektrocompetente E. coli cellen. Het eerste type bekwame cellen vertegenwoordigt de goedkoopste bron van E. coli culturen, die in de meeste laboratoria gebruikt worden voor bacteriële transformatie. Door alle eerder vermelde eigenschappen is CAPRRESI een nuttige optie voor het assembleren van chimeras.

Bovendien zou CAPRRESI kunnen werken in combinatie met overlappende PCR fragmenten of plasmid recovery technieken. Bijvoorbeeld, in plaats van twee synonieme sequenties per complementair DNA-gedeelte in te voegen, zou het gewenste breekgebied (op de wilde wildtype genen) overlappende oligonucleotiden kunnen gebruiken om tussenliggende sequenties te smelten. De introductie van synoniemsequenties kan worden beperkt tot het ampR- gen van pUC18 / 19-vectoren, wat leidt tot het gebruik van slechts één restrictie-enzym om plasmi te herstellenD integriteit. Deze toekomstige toepassingen zouden CAPRRESI kunnen versterken door de fusie van elk type DNA-sequenties ( dwz niet alleen proteïne-coderende genen) toe te staan, zonder de ligatie-efficiëntie in gevaar te brengen.

Om CAPRRESI te testen werden twee chimere sigma factoren samengesteld door regio's uit twee wildtype primaire sigmafactorengenen: rpoD ( E. coli ) en sigA ( R. etli ) uit te wisselen. Alle bekende primaire sigma factoren bevatten vier domeinen, σ1 tot σ4 8 . Chimera 01 bestaat uit RpoDσ1-σ2 en SigAσ3-σ4, terwijl chimera 02 SigAσ1-σ2 en RpoDσ3-σ4 heeft. De integriteit van de chimere constructies werd geverifieerd door Sanger sequencing 10 ( Figuur 2 ).

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs verklaren dat ze geen concurrerende financiële belangen hebben.

Acknowledgments

Dit werk werd ondersteund door Consejo Nacional de Ciencia en Tecnología, CONACYT, México (subsidie ​​nummer 154833) en Universidad Nacional Autónoma de México. De auteurs bedanken Víctor González, Rosa I. Santamaría, Patricia Bustos en Soledad Juárez voor hun administratief en technisch advies.

Materials

Name Company Catalog Number Comments
Platinum Taq DNA polymerase High Fidelity Thermo Fisher 11304011 Produces a mix of blunt/3’-A overhang ended PCR products
High pure plasmid isolation kit Roche 11754785001 Used for all plasmid purification reactions
High pure PCR product purification kit Roche 11732676001 Used for all PCR purification reactions from agarose gels
AflII restriction enzyme New England Biolabs R0520L Recognizes sequence 5’-CTTAAG-3’ and cuts at 37 °C
KpnI-HF restriction enzyme New England Biolabs R3142L Recognizes sequence 5’-GGTACC-3’ and cuts at 37 °C
SpeI-HF restriction enzyme New England Biolabs R3133L Recognizes sequence 5’-ACTAGT-3’ and cuts at 37 °C
XbaI restriction enzyme New England Biolabs R0145L Recognizes sequence 5’-TCTAGA-3’ and cuts at 37 °C
Ampicillin sodium salt Sigma Aldrich A0166-5G Antibiotics
Nalidixic acid Sigma Aldrich N8878-5G Antibiotics
Yeast Extract Sigma Aldrich Y1625-1KG Bacterial cell culture
Casein peptone Sigma Aldrich 70171-500G Bacterial cell culture
NaCl Sigma Aldrich S9888-1KG Sodium chloride
Agar Sigma Aldrich 05040-1KG Bacterial cell culture
XbaI restriction enzyme Thermo Fisher FD0684 Fast digest XbaI enzyme
KpnI restriction enzyme Thermo Fisher FD0524 Fast digest KpnI enzyme
Quick Ligation Kit New England Biolabs M2200S Fast DNA ligation kit
AflII restriction enzyme Thermo Fisher FD0834 Fast digest AflII enzyme
SpeI restriction enzyme Thermo Fisher FD1253 Fast digest SpeI enzyme

DOWNLOAD MATERIALS LIST

References

  1. Horton, R. M., Hunt, H. D., Ho, S. N., Pullen, J. K., Pease, L. R. Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene. 77, (1), 61-68 (1989).
  2. Vos, M. J., Kampinga, H. H. A PCR amplification strategy for unrestricted generation of chimeric genes. Anal. Biochem. 380, (2), 338-340 (2008).
  3. Hawkins, N. C., Garriga, G., Beh, C. T. Creating Precise GFP Fusions in Plasmids Using Yeast Homologous Recombination. Biotechniques. 34, (1), 1-5 (2003).
  4. Sander, J. D., Joung, J. K. CRISPR-Cas systems for editing, regulating and targeting genomes. Nat Biotechnol. 32, (4), 347-355 (2014).
  5. Nagy, A. Cre recombinase: The universal reagent for genome tailoring. Genesis. 26, (2), 99-109 (2000).
  6. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods. 6, (5), 343-345 (2009).
  7. Norrander, J., Kempe, T., Messing, J. Construction of improved M13 vectors using oligodeoxynucleotide-directed mutagenesis. Gene. 26, (1), 101-106 (1983).
  8. Gruber, T. M., Gross, C. A. Multiple sigma subunits and the partitioning of bacterial transcription space. Annu Rev Microbiol. 57, 441-466 (2003).
  9. Edgar, R. C. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 32, (5), 1792-1797 (2004).
  10. Macrogen Inc. Seoul, Rep. Of Korea. Available from: http://dna.macrogen.com/eng/index.jsp (2016).
  11. Chevreux, B. MIRA: an automated genome and EST assembler. Available from: http://www.chevreux.org/thesis/index.html 1-161 (2005).
  12. Thompson, J. D., Gibson, T. J., Higgins, D. G. Multiple sequence alignment using ClustalW and ClustalX. Curr Protoc Bioinformatics. Chapter 2 (Unit 2.3) 1-22 (2002).
  13. Sambrook, J., Russell, D. W. Molecular Cloning: A laboratory manual. CSHLP. (2001).
  14. Rutherford, K., et al. Artemis: sequence visualization and annotation. Bioinformatics. 16, (10), 944-945 (2000).
CAPRRESI: Chimera Assembly Door Plasmide Recovery En Restriction Enzyme Site Insertion
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Santillán, O., Ramírez-Romero, M. A., Dávila, G. CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion. J. Vis. Exp. (124), e55526, doi:10.3791/55526 (2017).More

Santillán, O., Ramírez-Romero, M. A., Dávila, G. CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion. J. Vis. Exp. (124), e55526, doi:10.3791/55526 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter