Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

CAPRRESI: כימרה האסיפה על ידי פלסמיד השחזור והגבלת אנזים האתר הכנס

doi: 10.3791/55526 Published: June 25, 2017

Summary

כאן, אנו מציגים כימרה הרכבה על ידי התאוששות פלסמיד והגבלת אנזים האתר הכניסה (CAPRRESI), פרוטוקול המבוסס על החדרת אתרי אנזים הגבלה לתוך רצפי DNA נרדף התאוששות פלסמיד פונקציונלי. פרוטוקול זה הוא שיטה מהירה בעלות נמוכה עבור מיזוג גנים מקודדים חלבונים.

Abstract

כאן, אנו מציגים כימרה הרכבה על ידי התאוששות פלסמיד והגבלה אנזים האתר הכניסה (CAPRRESI). יתרונות CAPRRESI מכוחות רבים של שיטת ההתאוששות הפלסמידית המקורית ומציג עיכול אנזים הגבלה כדי להקל על תגובות קשירת DNA (נדרש הרכבה כימרה). עבור פרוטוקול זה, משתמשים שיבוט wildtype גנים לתוך פלסמיד זהה (pUC18 או pUC19). לאחר הבחירה סיליקו של רצף חומצות אמינו אזורים שבהם chimeras צריך להיות התאספו, משתמשים לקבל את כל רצפי DNA נרדף לקודד אותם. אד סקריפטים Perl לאפשר למשתמשים לקבוע את כל רצפי DNA נרדף. לאחר שלב זה, עוד סקריפט Perl מחפש אתרי אנזים הגבלה על כל רצפי DNA נרדף. זה ניתוח סיליקו מבוצע גם באמצעות הגן עמיד ampicillin ( ampR ) נמצא על pUC18 / 19 פלסמידים. משתמשים בעיצוב oligonucleotides בתוך אזורים נרדפים לשבש wildtype ו ampR גנים על ידי PCR. לאחר קבלתAining ו טיהור שברי דנ"א משלימים, עיכול אנזים הגבלה הושלמה. כימרה הרכבה מושגת על ידי ligating מתאים משברים דנ"א משלימים. PUC18 / 19 וקטורים נבחרים עבור CAPRRESI כי הם מציעים יתרונות טכניים, כגון גודל קטן (2,686 זוגות זוג), מספר עותק גבוה, תכונות תגובה רצף יתרון, וזמינות מסחרית. השימוש אנזימים הגבלת הרכבה כימרה מבטלת את הצורך פולימרים DNA המניבים מוצרים קהה- End. CAPRRESI היא שיטה מהירה וזולה עבור מיזוג גנים המקודדים חלבונים.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

הרכבה גנטית Chimeric כבר בשימוש נרחב בביולוגיה מולקולרית כדי להבהיר פונקציה חלבון ו / או למטרות ביוטכנולוגיות. קיימות שיטות שונות עבור גנים התכה, כגון חפיפה PCR הגברה המוצר 1 , התאוששות פלסמיד 2 , רקומבינציה הומולוגיים 3 , CRISPR-Cas9 מערכות 4 , מכוונת רקומבינציה 5 , ו Gibson הרכבה 6 . כל אחד מהם מציע יתרונות טכניים שונים; לדוגמה, את הגמישות של עיצוב PCR חופפים, את הבחירה vivo של קונסטרוקציות במהלך התאוששות פלסמיד, או היעילות הגבוהה של מערכות CRISPR-Cas9 ו גיבסון. מצד שני, כמה קשיים יכולים להתעורר בעת ביצוע כמה שיטות אלה; לדוגמה, שתי הגישות הראשונות מסתמכות על שברי דנ"א קהים, ו קשירה של סוגים אלה של מוצרים יכול להיות מאתגר מבחינה טכנית לעומת sticKy- הסתיים קשירת. ריאקומבינציה מכוונת אתר יכולה להשאיר עקבות של רצפי DNA נוספים (scars) על המקור, כמו במערכת CreloxP 5 . CRISPR-Cas9 יכול לפעמים לשנות אזורי גנום אחרים בנוסף לאתר היעד 4 .

כאן, אנו מציגים את ההרכבה של כימאים על ידי התאוששות פלסמידית והגבלת כניסה לאנזימים באתר (CAPRRESI), פרוטוקול להרכבת גנים המקודדים חלבונים המשלבים את שיטת ההתאוששות הפלסמידית (PRM) עם החדרת אתרי אנזים מגבילים על רצפי DNA נרדפים, . כדי להבטיח שלמות חומצות אמינו רצף, אתרי אנזים הגבלה מוכנסים על רצף דנ"א נרדף מתיחה. בין היתרונות של CAPPRESI ניתן לעשות זאת באמצעות ריאגנטים רגילים של מעבדה / כלים ( למשל , אנזימים, תאים מוסמכים, פתרונות, ו thermocycler) וכי הוא יכול לתת תוצאות מהירות (כאשר האנזימים המתאימים משמשים). הסתמכות על הגבלהאתרי האנזים המגיעים מרצפי DNA נרדפים יכולים להגביל את הבחירה של נקודות ההיתוך המדויקות בתוך החלבונים המעניינים. במקרים כאלה, גנים היעד צריך להיות התמזגו באמצעות oligonucleotides חופפים, אתרי הגבלת אנזים צריך להיות מוכנס אל הגן ההתנגדות של וקטור.

CAPRRESI מורכב שבעה שלבים פשוטים ( איור 1 ): 1) הבחירה של וקטור שיבוט, pUC18 או pUC19 6 ; 2) בניתוח סיליקו של sequtyences wildtype להיות התמזגו; 3) בחירה של אזורים שבירת הרכבה כימרה ו הפרעה פלסמיד; 4) בדור סיליקו של רצפי דנ"א נרדפים המכילים אתרי אנזים מגבילים; 5) שיבוט עצמאי של הגנים wildtype לתוך הפלסמיד הנבחר; 6) הפרעה פלסמיד ידי PCR, ואחריו הגבלת אנזים אכול; ו 7) התאוששות פלסמיד באמצעות קשירת דנ"א שינוי בקטריאלי. גנים Chimeric המיוצרים על ידי טכניקה זו צריך להיות מאומת wIth רצף.

PUC18 / 19 וקטורים מציעים יתרונות טכניים עבור שיבוט ו כימרה הרכבה, כגון גודל קטן ( כלומר, 2,686 זוגות זוג), מספר עותק גבוה, תכונות תגובה רצף יתרון, וזמינות מסחרית 7 . כאן, המארח Escherichia coli שימש כדי להרכיב ולטפל chimeras כי תרבויות חיידקים זולים לגדול מהר. בהתחשב בכך, שיבוט הבאים של שברי היתוך לתוך פלסמידים היעד הסופי יהיה צורך ( למשל, וקטורים ביטוי כמו pRK415 בחיידקים או pCMV בתאי יונקים).

CAPRRESI נבדק עבור מיזוג שני גנים עיקריים גורם sigma: E. colirpoD ו Rhizobium etlisigA . גורמי סיגמא ראשוניים הם יחידות RNA פולימראז האחראיות ליזום שעתוק, והם מורכבים מארבעה תחומים ( כלומר , σ1, σ2, σ3 ו- σ4) 8 . רצף חומצות האמינו lengtH של חלבונים המקודדים על ידי rpoD ו sigA הם 613 ו 685, בהתאמה. RpoD ו SigA לשתף 48% זהות (98% כיסוי). גורמי הסיגמא העיקריים הללו נחלקו לשני חלקים משלימים בין אזורים σ2 ו- σ3. שני גנים chimeric התאספו על פי עיצוב זה: כימרה 01 (RpoDσ1-σ2 + SigAσ3-σ4) ו chimera 02 (SigAσ1-σ2 + RpoDσ3-σ4). מוצרים היתוך דנ"א אומתו על ידי רצף.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. פרוטוקול CAPRRESI

הערה: איור 1 מייצג את פרוטוקול CAPRRESI הכולל. טכניקה זו מבוססת על עיצוב סיליקון הבנייה הבאים של chimeras הרצוי.

  1. בחירה של שיבוט פלסמיד, pUC18 או pUC19.
    1. בחר את וקטור pUC המתאים ביותר דרישות טכניות.
      הערה: לשני הווקטורים יש אותו רצף, למעט הכיוון של אתר השיבוט הרב. זה חשוב עבור העיצוב של oligonucleotides ואת הפרעת פלסמיד PCR.
  2. בניתוח סיליקו של גנים wildtype ו pUC18 / 19 sequences.
    1. השג את רצפי הדנ"א של הגנים wildtype ושמור אותם בקובץ פורמט FASTA ( לדוגמה, genes.fas).
      הערה: רצפים של pUC18 / 19 וקטורים הכלולים בקובץ pUC.fas ( איור 1 , שלב 1).
    2. לקבוע איזו הגבלה אנזYmes לא לחתוך את הגנים wildtype ו pUC18 / 19 sequences על ידי הפעלת סקריפט REsearch.pl. לחלופין, לבצע הגבלת אנזים חיפוש באתר עם כלי מקוון ( איור 1 , שלב 2).
      1. הקלד את הפרטים הבאים במסוף:
        פרל research.pl genes.fas
        פרל
        הערה: פקודות אלה תיצור את קבצי הפלט הבאים: genes_lin.fas, genes_re.fas, pUC_lin.fas ו- pUC_re.fas.
      2. בחר את אנזימי ההגבלה המתאימים לשיבוט הגנים wildtype לתוך האתר שיבוט מרובים של הנבחר pUC18 / 19 וקטור על ידי השוואת genes_re.fas ו pUC.fas קבצים. בחר את הכיוון של הכנס ביחס לגן עמיד ampicillin ( ampR ) של וקטור pUC18 / 19.
    3. עיצוב קדימה oligonucleotides הפוך כדי להגביר את אזור קידוד של גנים wildtype (oligonucleotides חיצוני). כלול את הגנתי הנכון אנזים באתר בכל קצה 5 'של אוליגונוקליוטידים; זה יגדיר את הכיוון להוסיף.
      1. כלול אתר פונקציונלי ריבוזום מחייב oligonucleotides קדימה.
      2. הכנס את שני גנים wildtype באותו כיוון בתוך וקטור.
  3. בחירה של אזורי שבירה עבור הרכבה כימרה ו הפרעה פלסמיד.
    1. השג את רצף חומצות האמינו של wildtype ואת הגנים ampR על ידי הפעלת scriptate.pl script ( איור 1 , שלב 3).
      1. הקלד את הפרטים הבאים במסוף:
        פרל translate.pl genes.fas
        פרל translate.pl ampR.fas

        הערה: סקריפט זה ייצור את קבצי הפלט הבאים: genes_aa.fas ו- ampR_aa.fas.
    2. גלובלי ליישר את שני wildtype רצפי חומצות אמינו עם תוכנה מתאימה ( למשל, MUSCLE) 9 .
    3. בחר את אזורי הפסקה הרצוי (3-6 חומצות אמינו) עבור כימרה כימיתMbly מבוסס על יישור רצף. שמור אותם בקובץ בפורמט FASTA ( למשל , אזורים.).
    4. אתר את רצפי ה- DNA כי הקוד עבור חומצת האמינו שנבחרה משתרע על שני גנים wildtype.
  4. בדור סיליקו של רצפי דנ"א נרדפים המכילים אתרי אנזים מגבילים.
    1. השג את כל רצפי דנ"א נרדף כי קוד עבור כל רצף חומצת אמינו שנבחרו אזורי שבירת ( איור 1 , שלב 4); רצפים אלה נשמרו בקובץ region.fas.
      1. הקלד את הפרטים הבאים במסוף:
        פרל synonym.pl region.fas
        הערה: סקריפט זה ייצור את קובץ הפלט region_syn.fas.
    2. חפש אתרי הגבלת אנזים שנמצאו על רצפי DNA נרדפים.
      1. הקלד את הבא לתוך מסוף:
        הערה: סקריפט זה ייצור את קובץ הפלט region_syn-re.fas.
    3. בחר אנזים הגבלה אחת משותפת בין רצפים נרדפים של שני גנים wildtype; אתר זה ישמש להרכבת כימורות באמצעות עיכול אנזים הגבלה. ודא כי אנזים הגבלה הנבחר לא לחתוך את הגנים wildtype ולא רצפים וקטור pUC18 / 19.
      1. השווה את אנזימי ההגבלה שנמצאו על genes_re.fas, pUC_re.fas, ו- region_syn-re.fas קבצים.
    4. ב סיליקו תחליף את המקור עבור רצפי DNA שלהם נרדף ב loci המקביל על שני גנים wildtype. צרף רצפי DNA נרדפים לקובץ הרצף wildtype (genes.fas).
    5. קבל את רצף חומצות האמינו של הגנים הכלולים בקובץ genes.fas ( genl.fas perl translate.pl ).
    6. ישר את רצפי חומצות האמינו מתורגמים מ wildtype ו sequences DNA נרדף. ודא ששני הרצפים זהים.
    7. חזור על כל השלבים של סעיף זה עם הגן ampR הנוכחי על puC18 / 19 וקטור.
      הערה: המטרה היא לשבש את הגן ampR (קובץ ampR.fas) לשני חלקים משלימים. אנזים הגבלה שנבחרה כדי לשבש את הגן ampR צריך להיות שונה מזה המשמש הרכבה כימרה.
  5. שיבוט עצמאי של שני גנים wildtype לתוך הנבחר pUC18 / 19 וקטור (איור 1, שלב 3).
    1. לטהר את הדנ"א pUC18 / 19 פלסמיד נבחר באמצעות ערכת טיהור DNA פלסמיד.
      1. לדוגמה, להפוך E. coli DH5α עם pUC18 פלסמיד ולגדול את transformants לילה ב 37 מעלות צלזיוס על מוצק LB-0.3 מ"ג / מ"ל ​​אמפיצילין (Amp). בחר מושבה המרה, לחסן חדש LB-0.3 מ"ג / מ"ל ​​צלחת Amp, ולגדול אותו לילה ב 37 מעלות צלזיוס.
      2. לקחת חלק בתרבות הקודמת לגדל אותו LB נוזלי 0.3 מ"ג / מ"ל ​​אמפר עבור 6-8 שעות ב 37 ° C. חלץ את ה- DNA פלסמיד באמצעות ערכת.
    2. PCR להגביר גנים wildtype מן הדנ"א הגנומי הכולל באמצעות appropOligonucleotides חיצוני להונות - -. השתמש פולימרז DNA באיכות גבוהה אם אפשר. בחר את הפולימרז DNA אשר ממקסם את התשואה. בצע PCR על פי הנחיות היצרן ואת טמפרטורת ההיתוך של oligonucleotides.
      1. הפעל מחזורי PCR, בהתאם פולימראז DNA, גודל amplicon, תבנית, ו oligonucleotides בשימוש. לדוגמה, כדי להגביר את ה- DNA RPOD , להכין תגובה 50 μL: 5 μL של חיץ 10x, 2 μL של 50 מ"מ MgSO 4 , 1 μL של 10 mM dNTP לערבב, 2 μL של כל oligonucleotide 10 מיקרומטר (טבלה 2), 2 ΜL של ה- DNA תבנית ( E. קולי DH5α סך DHNA), 35.8 μL של מים טהור במיוחד, 0.2 μL של פולימרז DNA גבוהה נאמנות. הפעל את מחזורי ה- PCR הבאים: 1 דקות ב 94 מעלות צלזיוס עבור denaturation הראשונית ואחריו 30 מחזורים של הגברה (30 s ב 94 מעלות צלזיוס כדי להכחיש, 30 s ב 60 מעלות צלזיוס כדי anneal oligonucleotides, ו 2 דקות ב 68 מעלות צלזיוס להרחיב).
      2. ממיסים 1.2 גרם שלAgarose ב 100 מ"ל של מים מזוקקים פעמיים על ידי חימום אותם במיקרוגל. להרכיב מגש ג'ל מסרק ולשים אותם גלגלית ג'ל אופקי. ממלאים את מגש ג'ל עם פתרון agarose מומס ולתת לו לחזק. הסר את המסרק.
      3. מניחים את הג'ל לתוך תא אלקטרופורזה. מילוי קאמרית עם חיץ 1x Tris-acetate-EDTA. טען 50 μL של מוצרי PCR לתוך בארות ג'ל. Electrophorese דגימות ( למשל , ב 110 V עבור 1 שעות).
      4. לאחר אלקטרופורזה, הכתם ג 'ל ב 100 מ"ל של מים מזוקקים המכילים 100 μL של 1 מ"ג / מ"ל ​​ethidium פתרון ברומיד במשך 10 דקות עם רעד איטי. לשטוף את הג'ל במים מזוקקים במשך עוד 10 דקות בהילוך איטי; השתמש שייקר אופקי.
        זהירות: ethidium bromide הוא תרכובת רעילה; ללבוש כפפות מגן ומעיל כותנה.
      5. לטהר DNA wildpepe הגן מן הלהקות המקביל של ג'ל באמצעות ערכת. לדמיין את להקות ידי הצבת ג'ל מוכתם בתא UV (אורך גל מומלץ: 300 ננומטר). שמור על החשיפה של הג'ל למינימום. השתמש ערכת טיהור DNA ופעל לפי הוראות היצרן.
        זהירות: קרינת UV מסוכנת; ללבוש מגן מגן, משקפיים ומעיל כותנה.
    3. תקציר גנים מטוהרים wildtype ו pUC18 / 19 DNA פלסמיד עם אנזימים הגבלה על פי הוראות היצרן. השתמש אנזימים עיכול מהיר כאשר אפשרי. לדוגמה, לעכל 6 μL של DNA pUC18 (300 ng / μL) ב 10 μL של מים ultrapure, 2 μL של חיץ 10X, 1 μL של אנזים KPn אני הגבלה, ו 1 μL של אנזים אני מגביל I. השאירו את התגובה ב 37 מעלות צלזיוס למשך 30 דקות.
      1. להשבית את אנזימי הגבלה על פי הנחיות היצרן. לדוגמה, לבטל את התגובה העיכול פעמיים Kpn אני- XBA אני ב 80 מעלות צלזיוס במשך 5 דקות.
    4. מערבבים להוסיף: DNA וקטור ב rati volumetricO של 3: 1. בצע את הוראות היצרן עבור התגובה קשירת. השתמש אנזימים קשירת מהיר כאשר אפשרי (להשאיר את התגובה ב 25 מעלות צלזיוס למשך 10 דקות).
      הערה: בדרך כלל, ריכוז ה- DNA לאחר טיהור באמצעות ערכות טוב מספיק עבור עיכול התגובות קשירת. לדוגמה, להוסיף 6 μL של דנ"א rpoD ( Kpn אני- XBA אני, 150 ng / μL), 3 μL של DNA pUC18 ( Kpn אני- XBA אני, 150 ng / μL), 10 μL של חיץ 2x, 1 μL של ultrapure מים, ו 1 μL של ליגז DNA T4. השאירו תגובה קשירת ב 25 מעלות צלזיוס למשך 10 דקות.
    5. להפוך את E. coli DH5α עם μL 2-4 של התגובה קשירת, כמתואר בחומרים משלימים. פלייט התאים הופכים ללוחות מוצקים LB / Amp / X-gal / IPTG. השאירו את הצלחות לילה ב 37 מעלות צלזיוס.
    6. בחר בצבע לבן מושבות E. coli מושבות להכות אותם על צלחת LB / Amp חדש. השאירו את הצלחות בן לילה ב 37 מעלות צלזיוס/ Li>
    7. בצע המושבה PCR לבחור מועמדים עבור רצף התגובה, כמתואר בחומרים משלימים. חלץ DNA פלסמיד מן המועמדים. לחלופין, לעכל DNA פלסמיד מועמד עם אנזימים הגבלה אותו משמש שיבוט מוסיף.
    8. רצף מועמדים קונסטרוקציות עם ספק שירות רצף 10 . להרכיב את רצף סיליקו באמצעות אסמבלר DNA 11 ( איור 1 , שלב 5).
  6. פלסמיד הפרעה על ידי PCR ואחריו הגבלת אנזים אכול.
    1. עיצוב סיליקון קדימה ואוליגונוקליוטידים הפוכה באזורים הפסקה עבור wildtype ו ampR גנים, בהתאמה. תחליף סיליקו קטע wildtype עבור רצף DNA המקביל שלו המקביל (שהושג בשלב 1.4).
      הערה: רצף DNA זה נרדף מכיל אנזים הגבלת האתר. קדימה ואוליגנוקליוטידים הפוכה חפיפה ב tהוא הגבלת אנזים האתר. Oligonucleotides צריך לנוע בין 21-27 נוקלאוטידים, בסופו של דבר עם ציטוזין או גואנין, ומכילים אתר אנזים הגבלה. אולגונוקליוטידים קדימה יש את אותו רצף כמו אזור היעד שלה על ה- DNA תבנית. A olononucleotide הפוך הוא רצף משלים לאחור של אזור היעד על ה- DNA תבנית.
    2. השתמש בשני מבני הגן wildtype כמו תבנית ה- DNA עבור תגובות PCR ( למשל, pUC18 rpoD ו pUC18 sigA ). השג שני חלקים משלימים של כל בנייה (pUC18 rpoD σ1-σ2, pUC18 rpoD σ3-σ4, pUC18 siga σ1-σ2, ו pUC18 siga σ3-σ4) ( איור 1 , שלב 6).
    3. טען דגימות DNA לתוך ג'ל agarose 1-1.2% [w / v]. להפריד את מוצרי ה- PCR מתבנית ה- DNA על ידי אלקטרופורזה ( למשל, 110 V עבור 1 שעות). לחלופין, לעכל את תגובות ה- PCR עם Dnn אני לשבור את תבנית ה- DNA.
      הערה: Dpnאנזים מזהה רק רצפי דנ"א מתילתיים (5'-GATC-3).
      1. לטהר את דגימות באמצעות ערכת טיהור DNA. בצע את ההנחיות של היצרן.
    4. עיכול כפול כל שברי דנ"א משלימים עם אנזימים הגבלה המתאימה על פי הוראות היצרן. השתמש אנזימים הגבלת מהיר לעכל כאשר אפשרי. לדוגמה, פעמיים לעכל את קטע pUC18rpoDσ1-σ2 DNA עם Afl II ו Spe אני משתמש בפרוטוקול של היצרן. השאירו את התגובה העיכול ב 37 מעלות צלזיוס למשך 15 דקות.
    5. להשבית את אנזימי הגבלה על פי הנחיות היצרן. לדוגמה, להשבית Afl II- אני מדבר על 80 מעלות צלזיוס למשך 20 דקות.
  7. פלסמיד התאוששות באמצעות קשירת דנ"א שינוי בקטריאלי.
    1. מערבבים את שברי דנ"א תקין ביחס 1: 1 volumetric להרכיב את הגן chimeric הרצוי ( איור1, שלב 7).
      הערה: בדרך זו, שלמות הגן ampR משוחזר, לייצר חלבון פונקציונלי.
      1. לדוגמה, לערבב 4 μL של pUC18 rpoD σ1-σ2 דנה (מתעכל עם אפל II- אני מדבר , 150 ng / μL), 4 μL של pUC18 sigA σ3-σ4 דנ"א (אפל II- אני, 150 ng / μL) 10 μL של חיץ 2x, 2 μL של מים ultrapure, ו 1 μL של ליגז DNA T4; ריכוז ה- DNA לאחר טיהור ערכת הוא טוב מספיק לעיכול קשירת הבאים. השאירו את התגובה קשירת על 25 מעלות צלזיוס למשך 10 דקות.
    2. המרה E. DH5α coli עם μL 3-5 של התגובה כימה הרכבה קשירת (חומרים משלימים). לגדל את התאים המרה ב LB / Amp / X-gal / צלחות IPTG לילה ב 37 מעלות צלזיוס למשך הלילה.
    3. בחר בצבע לבן מושבות E. coli מושבות להכות אותם על צלחת LB / Amp חדש. השאירו את הצלחות בן 37 ​​בלילה° C.
    4. בצע המושבה PCR לבחור מועמדים לתגובה רצף, כמתואר בחומרים משלימים. דמיינו להקות ב 1-1.2% (w / v) ג'ל agarose ידי ביצוע electrophoresis (המתואר בשלב 2.3.2.1).
    5. לגדל תרבויות ממועמדים חיוביים. חלץ DNA פלסמיד מהם באמצעות ערכת טיהור DNA פלסמיד.

2. רצף המועמד Chimeric קונסטרוקציות

  1. ודא את האיכות של ה- DNA פלסמיד הוא מספיק טוב עבור התגובה רצף על ידי ההנחיות הבאות מתוך ספק השירות רצף. חלץ DNA באמצעות ערכות טיהור. לדוגמה, בדף האינטרנט של ספק השירות רצף, להקדיש תשומת לב מיוחדת ריכוז ה- DNA המומלץ עבור דגימות. השג את הריכוז של דגימות באמצעות מכשיר כימות DNA.
  2. רצף מועמד chimeric קונסטרוקציות עם ספק שירות רצף 10 .
  3. להרכיב se Quencing קורא עם אסמבלר דנ"א סיליקון 11 .
  4. ליישר התאספו לעומת ברצפים chimeric סיליקון מעוצב באמצעות רצף יישור כלים 9 , 12 . ודא כי הגן chimeric היה התמזגו בהצלחה.

3. הכנת ההכנות

הערה: כל השלבים מעורבים תאים חיים צריך להתבצע מכסה המנוע זרימה למינרית נקי עם מבער Bunsen ב.

  1. הפקת E. coli DH5α תאים מוכשרים.
    1. כדי לייצר תאים coli -competent, בצע פרוטוקולים שפורסמו 13 או לראות את החומרים המשלימים . לחלופין, להשתמש בתאים המוסמכים זמין מסחרית.
  2. טרנספורמציה E. coli DH5α תאים מוכשרים.
    1. עבור השינוי הכימי של תרבויות E. coli , בצע פרוטוקולים שפורסמוClass = "xref"> 13 או לראות את החומרים המשלימים . לחלופין, להשתמש electroporation עבור שינוי חיידקי. אם נעשה שימוש בתאים מסחריים זמינים, פעל לפי הנחיות היצרן.
  3. טיהור דנ"א גנומי ופלסמיד מ E. coli DH5α.
    1. ביצוע מיצוי חומצות גרעין, כאמור בחומרים משלימים , באמצעות ערכות זמינים מסחרית או בעקבות פרוטוקולים שפורסמו 13 .
  4. בצע המושבה PCR.
    1. השתמש בטכניקה זו כדי לזהות מועמד מושבות טרנספורמציה לתגובה רצף הבאים.
      הערה: שיטה זו אינה מייצגת אימות סופי של שלמות הרצפים. תיאור מפורט של טכניקה זו זמין חומרים משלימים .
  5. הכנת הפתרונות.
    1. לִרְאוֹת
  6. הורד את הסקריפטים ואת קבצי הרצף הדרושים לפרוטוקול CAPRRESI.
    1. הורדת קבצים בנק גן המכיל את רצף הגנום המלא של המינים הרצוי, לחלץ את רצף ה- DNA של הגן שנבחר באמצעות דפדפן הגנום, ולשמור אותו בפורמט קובץ fasta. הורד את התסריטים של Perl הדרושים לפרוטוקול CAPRRESI. אחסן את הסקריפטים ואת קבצי הרצף באותה ספריה.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

איור 1 מתאר את CAPRRESI. באמצעות שיטה זו, שני גנים chimeric התאספו על ידי החלפת תחומים של שני גורמי סיגמא עיקרי חיידקי ( כלומר, E. coli RpoD ו R. etli SigA). רצפי ה- DNA של גנים rpoD ו sigA התקבלו באמצעות דפדפן Genome Genem 14 מ GenBank קבצים הגנום NC_000913 ו NC_007761, בהתאמה. רצף ה- DNA של וקטור pUC18 התקבל ממסד הנתונים nucleotide של שרת NCBI. בניתוח סיליקו של אתרי אנזים הגבלה נעשו על רצפי דנ"א על ​​ידי הפעלת סקריפט Perl של REsearch.pl (ראה שלב 1.2.2). תוצאות אלו שימשו לתכנון oligonucleotide (שלב 1.2.3). Oligonucleotides חיצוניים כללו אתרי הכרה עבור XBA I ו- Kpn אני אנזימים הגבלה לשכפל gentypepe גנים לתוך האתר pUC18 שיבוט מרובים. את oligonucleotide קדימה כולל גם riboאתר מחייב כלשהו ( טבלה 2 ). הדנ"א הגנומי הופק מ E. תאים coli DH5α גדל LB / Nal מרק (37 ° C, 220-250 סל"ד) ו R. etli תאים CFN42 גדל PY / Nal / CaCl 2 מרק (30 ° C, 220-250 סל"ד ). דגימות אלה שימשו תבניות DNA עבור הגברה הגן wildtype (שלב 1.5.2).

גנים Wildtype היו מוגבר באמצעות פולימרז DNA גבוהה טיק נאמנות, אשר טוהר מ agarose ג'לים (ערכת טיהור DNA), מעוכל פעמיים עם Kpn אני- XBA אנזימים הגבלה, ו משובטים לתוך וקטור pUC18. Chemically המוסמכת E. תאים coli DH5α השתנו עם 5 μL של התגובה קשירת המקביל wildtype קונסטרוקציות pUC18 rpoD ו pUC18 sigA (שלב 1.5.5). תאים Transformant נבחרו על מוצק LB / Amp / X-gal / לוחות IPTG גדל ב 37 מעלות צלזיוס. Wildtype קונסטרוקציות אומתו על ידי סנגר sequenc12 . סנגר רצף קורא היו סיליקון התאספו באמצעות MIRA 11 (שלב 1.5.8).

חומצות אמינו רצפים מן הגנים wildtype התקבלו על ידי הפעלת scriptate.pl script (שלב 1.3.1). לאחר התאמת גנים wildtype עם Clustal 12 , נבחרו אזורי חומצת האמינו TLV ו- NLR בגן ההתנגדות ampicillin ( ampR ) ובגורמי סיגמא בסיסיים של wildtype, בהתאמה (שלב 1.3.3). אזורים אלה חומצת אמינו שימשו לחישוב כל רצפים נרדפים DNA אפשרי לקודד אותם על ידי הפעלת סקריפט synonym.pl (שלב 1.4.1). התסריט REsynonym.pl חיפש אתרי אנזים הגבלה שנמצאו על רצפי DNA נרדף שנוצר קודם לכן (Step1.4.2). אלה אזורים נרדף שהציג את המספר הנמוך ביותר של שינויים לעומת sequtype wildtype נבחרו. עבור גנים גורם סיגמא העיקרי, sequtyences wildtype של RpOD (AACTTACGT) ו- SigA (AACCTTCGC) הוחלפו עבור AA CTTAAG G. האחרון כלל אתר אפל II (מודגש). עבור הגן ampR , רצף wildtype ACGCTGGTG הוחלף עבור שם נרדף שלה, AC ACTAGT G. רצף DNA נרדף מוכנס לתוך הגן ampR הכיל אתר I אני (מודגש). החלפת סיליקו של wildtype עבור רצפים נרדף המקביל נעשו כדי לאמת את השלמות רצף ואת העיצוב oligonucleotide (צעדים 1.2-1.4).

שינויים רצף נרדף הוצגו על ידי PCR באמצעות oligonucleotides המתאים ( טבלה 2 ) ו wildtype קונסטרוקציות כמו תבניות DNA (שלב 1.5.2). התגובות הגברה המיוצרות ארבעה חלקים משלימים: pUC18 rpoD σ1-σ2, pUC18 rpoD σ3-σ4, pUC18 siga σ1-σ2, pUC18 siga σ3-σ4. החלקים המשלימיםקרע לא רק גורמים sigma, אלא גם את הגנים ampr . חלקים משלימים היו מטוהרים באמצעות ערכת טיהור דנ"א (שלב 1.6.3).

אלה משברים דנ"א משלימים היו פעמיים מתעכל עם Afl II ו אני אומר אני אנזימים הגבלה (שלב 1.6.4). על פי עיצוב CAPRRESI, שברי דנ"א pUC18 rpoD σ1-σ2 היה ligated עם pUC18 siga σ3-σ4 להשיג כימרה 01, ו pUC18 siga σ1-σ2 היה ligated עם pUC18 rpoD σ3-σ4 להרכיב כימרה 02 (צעדים 1.7.1-1.7 3). Chemically המוסמכת E. תאים coli DH5α השתנו עם 5 μL של התגובה קשירת של chim01 pUC18 ו pUC18 chim02 (שלב 1.7.4). תאים transformant נבחרו על מוצק LB / Amp / X-gal / IPTG צלחות גדל ב 37 ° C (שלב 1.7.5). מבנים קונסטרוקטיביים אומתו על ידי סנגר רצף 10 (שלב 2). סנגר רצף rEads היו מרוכזים באמצעות MIRA 11 , ואת הקבצים שהתקבלו שלה מופיע בטבלה 3 . איור 2 מציג את היישור (המבוצע באמצעות MUSCLE) 9 של רצפים מורכבים של גנים wildtype ו- chimeric באזורי שבירה.

איור 1
איור 1: סקירה כללית של CAPRRESI. ייצוגים: גנים (חיצים עבים), פלסמידים פונקציונליים (עיגולים סגורים), ואוליגונוקליוטידים (חצים דקים, שחורים מכוונים). אתרי אנזים הגבלה שהוכנסו לאוליגונוקליוטידים מופיעים בצבעים. קיצורים: WT (wildtype), FWD (oligonucleotide קדימה), REV (oligonucleotide הפוך), ampR (ampicillin התנגדות הגן), RES (הגבלת אנזים האתר), RE (אנזים הגבלה). אנא לחץ כאן כדי לראות גדול יותרעל נתון זה.

איור 2
איור 2: יישור של רצפים wildtype מורכב ו chimeric גן. רצפי DNA שנאספו היו מיושרים באמצעות MUSCLE 9 . רצפים הורכבו עם MIRA 11 . רצפים נרדפים מופיעים בשחור. אתר ההכרה של אפל II מופיע בקו תחתון. IUPAC קוד נוקליאוטידים: R (A או G) ו- K (G או T). מבנים: rpoD (אדום), siga (כחול), כימרה 01 רצף ( rpoD σ1-σ2- siga σ3-σ4), ו chimera 02 רצף ( siga σ1-σ2- rpoD σ3-σ4). אנא לחץ כאן כדי להציג גרסה גדולה יותר של דמות זו.

פִּתָרוֹן רכיבים הוראות
כַּמוּת מתחם
Luria-Bertani (LB) מרק 5 גרם תמצית שמרים ממיסים את כל הרכיבים במים. החיטוי. חנות בטמפרטורת החדר עד לשימוש. עבור מוצק LB מרק, להוסיף 15 גרם של אגר bacteriological למתכון.
10 גרם מקרה פפטון
10 גרם NaCl
עד 1 ליטר מים מזוקקים
LB / Amp / X-gal / לוחות IPTG 100 מ"ל מותכת מוצק LB מרק מוסיפים את כל המרכיבים כדי למזג מרק LB. ממלאים צלחות פטרי ומחכים עד שהם יתגברו. בצע שלבים ברדס נקי למינרית נקי עם מבער Bunsen ב.
100 μL Ampicillin (Amp) [100 mg / mL]
100 μL X-gal [20 mg / ml]
50 μL 1 פתרון M IPTG
פפטון שמרים (PY) מרק 3 גרם תמצית שמרים ממיסים את כל הרכיבים במים. החיטוי. חנות בטמפרטורת החדר עד לשימוש. לקבלת מוצק PY מרק, להוסיף 15 גרם של אגר bacteriological למתכון. עבור תרבות etli R., להוסיף 700 μL של 1 M CaCl 2 פתרון לפני השימוש.
5 גרם מקרה פפטון
עד 1 ליטר מים מזוקקים
PY / CaCl 2 / Nal צלחות 100 מ"ל תירס מוצק PY מרק מוסיפים את כל הרכיבים כדי למזג מרק PY. ממלאים את צלחות פטרי לחכות עד שהם לחזק. בצע שלבים ברדס נקי למינרית נקי עם מבער Bunsen ב.
700 μL 1 M CaCl 2 פתרון
100 μL חומצה nalidixic (Nal) [20 mg / mL]
1 M סידן כלוריד (CaCl 2 ) פתרון 11.1 גרם CaCl 2 ממיסים CaCl 2 במים. החיטוי. חנות בטמפרטורת החדר.
עד 100 מ"ל מים מזוקקים
Tris-EDTA (TE) 10: 1 pH 8.0 1 מ"ל פתרון 1 M טריס מערבבים את כל הרכיבים. החיטוי. חנות בטמפרטורת החדר.
400 μL 0.25 M פתרון EDTA
עד 100 מ"ל מים מזוקקים
TE 50:20 pH 8.0 5 מ"ל פתרון 1 M טריס מערבבים את כל הרכיבים. החיטוי. חנות בטמפרטורת החדר/ Td>
8 מ"ל 0.25 M פתרון EDTA
עד 100 מ"ל מים מזוקקים
TE 10: 1 10 mM פתרון NaCl 58.4 מ"ג NaCl ממיסים NaCl ב TE 10: 1. החיטוי. חנות בטמפרטורת החדר.
עד 100 מ"ל TE 10: 1 pH 8.0 פתרון
תמיסת תמוגה 80 מ"ג ליזוזים ממיסים ומערבבים את כל המרכיבים במים. מסנן לעקר באמצעות מסנן 0.22 מיקרומטר. חנות בטמפרטורת החדר.
2 מ"ל 0.5 M גלוקוז פתרון
400 μL 0.5 M EDTA פתרון
500 μL פתרון 1 M טריס
עד 20 מ"ל מים מזוקקים כפולים
לפתרון תמוגה II 1.2 מ"ל 5 M נתרן hydroxide (NaOH) פתרון ממיסים את כל הרכיבים במים. מסנן לעקר באמצעות מסנן 0.22 מיקרומטר. חנות בטמפרטורת החדר.
3 מ"ל 10% נתרן dodecyl סולפט (SDS) פתרון
עד 30 מ"ל מים מזוקקים כפולים
תמיסה תמוגה III 29.4 גרם אשלגן אצטט (CH 3 COOK) ממיסים ומערבבים את כל המרכיבים במים. מסנן לעקר באמצעות מסנן 0.22 מיקרומטר. חנות בטמפרטורת החדר.
11.5 מ"ל חומצה אצטית מוחלטת (CH 3 COOH)
עד 100 מ"ל מים מזוקקים כפולים
1 M מגנזיום כלוריד (MgCl 2 ) פתרון 9.5 גרם MgCl 2 ממיסים MgCl 2 ב wAter. החיטוי. חנות בטמפרטורת החדר.
עד 100 מ"ל מים מזוקקים
3 M סודיום אצטט (CH 3 COONA) פתרון 24.6 גרם CH 3 COA ממיסים CH 3 COONA במים. החיטוי. חנות בטמפרטורת החדר
עד 100 מ"ל מים מזוקקים
10% פתרון SDS 10 גרם SDS ממיסים SDS במים עם סרגל ערבוב מגנטי במהירות נמוכה. החיטוי. חנות בטמפרטורת החדר.
עד 100 מ"ל מים מזוקקים
3 M CH 3 פתרון COOK 29.4 גרם CH 3 קוק ממיסים CH 3 COOK במים. מסנן לעקר באמצעות מסנן 0.22 מיקרומטר. חנות בטמפרטורת החדר. עד 100 מ"ל מים מזוקקים כפולים
פתרון פתרון 5 מ"ג קי ממיסים חלבון K ב TE 50:20 פתרון. מחממים על 37 מעלות צלזיוס למשך 1 שעות. חנות ב -20 מעלות צלזיוס.
עד 1 מ"ל TE 50:20 pH 8.0 פתרון
פתרון RNase 10 מ"ג RNase ממיסים RNase במים. מחממים ב 95 מעלות צלזיוס למשך 10 דקות. חנות ב -20 מעלות צלזיוס.
עד 1 מ"ל מים סטריליזציה מעוקרים
1 M isopropyl-β-D-thiogalactoside (IPTG) פתרון 238.3 מ"ג IPTG ממיסים IPTG במים. מסנן לעקר באמצעות מסנן 0.22 מיקרומטר. חנות ב -20 מעלות צלזיוס.
עד 1 מ"ל מים סטריליזציה מעוקרים
20 מ"ג X-gal ממיסים X-gal במים. מסנן לעקר באמצעות מסנן 0.22 מיקרומטר. חנות ב -20 מעלות צלזיוס.
עד 1 מ"ל מים סטריליזציה מעוקרים
פנול: כלורופורם: אלכוהול isoamyl 24: 24: 1 פתרון 24 מ"ל פנול מערבבים את כל הרכיבים. חנות בבקבוק כתום ענבר ב 4 מעלות צלזיוס. זְהִירוּת! חומר מסוכן. ללבוש משקפי מגן, כפפות כותנה מעבדה כותנה. השתמש ברדס מיצוי. אל תפעיל את מבער בונזן או כל מקור אש אחר במהלך הטיפול. אלטרנטיבי: השתמש פנול מסחרי: כלורופורם: אלכוהול isoamyl 25: 24: 1 פתרון
24 מ"ל כְּלוֹרוֹפוֹרם
1 מ"ל אלכוהול איזואמי
0.5 M גלוקוז פתרון 9 g זק"ג ממיסים גלוקוז במים. מסנן לעקר באמצעות מסנן 0.22 מיקרומטר. חנות בטמפרטורת החדר.
עד 100 מ"ל מים סטריליזציה מעוקרים
0.5 M ethylenediaminetetraacetic חומצה (EDTA) pH 8.0 פתרון 14.6 גרם EDTA ממיסים EDTA במים. התאמת ה- pH עם פתרון 5 Na NaOH. החיטוי. חנות בטמפרטורת החדר.
עד 100 מ"ל מים מזוקקים
0.25 M EDTA pH 8.0 פתרון 7.3 גרם EDTA ממיסים EDTA במים. התאמת ה- pH עם פתרון 5 Na NaOH. החיטוי. חנות בטמפרטורת החדר.
עד 100 מ"ל מים מזוקקים
/ M Tris pH 8.0 פתרון 12.1 גרם טריס ממיסים את טריס במים. התאם את ה- pH עםחומצה הידרוכלורית מוחלטת (HCl). החיטוי. חנות בטמפרטורת החדר.
עד 100 מ"ל מים מזוקקים
5 M נתרן hydroxide (NaOH) פתרון 19.9 גרם NaOH ממיסים NaOH במים. חנות בטמפרטורת החדר. זְהִירוּת! תרכובת קאוסטית.
עד 100 מ"ל מים מזוקקים כפולים
0.1 M NaOH פתרון 399 מ"ג NaOH ממיסים NaOH במים. חנות בטמפרטורת החדר.
עד 100 מ"ל מים מזוקקים כפולים
Nalidixic חומצה (Nal) פתרון המניה 60 מ"ג חומצה nalidixic ממיסים נל במים. מסנן לעקר באמצעות מסנן 0.22 מיקרומטר. חנות ב 4 מעלות צלזיוס.
עד 3 מ"ל 0.1 MNAOH פתרון
אמפיצילין (אמפר) פתרון המניות 300 מ"ג אמפיצילין ממיסים אמפר במים. מסנן לעקר באמצעות מסנן 0.22 מיקרומטר. חנות ב 4 מעלות צלזיוס.
עד 3 מ"ל מים מזוקקים כפולים
10x tris-acetate-EDTA חיץ 48.4 גרם טריס ממיסים את כל הרכיבים במים. החיטוי. חנות בטמפרטורת החדר.
20 מ"ל 0.5 M EDTA פתרון
11.44 מ"ל חומצה אצטית קרחונית
עד 1 ליטר מים מזוקקים

טבלה 1: הכנת פתרונות. הוראות להכנת הכנה.

לא. קוד סדר פעולות אורך (nt) מאפיינים
1 RpoD-FWD GC TCTAGA GA AGAGAGA טאטקאטגאגאאקאקגקגטקה 43 אתר XbaI ; הגברה של גנים של סוג בר ושיבוט וקטורי
2 RoD-REV GGTACC TTAATCGTCCAGGAAGAGACACG 29 אתר KpnI ; הגברה של גנים של סוג בר ושיבוט וקטורי
3 סיגא- FWD GC TCTAGA GA AGAGAGA טאטקאטאגקאקאגאגאגאגאג 43 אתר XbaI ; הגברה של גנים של סוג בר ושיבוט וקטורי
4 SigA-REV GG GACTACC TTAGCTGTCCAGAAAGAGTTTTT </ Td> 29 אתר KpnI ; הגברה של גנים של סוג בר ושיבוט וקטורי
3 Ampr-FWD AC ACTAGT GAAAGTAAAAGAT 21 אתר SpeI מוכנס, מוטציה נרדפת. הפרעה של הגן amper
4 AmpR-REV TCTT GTTTCTGGGTGAG 21 אתר SpeI מוכנס, מוטציה נרדפת. הפרעה של הגן amper
5 Σ2RPD-FWD AA CTAGAG GCTGGTTATTTCTATCGCT 27 אתר אפליי מוכנס, מוטציה נרדפת. בניית chim01-02
6 Σ2RpoD-REV GC CTAGAG TTCGCTTCAACCATCTCTT 27 אתר אפליי מוכנס, מוטציה נרדפת. בניית chim01-02
7 Σ2Siga-FWD AA CTTAAG GCTCGTCATTTCAATCGCC 27 אתר אפליי מוכנס, מוטציה נרדפת. בניית chim01-02
8 Σ2SigA-REV GC CTAGAG TTCGCTTCGACCATTTCCT 27 אתר אפליי מוכנס, מוטציה נרדפת. בניית chim01-02

טבלה 2: רצפים Oligonucleotide. אתרי אנזים הגבלה מופיעים בקו תחתון. אתר מחייב של ריבוזום: מודגש.

בְּנִיָה קובץ רצף קובץ איכות
Chimera01 Chim01_out.unpadded.fasta Chim01_out.unpadded.fasta.qual
Chim01_A3 / B3 / E2 / F2 / G2 /H2.pdf
Chimera02 Chim02_out.unpadded.fasta Chim02_out.unpadded.fasta.qual
Chim02_c3 / d3 / e3 / f3 / g3 / h3.pdf
RpoD Rpod_out.unpadded.fasta Rpod_out.unpadded.fasta.qual
סיגא Siga_out.unpadded.fasta Siga_out.unpadded.fasta.qual

טבלה 3: רצף קבצים שהושגו עם מאסף MIRA ו- DNA ברצף. סנגר רצף קורא מ chimeric קונסטרוקציות wildtype התאספו עם תוכנת MIRA 11 באמצעות אפשרות מיפוי. Chromatograms של רצף כימרה להופיע קבצי PDF.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

CAPRRESI תוכנן כחלופה ל- PRM 2 . PRM המקורי הוא טכניקה חזקה; זה מאפשר את היתוך של רצפי DNA לאורך כל חלק של הגנים שנבחרו. עבור PRM, גנים wildtype צריך להיות משובטים לאותו פלסמיד. לאחר מכן, oligonucleotides נועדו בתוך wildtype ואנטיביוטיקה גנים ההתנגדות נמצא על הפלסמיד. שיבוש פלסמיד מושגת על ידי PCR באמצעות פולימרס DNA, בוטה- DNA, נאמנות גבוהה מתוכננת בעבר oligonucleotides. קשירה של מוצרים משלימים PCR מרכיב גנים chimeric ומשחזר את הקלטת התנגדות אנטיביוטיקה, וכתוצאה מכך התאוששות פלסמיד תפקודית. PRM מאפשר בניית ספריות גן chimeric על רקע פלסמיד זהה. למרבה הצער, קשירת רצפי DNA קהה קהה יכול להיות קשה מבחינה טכנית. כימרה הרכבה על ידי שברי PCR חופפים 1 דורש גם כי פולימריות DNA תשואה בוטה- End מוצרים וטיהור דנ"א עבור כל תגובה. גנים chimeric התאספו על ידי טכניקה זו הם מוצרי DNA לינארית. שיבוט של כל בנייה לתוך וקטור היעד יכול לעכב ניתוח נוסף.

יתרונות CAPRRESI רבים של נקודות החוזק של PRM וגם מפשט את קשירה של שברי דנ"א משלימים באמצעות אתרי הגבלת אנזים על רצף דנ"א רצף אזורים. מסיבות אלה, CAPRRESI אינו דורש פולימרזות בוטה- DNA הסתיים. השימוש רצפים DNA נרדף מגביל אתרי היתוך עבור הרכבה כימרה אבל משפר את קשירת היעילות. שינוי חשוב נוסף הציג CAPRRESI היא כי chimeras הם התאספו ו מטופלים ב pUC18 / 19 וקטורים. אלה וקטורים להחזיק כמה תכונות יתרון, כאמור לעיל. דנ"א Chimeric ניתן להשיג על ידי הפצת וקטור הבנייה ב המארחים coli . שיבוט לאחר מכן של גנים chimeric לתוך פלסמיד הסופי ( למשל , וקטור הביטוי) הוא לפעמיםנדרש.

CAPRRESI גם מסתמך על טיפול בסיליקון של DNA ו רצפי חומצות אמינו. סקריפטים Perl אד הוק מאפשרים את הבחירה של אנזימים הגבלה המתאימים לשכפל גנים wildtype, החישוב של כל רצפי DNA נרדף המקביל לשבור אזורים (עבור הרכבה כימרה), וכן זיהוי של אנזימים הגבלה לפשט התאוששות פלסמיד. בהתחשב בתנאים אלה, CAPRRESI הוא חלופה עבור פיוזינג חלבונים מקודדים גנים. צעדים קריטיים של פרוטוקול CAPRRESI הם: 1) הבחירה של שבירת אזורים 2) טיהור של מוצרי PCR. שבירת האזורים נמתחת שם רצפים נרדפים מחושבים, ייצור אתרי אנזים הגבלה שאינם נמצאים על sequtype wildtype. השימוש של אתרי אנזים הגבלה עבור כימרה הרכבה מבטלת את הצורך פולימריות DNA אשר מניבים מוצרים קהה בוטה ומקלה על התגובה קשירת. לא כל האזורים יהיו שמיש אתרי הגבלה אנזים; FOR זו הסיבה, מומלץ להעביר שבירת אזורים על ידי חומצת אמינו אחת בכל פעם עד למתוח רצף הטוב ביותר נמצא. אם בתכנון סיליקו אינו מאפשר תנועה של האזורים השבורים או רצף משתרע חסר רצפים DNA נרדף עם אתרי הגבלה מתאימים אנזים, מומלץ למזג גנים היעד באמצעות oligonucleotides חופפים להציג רצפי DNA נרדף לתוך הגן התנגדות ampicillin (נמצא על וקטור) בלבד. בדרך זו, הגנים ניתן התמזגו בכל חלק ואת ההתאוששות פלסמיד מסתמך על קשירת של אתר ייחודי אחד (מתעכל עם אנזים רק הגבלה אחת). הגמישות של CAPPRESI מאפשרת את זה להתבצע בשילוב עם טכניקות אחרות.

טיהור של מוצרי ה- PCR מבוצע כדי למנוע דנ"א תבנית, להקטין את הסיכויים של זיהום פלסמיד ההורים לאחר קשירה של שברי DNA משלימים. מילוי שני אלה צעדים קריטיים משפר bacיעילות טרנספורמציה טרלית (מספר מבנים מורכבים כראוי), המאפשר CAPRRESI להתבצע עם או מוכשר כימית (CaCl 2 ) או תאים אלקטרומגנטיים E. coli . הסוג הראשון של תאים מוסמכים מייצג את המקור הזול ביותר של תרבויות E. coli , המועסקים עבור שינוי חיידקי ברוב המעבדות. בגלל כל התכונות שהוצגו בעבר, CAPRRESI מייצג אפשרות שימושית להרכבת chimeras.

יתר על כן, CAPRRESI יכול לעבוד בשילוב עם שברי PCR חופפים או טכניקות התאוששות פלסמיד. לדוגמה, במקום להכניס שני רצפים נרדפים לכל חלק DNA משלים, אזור השבירה הרצוי (על הגנים wildtype היעד) יכול להשתמש oligonucleotides חופפים כדי למזג רצפים מתערבבים. המבוא של רצפים נרדף יכול להיות מוגבל לגן ampR של pUC18 / 19 וקטורים, המוביל לשימוש רק אנזים הגבלה אחת כדי לשחזר plasmiיושרה. אלה יישומים עתידיים יכול לחזק CAPRRESI בכך שהוא מאפשר היתוך של כל סוג של רצפי DNA ( כלומר, לא רק גנים מקודדים קידוד), מבלי להתפשר יעילות קשירת.

על מנת לבדוק את ה- CAPRRESI, שני גורמי סיגמא סימטריים הורכבו על-ידי החלפת אזורים של שני גנים עיקריים של סיגמא: rpoD ( E. coli ) ו- sigA ( R. etli ). כל גורמי הסיגמא העיקריים ידועים להחזיק ארבעה תחומים, σ1 ל σ4 8 . כימרה 01 מורכב RpoDσ1-σ2 ו SigAσ3-σ4, בעוד כימרה 02 יש SigAσ1-σ2 ו RpoDσ3-σ4. היושרה של קונסטרוקציות chimeric אושרה על ידי סנגר רצף 10 ( איור 2 ).

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

המחברים מצהירים כי אין להם אינטרסים פיננסיים מתחרים.

Acknowledgments

עבודה זו נתמכה על ידי Consejo Nacional de Ciencia y Tecnología, CONACYT, México (מענק מס '154833) ו- Universidad Nacional Autonoma de México. המחברים מבקשים להודות לוויקטור גונזלס, לרוזה א. סנטומריה, לפטרישיה בוסטוס ולסולדדאד יוארז על עצהם המינהלית והטכנית.

Materials

Name Company Catalog Number Comments
Platinum Taq DNA polymerase High Fidelity Thermo Fisher 11304011 Produces a mix of blunt/3’-A overhang ended PCR products
High pure plasmid isolation kit Roche 11754785001 Used for all plasmid purification reactions
High pure PCR product purification kit Roche 11732676001 Used for all PCR purification reactions from agarose gels
AflII restriction enzyme New England Biolabs R0520L Recognizes sequence 5’-CTTAAG-3’ and cuts at 37 °C
KpnI-HF restriction enzyme New England Biolabs R3142L Recognizes sequence 5’-GGTACC-3’ and cuts at 37 °C
SpeI-HF restriction enzyme New England Biolabs R3133L Recognizes sequence 5’-ACTAGT-3’ and cuts at 37 °C
XbaI restriction enzyme New England Biolabs R0145L Recognizes sequence 5’-TCTAGA-3’ and cuts at 37 °C
Ampicillin sodium salt Sigma Aldrich A0166-5G Antibiotics
Nalidixic acid Sigma Aldrich N8878-5G Antibiotics
Yeast Extract Sigma Aldrich Y1625-1KG Bacterial cell culture
Casein peptone Sigma Aldrich 70171-500G Bacterial cell culture
NaCl Sigma Aldrich S9888-1KG Sodium chloride
Agar Sigma Aldrich 05040-1KG Bacterial cell culture
XbaI restriction enzyme Thermo Fisher FD0684 Fast digest XbaI enzyme
KpnI restriction enzyme Thermo Fisher FD0524 Fast digest KpnI enzyme
Quick Ligation Kit New England Biolabs M2200S Fast DNA ligation kit
AflII restriction enzyme Thermo Fisher FD0834 Fast digest AflII enzyme
SpeI restriction enzyme Thermo Fisher FD1253 Fast digest SpeI enzyme

DOWNLOAD MATERIALS LIST

References

  1. Horton, R. M., Hunt, H. D., Ho, S. N., Pullen, J. K., Pease, L. R. Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene. 77, (1), 61-68 (1989).
  2. Vos, M. J., Kampinga, H. H. A PCR amplification strategy for unrestricted generation of chimeric genes. Anal. Biochem. 380, (2), 338-340 (2008).
  3. Hawkins, N. C., Garriga, G., Beh, C. T. Creating Precise GFP Fusions in Plasmids Using Yeast Homologous Recombination. Biotechniques. 34, (1), 1-5 (2003).
  4. Sander, J. D., Joung, J. K. CRISPR-Cas systems for editing, regulating and targeting genomes. Nat Biotechnol. 32, (4), 347-355 (2014).
  5. Nagy, A. Cre recombinase: The universal reagent for genome tailoring. Genesis. 26, (2), 99-109 (2000).
  6. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods. 6, (5), 343-345 (2009).
  7. Norrander, J., Kempe, T., Messing, J. Construction of improved M13 vectors using oligodeoxynucleotide-directed mutagenesis. Gene. 26, (1), 101-106 (1983).
  8. Gruber, T. M., Gross, C. A. Multiple sigma subunits and the partitioning of bacterial transcription space. Annu Rev Microbiol. 57, 441-466 (2003).
  9. Edgar, R. C. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 32, (5), 1792-1797 (2004).
  10. Macrogen Inc. Seoul, Rep. Of Korea. Available from: http://dna.macrogen.com/eng/index.jsp (2016).
  11. Chevreux, B. MIRA: an automated genome and EST assembler. Available from: http://www.chevreux.org/thesis/index.html 1-161 (2005).
  12. Thompson, J. D., Gibson, T. J., Higgins, D. G. Multiple sequence alignment using ClustalW and ClustalX. Curr Protoc Bioinformatics. Chapter 2 (Unit 2.3) 1-22 (2002).
  13. Sambrook, J., Russell, D. W. Molecular Cloning: A laboratory manual. CSHLP. (2001).
  14. Rutherford, K., et al. Artemis: sequence visualization and annotation. Bioinformatics. 16, (10), 944-945 (2000).
CAPRRESI: כימרה האסיפה על ידי פלסמיד השחזור והגבלת אנזים האתר הכנס
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Santillán, O., Ramírez-Romero, M. A., Dávila, G. CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion. J. Vis. Exp. (124), e55526, doi:10.3791/55526 (2017).More

Santillán, O., Ramírez-Romero, M. A., Dávila, G. CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion. J. Vis. Exp. (124), e55526, doi:10.3791/55526 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter