Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

CAPRRESI: Assemblaggio chimico mediante inserimento del sito enzimatico di recupero e restrizione di plasmide

doi: 10.3791/55526 Published: June 25, 2017

Summary

Qui presentiamo l'assemblaggio di chimera mediante il recupero del plasmide e l'inserimento del sito enzimatico di restrizione (CAPRRESI), un protocollo basato sull'inserimento di siti di enzimi di restrizione in sequenze di DNA sinonimo e recupero plasmide funzionale. Questo protocollo è un metodo veloce e conveniente per fusione di geni di codifica proteica.

Abstract

Qui presentiamo l'assemblaggio di chimera mediante recupero del plasmide e inserimento del sito enzimatico di restrizione (CAPRRESI). CAPRRESI beneficia di molti punti di forza del metodo originale di recupero del plasmide e introduce la digestione dell'enzima di restrizione per facilitare le reazioni di legatura del DNA (richieste per l'assemblaggio di chimera). Per questo protocollo, gli utenti clonano i geni del wildtype nello stesso plasmide (pUC18 o pUC19). Dopo la selezione in silico di regioni di sequenze di aminoacidi in cui devono essere assemblate le chimere, gli utenti ottengono tutte le sequenze sinonime di DNA che li codificano. Gli script di Perl ad hoc consentono agli utenti di determinare tutte le sequenze di sinonimi del DNA. Dopo questo passaggio, un altro script Perl cerca siti di restrizione enzimatica su tutte le sequenze di DNA sinonimo. Questa analisi in silico viene eseguita anche utilizzando il gene di resistenza dell'ampicillina ( ampR ) trovato sui plasmidi pUC18 / 19. Gli utenti progettano oligonucleotidi all'interno delle regioni sinonime per interrompere i geni wildtype e ampR mediante PCR. Dopo obtL'integrazione e la purificazione di frammenti di DNA complementari, la digestione dell'enzima di restrizione viene completata. L'assemblaggio della chimera è ottenuto legando appropriati frammenti di DNA complementari. I vettori pUC18 / 19 sono selezionati per CAPRRESI perché offrono vantaggi tecnici, come piccole dimensioni (2.686 paia di base), numero di copie elevate, caratteristiche di reazione vantaggiosa di sequenziamento e disponibilità commerciale. L'impiego di enzimi di restrizione per l'assemblaggio di chimere elimina la necessità di DNA polimerasi che producono prodotti blunt-ended. CAPRRESI è un metodo veloce e conveniente per la fusione di geni che codificano proteine.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Il complesso gene chimerico è stato ampiamente utilizzato nella biologia molecolare per chiarire la funzione proteica e / o per scopi biotecnologici. Esistono diversi metodi per la fusione di geni, come la sovrapposizione del prodotto PCR 1 , il recupero del plasmide 2 , la ricombinazione omologa 3 , i sistemi CRISPR-Cas9 4 , la ricombinazione localizzata 5 e l'assemblaggio Gibson 6 . Ognuna di esse offre diversi vantaggi tecnici; Per esempio la flessibilità del disegno PCR sovrapposto, la selezione in vivo di costruzioni durante il recupero del plasmide o l'alta efficienza dei sistemi CRISPR-Cas9 e Gibson. D'altra parte, alcune difficoltà possono sorgere durante l'esecuzione di alcuni di questi metodi; Per esempio, i primi due approcci si basano su frammenti di DNA a sbavature e la legatura di questi tipi di prodotti potrebbe essere tecnicamente impegnativa rispetto a quella di sticLa legatura a chiave. La ricombinazione del sito può lasciare tracce di sequenze di DNA extra (cicatrici) sull'originale, come nel sistema CreoxP 5 . CRISPR-Cas9 può talvolta modificare altre regioni del genoma oltre al sito di destinazione 4 .

Qui introduciamo l'assemblaggio di chimera mediante il recupero del plasmide e l'inserimento del sito enzimatico di restrizione (CAPRRESI), un protocollo per fusione di geni di codifica proteica che combina il metodo di recupero del plasmide (PRM) con l'inserimento di siti di enzimi di restrizione sulle sequenze di DNA sinonimo, migliorando l'efficienza di legame . Per garantire l'integrità della sequenza di aminoacidi, i siti di restrizione enzimatica vengono inseriti in sequenze di DNA sinonimo. Tra i vantaggi di CAPPRESI è che può essere eseguito utilizzando reattivi / strumenti di laboratorio ( es . Enzimi, cellule competenti, soluzioni e termociclatori) e che può dare risultati rapidi (quando vengono utilizzati gli enzimi appropriati). Basandosi sulla restrizioneI siti enzimatici che emergono dalle sequenze di DNA sinonimo possono limitare la selezione dei punti di fusione esatti all'interno delle proteine ​​di interesse. In questi casi i geni bersaglio dovrebbero essere fusi utilizzando oligonucleotidi sovrapposti e siti di enzimi di restrizione dovrebbero essere inseriti sul gene di resistenza del vettore.

CAPRRESI è costituito da sette semplici passaggi ( Figura 1 ): 1) selezione del vettore di clonazione, pUC18 o pUC196; 2) nell'analisi siliconica delle sequenze di wildtype da fusione; 3) selezione di regioni di rottura per l'assemblaggio di chimera e la rottura del plasmide; 4) nella generazione siliconica di sequenze di DNA sinonime contenenti siti di restrizione enzimatica; 5) clonazione indipendente dei geni selvatici nel plasmide selezionato; 6) la rottura del plasmide mediante PCR, seguito da una digestione di enzimi di restrizione; E 7) recupero del plasmide utilizzando la legatura del DNA e la trasformazione batterica. I geni chimici prodotti da questa tecnica dovrebbero essere verificati wIth sequenziamento.

I vettori pUC18 / 19 offrono vantaggi tecnici per la clonazione e l'assemblaggio di chimere, quali piccole dimensioni ( cioè 2686 paia di base), numero di copie elevate, caratteristiche di reazione vantaggiosa di sequenziamento e disponibilità commerciale 7 . Qui un host di coli di Escherichia è stato usato per assemblare e gestire le chimere perché le colture batteriche sono economiche e crescono velocemente. Dato questo, sarà necessaria una successiva clonazione dei frammenti di fusione nei plasmidi target definiti ( ad esempio, vettori di espressione come pRK415 nei batteri o pCMV nelle cellule dei mammiferi).

CAPRRESI è stato testato per fusione di due geni del fattore di sigma primario: E. coliPro e Rhizobium etlisigA . I fattori sigma primari sono le subunità di polimerasi RNA responsabili dell'iniziazione della trascrizione e sono costituiti da quattro domini (σ1, σ2, σ3 e σ4) 8 . La sequenza di aminoacidi si lengtH di proteine ​​codificate da rpoD e sigA sono rispettivamente 613 e 685. RpoD e SigA condividono l'identità del 48% (copertura del 98%). Questi fattori di sigma primario sono stati suddivisi in due frammenti complementari tra regioni σ2 e σ3. Due geni chimerici sono stati assemblati secondo questo disegno: chimera 01 (RpoDσ1-σ2 + SigAσ3-σ4) e chimera 02 (SigAσ1-σ2 + RpoDσ3-σ4). I prodotti di fusione del DNA sono stati verificati mediante sequenziamento.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Protocollo CAPRRESI

NOTA: la Figura 1 rappresenta il protocollo CAPRRESI complessivo. Questa tecnica è basata su un disegno in silico e la successiva costruzione delle chimere desiderate.

  1. Selezione del plasmide di clonazione, pUC18 o pUC19.
    1. Selezionare il vettore pUC che meglio si adatta alle esigenze tecniche.
      NOTA: entrambi i vettori hanno la stessa sequenza, ad eccezione dell'orientamento del sito di clonazione multiplo. Questo è importante per la progettazione di oligonucleotidi e la rottura del plasmide PCR.
  2. In analisi silico dei geni selvatici e delle sequenze pUC18 / 19.
    1. Ottieni le sequenze di DNA dei geni di tipo selvatico e li salva in un file di formato FASTA ( ad esempio, genes.fas).
      NOTA: Le sequenze dei vettori pUC18 / 19 sono contenute nel file pUC.fas ( Figura 1 , passaggio 1).
    2. Determinare quale enzima di restrizioneYmes non tagliano i geni wildtype e le sequenze pUC18 / 19 eseguendo lo script REsearch.pl. In alternativa, eseguire una ricerca di siti di restrizione degli enzimi con uno strumento online ( figura 1 , passaggio 2).
      1. Digitare quanto segue in un terminale:
        Perl REsearch.pl genes.fas
        Perl REsearch.pl pUC.fas
        NOTA: Questi comandi creeranno i seguenti file di output: genes_lin.fas, genes_re.fas, pUC_lin.fas e pUC_re.fas.
      2. Selezionare gli appropriati enzimi di restrizione per la clonazione dei geni di tipo selvatico nel sito di clonazione multiplo del vettore pUC18 / 19 scelto confrontando i file genes_re.fas e pUC.fas. Scegli l'orientamento dell'inserto relativo al gene di resistenza dell'ampicillina ( ampR ) del vettore pUC18 / 19.
    3. Progettare gli oligonucleotidi in avanti e invertire per amplificare la regione di codifica dei geni selvatici (oligonucleotidi esterni). Includere il proprio sito di restrizione enzimatica ad ogni 5 'fineDegli oligonucleotidi; Questo definirà l'orientamento dell'inserto.
      1. Includere un sito funzionale di rilascio dei ribosomi negli oligonucleotidi in avanti.
      2. Inserire entrambi i geni di tipo selvatico nello stesso orientamento all'interno del vettore.
  3. Selezione delle regioni di rottura per l'assemblaggio di chimera e la rottura del plasmide.
    1. Ottieni la sequenza di aminoacidi del wildtype e dei geni ampR eseguendo lo script translate.pl ( Figura 1 , passaggio 3).
      1. Digitare quanto segue in un terminale:
        Perl translate.pl genes.fas
        Perl translate.pl ampR.fas

        NOTA: Questo script creerà i seguenti file di output: genes_aa.fas e ampR_aa.fas.
    2. Allineare globalmente le due sequenze aminoacidiche di tipo selvatico con un software appropriato ( es., MUSCLE) 9 .
    3. Selezionare le regioni di rottura desiderate (3-6 aminoacidi) per l'asse chimeraMbly basata sull'allineamento della sequenza. Salvare in un file in formato FASTA ( ad esempio , regions.fas).
    4. Individuare le sequenze di DNA che codificano per l'amminoacido selezionato si estende su entrambi i geni wildtype.
  4. In silico generazione di sequenze di DNA sinonimo contenenti siti di restrizione enzimatica.
    1. Ottenere tutte le sequenze sinonimo del DNA che codificano per ciascuna sequenza di sequenze di aminoacidi selezionate come aree di rottura ( figura 1 , passaggio 4); Queste sequenze sono state memorizzate nel file region.fas.
      1. Digitare quanto segue in un terminale:
        Perl synonym.pl regions.fas
        NOTA: Questo script creerà il file di output regions_syn.fas.
    2. Cercare siti di enzimi di restrizione trovati sulle sequenze di DNA sinonimo.
      1. Digitare quanto segue in un terminale: perl REsynonym.pl regions_syn.fas
        NOTA: Questo script creerà il file di output regions_syn-re.fas.
    3. Scegliere un enzima di restrizione che è condiviso tra sequenze sinonimi di entrambi i geni di tipo selvatico; Questo sito verrà utilizzato per assemblare chimere attraverso la digestione enzimatica di restrizione. Verificare che l'enzima di restrizione scelto non tagliasse né i geni del wildtype né le sequenze vettoriali pUC18 / 19.
      1. Confronta gli enzimi di restrizione trovati nei file genes_re.fas, pUC_re.fas e regions_syn-re.fas.
    4. In silico sostituiscono gli originali per la loro sinonima sequenza di DNA nei corrispondenti loci su entrambi i geni selvatici. Aggiungi sequenze del DNA sinonimo nel file di sequenza di wildtype (genes.fas).
    5. Ottieni la sequenza di aminoacidi dei geni contenuti nel file genes.fas ( perl translate.pl genes.fas ).
    6. Allineare le sequenze di aminoacidi tradotte da sequenze di DNA selvatiche e sinonime. Verificare che entrambe le sequenze siano le stesse.
    7. Ripetere tutte le fasi di questa sezione con il gene ampR presente sul pUC18 / 19 vettore.
      NOTA: L'obiettivo è quello di interrompere il gene ampR (file ampR.fas) in due parti complementari. L'enzima di restrizione selezionato per interrompere l' ampR gene deve essere diverso da quello utilizzato per l'assemblaggio di chimera.
  5. Clonazione indipendente dei due geni di tipo selvatico nel vettore pUC18 / 19 selezionato (figura 1, fase 3).
    1. Purificare il DNA plasmidico pUC18 / 19 scelto utilizzando un kit di purificazione del DNA plasmidico.
      1. Ad esempio, trasformare E. coli DH5α con il plasmid pUC18 e far crescere i trasformanti per una notte a 37 ° C su ampio ampicillina LB-0,3 mg / mL (Amp). Scegliere una colonia di trasformante, inoculare una nuova piastra di Amp di LB-0,3 mg / mL e farla ricrescere la notte a 37 ° C.
      2. Parte della cultura precedente e farlo in liquido LB-0,3 mg / mL Amp per 6-8 ore a 37 ° C. Estraete il DNA del plasmide usando un kit.
    2. PCR amplificano i geni di tipo selvatico dal DNA genomico totale utilizzando l'appropRiattivano gli oligonucleotidi esterni. Utilizzare una DNA polimerasi ad alta fedeltà se possibile. Selezionare la DNA polimerasi che massimizza il rendimento. Eseguire il PCR secondo le linee guida del produttore e la temperatura di fusione degli oligonucleotidi.
      1. Eseguire cicli PCR, a seconda della DNA polimerasi, delle dimensioni dell'amplicone, del template e degli oligonucleotidi utilizzati. Ad esempio, per amplificare il rpoD DNA, preparare una reazione di 50 μL: 5 μl di tampone 10 volte, 2 μL di 50 mM MgSO4, 1 μl di 10 mM dNTP mix, 2 μL di ogni oligonucleotide da 10 μM (Tabella 2), 2 ΜL del template DNA ( E. coli DH5α totale DNA), 35,8 μL di acqua ultra-pura e 0,2 μL di DNA-polimerasi ad alta fedeltà. Eseguire i seguenti cicli di PCR: 1 min a 94 ° C per la denaturazione iniziale seguita da 30 cicli di amplificazione (30 s a 94 ° C per denaturare, 30 s a 60 ° C per anneare gli oligonucleotidi e 2 min a 68 ° C per estendere).
      2. Sciogliere 1,2 g diAgarosio in 100 ml di acqua doppia-distillata riscaldandoli nel forno a microonde. Montare un vassoio e pettine in gel e metterli nel caster gelato orizzontale. Riempire il vassoio gel con la soluzione di agarosio fuso e lasciarlo solidificare. Rimuovere il pettine.
      3. Posizionare il gel nella camera di elettroforesi. Riempire la camera con un tampone Tris-acetato-EDTA. Caricare 50 μL di prodotti PCR nei pozzetti del gel. Elettroforesi i campioni ( es ., A 110 V per 1 ora).
      4. Dopo l'elettroforesi, macchiare il gel in 100 ml di acqua a doppia distillazione contenente 100 μL di 1 mg / ml di soluzione di bromuro di etidio per 10 min con agitazione lenta. Lavare il gel in acqua doppia distillazione per altri 10 minuti in scuotimento lento; Utilizzare un agitatore orizzontale.
        Attenzione: il bromuro di etido è un composto tossico; Indossare guanti protettivi e un cappotto di laboratorio di cotone.
      5. Purificare il gene DNA selvatico dalle bande corrispondenti del gel utilizzando un kit. Visualizzare le bande inserendo il gel macchiato in una camera UV (Lunghezza d'onda raccomandata: 300 nm). Mantenere l'esposizione del gel al minimo. Utilizzare un kit di purificazione del DNA e seguire le istruzioni del produttore.
        Attenzione: la radiazione UV è pericolosa; Indossare uno scudo protettivo, occhiali e un cappotto di laboratorio di cotone.
    3. Il digest ha purificato i geni selvatici e il plasmid pUC18 / 19 con gli enzimi di restrizione secondo le istruzioni del produttore. Usare digestione veloce quando possibile. Ad esempio, digerire 6 μL di DNA pUC18 (300 ng / μL) in 10 μl di acqua ultrapure, 2 μl di tampone 10X, 1 μl di enzima di restrizione KpnI e 1 μl di enzima di restrizione XbaI . Lasciare la reazione a 37 ° C per 30 min.
      1. Inattivare gli enzimi di restrizione secondo le linee guida del produttore. Ad esempio, inattivare la reazione di digestione Kpn I- Xba I a 80 ° C per 5 min.
    4. Inserire la miscela: DNA vettoriale a una rati volumetricaO di 3: 1. Seguire le istruzioni del produttore per una reazione di ligation. Utilizzare gli enzimi veloci di legatura quando possibile (lasciare la reazione a 25 ° C per 10 minuti).
      NOTA: In genere, la concentrazione del DNA dopo la purificazione usando i kit è abbastanza buona per le reazioni di digestione e di legatura. Ad esempio, aggiungere 6 μl di DNA rpoD ( Kpn I- Xba I, 150 ng / μL), 3 μl di DNA pUC18 ( Kpn I- Xba I, 150 ng / μL), 10 μl di 2x tampone, 1 μL di ultrapure Acqua e 1 μl di ligasi del DNA di T4. Lasciare la reazione di legame a 25 ° C per 10 min.
    5. Trasformare l' E. coli DH5α con 2-4 μL della reazione di ligation, come descritto nei Materiali Supplementari. Piastra le cellule trasformate in lastre LB / Amp / X-gal / IPTG. Lasciare i piatti durante la notte a 37 ° C.
    6. Selezionare colonie di E. coli trasformanti bianche e striarle su una nuova piastra LB / Amp. Lasciare i piatti durante la notte a 37 ° C/ Li>
    7. Eseguire una colonia PCR per scegliere i candidati per la sequenza della reazione, come descritto nei Materiali Supplementari. Estrarre il plasmide DNA dai candidati. In alternativa, digerire il DNA del plasmide candidato con gli stessi enzimi di restrizione utilizzati per la clonazione degli inserti.
    8. Costruzioni di sequenza con un fornitore di servizi di sequenziamento 10 . Assemblare la sequenza in silico usando un assemblatore di DNA 11 ( figura 1 , fase 5).
  6. Interruzione del plasmide da PCR seguito da digestione enzimatica di restrizione.
    1. Progettazione in silico avanti e invertire gli oligonucleotidi in aree di rottura per wildtype e ampR geni, rispettivamente. Sostituire in silico il frammento di tipo selvatico per la sua corrispondente sequenza sinonimo del DNA (ottenuta nel passaggio 1.4).
      NOTA: Questa sequenza di DNA di sinonimo contiene un sito di restrizione enzimatica. Gli oligonucleotidi in avanti e invertire si sovrappongono a tLui sito di restrizione enzima. Gli oligonucleotidi devono variare da 21 a 27 nucleotidi, terminare con una citosina o guanina e contenere un sito di restrizione enzimatica. Un oligonucleotide in avanti ha la stessa sequenza della sua regione target sul DNA del template. Un oligonucleotide inverso è la sequenza complementare inversa della regione bersaglio sul DNA del templato.
    2. Utilizzare le due costruzioni di gene wildtype come il template di DNA per le reazioni PCR ( es . PUC18 rpoD e pUC18 sigA ). Ottenere due parti complementari di ogni costruzione (pUC18 rpoD σ1-σ2, pUC18 rpoD σ3-σ4, pUC18 sigA σ1-σ2 e pUC18 sigA σ3-σ4) ( figura 1 , passaggio 6).
    3. Caricare i campioni di DNA in un gel agarosico 1-1,2% [w / v]. Separare i prodotti PCR dal modello DNA mediante elettroforesi ( ad es. 110 V per 1 ora). In alternativa, digerire le reazioni PCR con Dpn I per rompere il template del DNA.
      NOTA: DpnI enzima riconosce solo sequenze di DNA metilate (5'-GATC-3 ').
      1. Purificare i campioni utilizzando un kit di purificazione del DNA. Seguire le linee guida del produttore.
    4. Doppio digerire tutti i frammenti DNA complementari con gli appropriati enzimi di restrizione secondo le indicazioni del produttore. Utilizzare gli enzimi di restrizione digestivo veloce quando possibile. Ad esempio, duplicare il frammento di DNA pUC18rpoDσ1-σ2 con Afl II e Spe I utilizzando il protocollo del produttore. Lasciare la reazione di digestione a 37 ° C per 15 minuti.
    5. Inattivare gli enzimi di restrizione secondo le linee guida del produttore. Ad esempio, inattiva Afl II- Spe I a 80 ° C per 20 min.
  7. Recupero del plasmide utilizzando la legatura del DNA e la trasformazione batterica.
    1. Mescolare i frammenti corretti del DNA in un rapporto volumetrico 1: 1 per assemblare il gene chimerico desiderato ( Fig1, passo 7).
      NOTA: In questo modo, l'integrità del gene ampR viene ripristinato, producendo una proteina funzionale.
      1. Ad esempio, mescolare 4 μL di DNA pUC18 rpoD σ1-σ2 (digerito con Afl II- Spe I, 150 ng / μL), 4 μL di pUC18 sigA σ3-σ4 DNA ( Afl II- Spe I, 150 ng / 10 μl di 2x tampone, 2 μL di acqua ultrapure e 1 μl di T4 DNA ligasi; La concentrazione del DNA dopo la purificazione del kit è abbastanza buona per la digestione e la successiva legatura. Lasciare la reazione di legatura a 25 ° C per 10 min.
    2. Trasformare E. coli DH5α con 3-5 μL della reazione di ligazione dell'assemblea chimica (Materiali Supplementari). Crescere le cellule trasformanti in piastre LB / Amp / X-gal / IPTG durante la notte a 37 ° C per una notte.
    3. Selezionare colonie di E. coli trasformanti bianche e striarle su una nuova piastra LB / Amp. Lasciare i piatti durante la notte a 37° C.
    4. Eseguire una colonia PCR per scegliere i candidati per una reazione di sequenza, come descritto nei Materiali Supplementari. Visualizzare le fasce in un agarosio 1-1,2% (w / v) eseguendo elettroforesi (descritto nel punto 2.3.2.1).
    5. Crescere le culture dai candidati positivi. Estrarre il DNA del plasmide da loro usando un kit di purificazione del DNA plasmidico.

2. Sequenza Candidate Costruzioni Chimeriche

  1. Assicurarsi che la qualità del DNA del plasmide sia abbastanza buona per la reazione di sequenziamento seguendo le linee guida del fornitore di servizi di sequenza. Estrarre il DNA utilizzando i kit di purificazione. Ad esempio, sulla pagina Internet del fornitore di servizi di sequenza, prestare particolare attenzione alla concentrazione raccomandata del DNA per i campioni. Ottieni la concentrazione di campioni utilizzando uno strumento di quantificazione del DNA.
  2. Costruzioni chimiche candidate sequenza con un fornitore di servizi di sequenziamento 10 .
  3. Assemblare La quencing legge con un assembler di DNA in silico 11 .
  4. Allineare le sequenze chimeriche assemblate rispetto a silico , utilizzando gli strumenti di allineamento delle sequenze 9 , 12 . Verificare che il gene chimerico sia stato fuso con successo.

3. Preparazione

NOTA: tutti i passaggi che coinvolgono cellule viventi devono essere eseguite in un cappuccio flusso laminare pulito con il bruciatore di Bunsen acceso.

  1. Produzione di cellule E. coli DH5α-competenti.
    1. Per produrre cellule E. coli -competenti, seguire i protocolli pubblicati 13 o vedere i Materiali Supplementari . In alternativa, utilizzare celle competenti commercialmente disponibili.
  2. Trasformazione di cellule competenti di E. coli DH5α.
    1. Per la trasformazione chimica delle colture E. coli , seguire i protocolli pubblicatiClass = "xref"> 13 o vedere i Materiali Supplementari . In alternativa, utilizzare l'elettroporazione per la trasformazione batterica. Se vengono utilizzate celle competenti commercialmente disponibili, seguire le linee guida del produttore.
  3. Purificando il DNA genomico e plasmidico da E. coli DH5α.
    1. Eseguire l'estrazione dell'acido nucleico, come indicato nei Materiali Supplementari , utilizzando kit disponibili in commercio o seguendo protocolli pubblicati 13 .
  4. Eseguire PCR colonia.
    1. Utilizzare questa tecnica per identificare le colonie del trasformante candidato per la successiva reazione di sequenza.
      NOTA: Questo metodo non rappresenta una verifica finale dell'integrità delle sequenze. Una descrizione dettagliata di questa tecnica è disponibile nei Materiali Supplementari .
  5. Preparazione delle soluzioni.
    1. Vedere
  6. Scaricare gli script e i file di sequenza necessari per il protocollo CAPRRESI.
    1. Scaricare i file gene bancari che contengono la sequenza completa del genoma della specie desiderata, estrarre la sequenza del DNA del gene scelto utilizzando un browser genomico e salvarlo in formato fasta. Scaricare gli script Perl necessari per il protocollo CAPRRESI. Conservare gli script e i file di sequenza nella stessa directory.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

La figura 1 descrive CAPRRESI. Utilizzando questo metodo, due geni chimerici sono stati assemblati scambiando i domini di due fattori di sigma primario batterico ( es. E. coli RpoD e R. etli SigA). Le sequenze di DNA dei geni rpoD e sigA sono state ottenute utilizzando il Artemis Genome Browser 14 da GenBank genome file NC_000913 e NC_007761, rispettivamente. La sequenza DNA del vettore pUC18 è stata ottenuta dal database nucleotide del server NCBI. In silico sono state effettuate analisi di siti di enzimi di restrizione sulle sequenze di DNA eseguendo lo script Perl di REsearch.pl (vedere la fase 1.2.2). Questi risultati sono stati utilizzati per la progettazione dell'oligonucleotide (fase 1.2.3). Gli oligonucleotidi esterni includevano siti di riconoscimento per gli enzimi di restrizione Xba I e Kpn I per clonare geni di tipo selvatico nel sito di clonazione multiplo pUC18. L'oligonucleotide anteriore comprendeva anche un riboUn sito di legame ( tabella 2 ). Il DNA genomico è stato estratto da cellule E. coli DH5α coltivate in brodo LB / Nal (37 ° C, 220-250 rpm) e nelle cellule R. etli CFN42 coltivate in brodo PY / Nal / CaCl2 (30 ° C, 220-250 giri / min ). Questi campioni sono stati utilizzati come modelli di DNA per l'amplificazione genica di tipo selvatico (fase 1.5.2).

I geni del wildtype sono stati amplificati utilizzando una polimerasi DNA ad alta fedeltà Taq , che è stata purificata da gel agarosio (kit di purificazione DNA), digestata a doppio con enzimi di restrizione Kpn I- XbaI e clonata nel vettore pUC18. Le cellule E. coli DH5α chimicamente competenti sono state trasformate con 5 μL della reazione di legatura corrispondente a costruzioni di tipo pUC18 rpoD e pUC18 sigA (punto 1.5.5). Le cellule trasformanti sono state selezionate su piastre LB / Amp / X-gal / IPTG solide coltivate a 37 ° C. Le costruzioni Wildtype sono state verificate da sequenza SangerIng 10 . Le sequenze di sequenza di Sanger sono state assemblate in silico utilizzando MIRA 11 (passo 1.5.8).

Le sequenze di aminoacidi provenienti da geni di tipo selvatico sono state ottenute eseguendo lo script translate.pl (passo 1.3.1). Dopo l'allineamento dei geni di tipo selvatico con Clustal 12 , le regioni aminoacidiche TLV e NLR sono state selezionate rispettivamente sul gene di resistenza dell'ampicillina ( ampR ) e sui fattori di sigma primario della wildtype (punto 1.3.3). Queste regioni di aminoacidi sono state utilizzate per calcolare tutte le possibili sequenze sinonimi di DNA che li codificano eseguendo lo script synonym.pl (punto 1.4.1). Lo script REsynonym.pl ha cercato i siti di enzimi di restrizione trovati sulle sequenze DNA del sinonimo precedentemente generate (punto 1.4.2). Quelle regioni sinonimi che hanno introdotto il minor numero di cambiamenti rispetto alle sequenze di wildtype sono stati selezionati. Per i geni del fattore di sigma primario, sequenze di wildtype di Rp(AACTTACGT) e SigA (AACCTTCGC) sono stati scambiati per AA CTTAAG G. Quest'ultimo ha incluso un sito Afl II (grassetto). Per il gene ampR , la sequenza di wildtype ACGCTGGTG è stata scambiata per il suo sinonimo, AC ACTAGT G. La sequenza di DNA sinonimo inserita nel gene ampR conteneva un sito Spe I (grassetto). La sostituzione in silico del tipo selvatico per le corrispondenti sequenze sinonimi è stata fatta per verificare l'integrità delle sequenze e il disegno oligonucleotidico (fasi 1.2-1.4).

Le modifiche della sequenza sinonima sono state introdotte mediante PCR utilizzando gli opportuni oligonucleotidi ( Tabella 2 ) e le costruzioni di tipo selvatico come modelli di DNA (fase 1.5.2). Le reazioni di amplificazione hanno prodotto quattro parti complementari: pUC18 rpoD σ1-σ2, pUC18 rpoD σ3-σ4, pUC18 sigA σ1-σ2 e pUC18 sigA σ3-σ4. Le parti complementari disNon hanno sommerso i fattori sigma, ma anche i geni ampR . Le parti complementari sono state purificate usando un kit di purificazione del DNA (punto 1.6.3).

Questi frammenti di DNA complementari sono stati duplicati con gli enzimi di restrizione Afl II e Spe I (punto 1.6.4). Secondo il progetto CAPRRESI, i frammenti di DNA pUC18 rpoD σ1-σ2 sono stati legati con pUC18 sigA σ3-σ4 per ottenere chimera 01 e pUC18 sigA σ1-σ2 è stata legata con pUC18 rpoD σ3-σ4 per assemblare chimera 02 (punti 1.7.1-1.7 .3). Le cellule E. coli DH5α chimicamente competenti sono state trasformate con 5 μL di reazione di legatura di pUC18 chim01 e pUC18 chim02 (punto 1.7.4). Le cellule trasformanti sono state selezionate su lastre LB / Amp / X-gal / IPTG coltivate a 37 ° C (punto 1.7.5). Le costruzioni chimiche sono state verificate da sequenza 10 di Sanger (fase 2). Sanger sequenza rGli eads sono stati assemblati utilizzando MIRA 11 e i file risultanti sono elencati nella tabella 3 . La Figura 2 mostra gli allineamenti (eseguiti con MUSCLE) 9 delle sequenze assemblate di wildtype e di geni chimerici in aree di rottura.

Figura 1
Figura 1: Panoramica di CAPRRESI. Rappresentazioni: geni (frecce spesse), plasmidi funzionali (cerchi chiusi) e oligonucleotidi (sottili, frecce nere). I siti di enzimi di restrizione inseriti in oligonucleotidi appaiono nei colori. Abbreviazioni: Wt (wildtype), FWD (oligonucleotide in avanti), REV (oligonucleotide inverso), ampR (gene di resistenza all'ampicillina), RES (sito di restrizione enzimatica), RE (enzima di restrizione). Clicca qui per vedere più versiSu di questa figura.

figura 2
Figura 2: Allineamento di wildtype assemblati e sequenze di geni chimici. Le sequenze di DNA assemblate sono state allineate usando il MUSCLE 9 . Le sequenze sono state assemblate con MIRA 11 . Le sequenze di sinonimi vengono visualizzate in nero. Il sito di riconoscimento Afl II appare sottolineato. Codice nucleotidico IUPAC: R (A o G) e K (G o T). Costruzioni: rpoD (rosso), sigA (blu), sequenza chimera 01 ( rpoD σ1-σ2- sigA σ3-σ4) e sequenza chimera 02 ( sigA σ1-σ2- rpoD σ3-σ4). Clicca qui per visualizzare una versione più grande di questa figura.

Soluzione componenti Istruzioni
Quantità Composto
Brodo Luria-Bertani (LB) 5 g estratto di lievito Sciogliere tutti i componenti in acqua. Autoclave. Conservare a temperatura ambiente fino all'uso. Per il brodo di LB solido, aggiungete 15 g di agar batteriologico alla ricetta.
10 g Caseina peptone
10 g NaCl
Fino a 1 L Doppia acqua distillata
LB / Amp / X-gal / piastre IPTG 100 mL Brodo LB solido fuso Aggiungere tutti i componenti a brodo LB temperato. Riempite i piatti di Petri e aspettate che si solidificino. Eseguire i passaggi in un cappuccio flusso laminare pulito con il bruciatore Bunsen acceso.
100 μL Ampicillina (Amp) [100 mg / mL]
100 μL X-gal [20 mg / ml]
50 μL 1 M soluzione IPTG
Lievito peptone (PY) 3 g estratto di lievito Sciogliere tutti i componenti in acqua. Autoclave. Conservare a temperatura ambiente fino all'uso. Per il brodo solido PY, aggiungete 15 g di agar batteriologico alla ricetta. Per la coltura R. etli, aggiungere 700 μL di soluzione 1 M di CaCl2 prima dell'uso.
5 g Caseina peptone
Fino a 1 L Doppia acqua distillata
Piastre PY / CaCl 2 / Nal 100 mL Brodo solido PY fuso Aggiungere tutti i componenti al brodo PY temperato. Riempite i piatti di Petri e aspettate che si solidificino. Eseguire i passaggi in un cappuccio flusso laminare pulito con il bruciatore Bunsen acceso.
700 μL 1 M CaCl2 soluzione
100 μL Acido nalidixic (Nal) [20 mg / mL]
1 M soluzione di cloruro di calcio (CaCl2) 11,1 g CaCl2 Sciogliere CaCl2 in acqua. Autoclave. Conservare a temperatura ambiente.
Fino a 100 ml Doppia acqua distillata
Tris-EDTA (TE) 10: 1 pH 8,0 1 ml 1 soluzione M Tris Mescolare tutti i componenti. Autoclave. Conservare a temperatura ambiente.
400 μL 0,25 M soluzione EDTA
Fino a 100 ml Doppia acqua distillata
TE 50:20 pH 8,0 5 mL 1 soluzione M Tris Mescolare tutti i componenti. Autoclave. Conservare a temperatura ambiente/ Td>
8 ml 0,25 M soluzione EDTA
Fino a 100 ml Doppia acqua distillata
TE 10: 1 10 mM soluzione NaCl 58,4 mg NaCl Sciogliere NaCl in TE 10: 1. Autoclave. Conservare a temperatura ambiente.
Fino a 100 ml Soluzione TE 10: 1 pH 8,0
Soluzione di lisi I 80 mg lisozima Sciogliere e mescolare tutti i componenti in acqua. Filtro sterilizzare utilizzando un filtro da 0,22 μm. Conservare a temperatura ambiente.
2 mL 0,5 M soluzione di glucosio
400 μL 0,5 M soluzione EDTA
500 μL 1 soluzione M Tris
Fino a 20 ml Acqua doppia distillata sterilizzata
Soluzione di lisi II 1,2 mL 5 M soluzione di idrossido di sodio (NaOH) Sciogliere tutti i componenti in acqua. Filtro sterilizzare utilizzando un filtro da 0,22 μm. Conservare a temperatura ambiente.
3 ml Soluzione di dodecil solfato di sodio (SDS) del 10%
Fino a 30 ml Acqua doppia distillata sterilizzata
Soluzione di lisi III 29,4 g Acetato di potassio (CH 3 COOK) Sciogliere e mescolare tutti i componenti in acqua. Filtro sterilizzare utilizzando un filtro da 0,22 μm. Conservare a temperatura ambiente.
11,5 ml Acido acetico assoluto (CH 3 COOH)
Fino a 100 ml Acqua doppia distillata sterilizzata
1 M soluzione di cloruro di magnesio (MgCl2) 9,5 g MgCl2 Sciogliere MgCl2 in wAter. Autoclave. Conservare a temperatura ambiente.
Fino a 100 ml Doppia acqua distillata
3 M di sodio acetato (CH 3 COONa) 24,6 g CH 3 COONa Sciogliere CH 3 COONa in acqua. Autoclave. Conservare a temperatura ambiente
Fino a 100 ml Doppia acqua distillata
Soluzione 10% SDS 10 g SDS Sciogliere la SDS in acqua con una barra di agitazione magnetica a bassa velocità. Autoclave. Conservare a temperatura ambiente.
Fino a 100 ml Doppia acqua distillata
Soluzione 3 M CH 3 COOK 29,4 g CH 3 COOK Sciogliere CH 3 COOK in acqua. Filtro sterilizzare utilizzando un filtro da 0,22 μm. Conservare a temperatura ambiente. Fino a 100 ml Acqua doppia distillata sterilizzata
Soluzione di proteinasi K 5 mg Proteina K Sciogliere la proteinasi K nella soluzione TE 50:20. Scaldare a 37 ºC per 1 ora. Conservare a -20 ºC.
Fino a 1 ml TE 50:20 soluzione pH 8,0
Soluzione RNase 10 mg RNase Sciogliere RNase in acqua. Scaldare a 95 ºC per 10 minuti. Conservare a -20 ºC.
Fino a 1 ml Acqua ultrapure sterilizzata
1 M isopropil-β-D-tiogalattoside (IPTG) 238,3 mg IPTG Sciogliere IPTG in acqua. Filtro sterilizzare utilizzando un filtro da 0,22 μm. Conservare a -20 ºC.
Fino a 1 ml Acqua ultrapure sterilizzata
20 mg X-gal Sciogliere X-gal in acqua. Filtro sterilizzare utilizzando un filtro da 0,22 μm. Conservare a -20 ºC.
Fino a 1 ml Acqua ultrapure sterilizzata
Fenolo: cloroformio: isoamil alcool 24: 24: 1 soluzione 24 mL fenolo Mescolare tutti i componenti. Conservare in una bottiglia ambrata a 4 ºC. ATTENZIONE! Materiale pericoloso. Indossare occhiali protettivi, guanti e abiti da laboratorio in cotone. Usare una cappa di estrazione. NON accendere il bruciatore Bunsen o qualsiasi altra fonte di fuoco durante la movimentazione. Alternativa: utilizzare fenolo commerciale: cloroformio: isoamil alcool 25: 24: 1 soluzione
24 mL cloroformio
1 ml Isoamil alcool
0,5 M soluzione di glucosio 9 g glucose Sciogliere il glucosio in acqua. Filtro sterilizzare utilizzando un filtro da 0,22 μm. Conservare a temperatura ambiente.
Fino a 100 ml Acqua ultrapure sterilizzata
0,5 M di soluzione di pH 8,0 dell'acido etilendiamintetraoacetico (EDTA) 14,6 g EDTA Sciogliere EDTA in acqua. Regolare il pH con 5 M NaOH. Autoclave. Conservare a temperatura ambiente.
Fino a 100 ml Doppia acqua distillata
Soluzione 0,25 M EDTA pH 8,0 7,3 g EDTA Sciogliere EDTA in acqua. Regolare il pH con 5 M NaOH. Autoclave. Conservare a temperatura ambiente.
Fino a 100 ml Doppia acqua distillata
1 M Tris pH 8,0 soluzione 12,1 g Tris Sciogliere Tris in acqua. Regolare il pH conAcido cloridrico assoluto (HCl). Autoclave. Conservare a temperatura ambiente.
Fino a 100 ml Doppia acqua distillata
5 M soluzione di idrossido di sodio (NaOH) 19,9 g NaOH Sciogliere NaOH in acqua. Conservare a temperatura ambiente. ATTENZIONE! Composto caustico.
Fino a 100 ml Acqua doppia distillata sterilizzata
0,1 M soluzione di NaOH 399 mg NaOH Sciogliere NaOH in acqua. Conservare a temperatura ambiente.
Fino a 100 ml Acqua doppia distillata sterilizzata
Soluzione stock di acido nalidixic (Nal) 60 mg Acido nalidixic Sciogliere Nal in acqua. Filtro sterilizzare utilizzando un filtro da 0,22 μm. Conservare a 4 ° C.
Fino a 3 ml 0,1 MNSoluzione aOH
Ampicillina (Amp) 300 mg ampicillina Sciogliere l'ampère in acqua. Filtro sterilizzare utilizzando un filtro da 0,22 μm. Conservare a 4 ° C.
Fino a 3 ml Acqua doppia distillata sterilizzata
10x tris-acetato-EDTA tampone 48,4 g Tris Sciogliere tutti i componenti in acqua. Autoclave. Conservare a temperatura ambiente.
20 ml 0,5 M soluzione EDTA
11,44 ml acido acetico glaciale
Fino a 1 L Doppia acqua distillata

Tabella 1: Preparazione della soluzione. Istruzioni per la preparazione della soluzione.

No. Codice Sequenza Lunghezza (nt) Caratteristiche
1 RpoD-FWD GC TCTAGA GA AGGAGA TATCATATGGAGCAAAACCCGCAGTCA 43 Sito XbaI ; Amplificazione genica tipo selvatico e clonazione vettoriale
2 ROD-REV GG GGTACC TTAATCGTCCAGGAAGCTACG 29 Sito KpnI ; Amplificazione genica tipo selvatico e clonazione vettoriale
3 SIGA-FWD GC TCTAGA GA AGGAGA TATCATATGGCAACCAAGGTCAAAGAG 43 Sito XbaI ; Amplificazione genica tipo selvatico e clonazione vettoriale
4 SIGA-REV GG GGTACC TTAGCTGTCCAGAAAGCTTCT </ Td> 29 Sito KpnI ; Amplificazione genica tipo selvatico e clonazione vettoriale
3 AMPR-FWD AC ACTAGT GAAAGTAAAAGAT 21 Il sito SpeI inserito, mutazione sinonimo. Perdita del gene di ampR
4 AMPR-REV TC ACTAGT GTTTCTGGGTGAG 21 Il sito SpeI inserito, mutazione sinonimo. Perdita del gene di ampR
5 σ2RpoD-FWD AA CTTAAG GCTGGTTATTTCTATCGCT 27 Sito AflII inserito, mutazione sinonima . Costruzione di chim01-02
6 σ2RpoD-REV GC CTTAAG TTCGCTTCAACCATCTCTT 27 Sito AflII inserito, mutazione sinonima . Costruzione di chim01-02
7 σ2SigA-FWD AA CTTAAG GCTCGTCATTTCAATCGCC 27 Sito AflII inserito, mutazione sinonima . Costruzione di chim01-02
8 σ2SigA-REV GC CTTAAG TTCGCTTCGACCATTTCCT 27 Sito AflII inserito, mutazione sinonima . Costruzione di chim01-02

Tabella 2: sequenze di oligonucleotidi. I siti degli enzimi di restrizione appaiono sottolineati. Sito di rilegatura del ribosoma: grassetto.

Costruzione File di sequenza File di qualità
chimera01 chim01_out.unpadded.fasta chim01_out.unpadded.fasta.qual
chim01_A3 / B3 / E2 / F2 / G2 /H2.pdf
chimera02 chim02_out.unpadded.fasta chim02_out.unpadded.fasta.qual
chim02_C3 / D3 / E3 / F3 / G3 / H3.pdf
rpoD rpod_out.unpadded.fasta rpod_out.unpadded.fasta.qual
SIGA siga_out.unpadded.fasta siga_out.unpadded.fasta.qual

Tabella 3: File di sequenza ottenuti con l'assemblatore MIRA e sequenziatore di DNA. Il sequenziamento di Sanger da costruzioni chimiche e wildtype è stato assemblato con il software MIRA 11 utilizzando l'opzione di mappatura. I cromatogrammi di sequenza chimica appaiono come file PDF.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

CAPRRESI è stato progettato come alternativa al PRM 2 . Il PRM originale è una tecnica potente; Consente la fusione di sequenze di DNA su qualsiasi parte dei geni selezionati. Per PRM, i geni di tipo selvatico devono essere clonati nello stesso plasmide. Dopo di che, gli oligonucleotidi sono progettati all'interno di geni selvatici e resistenti agli antibiotici trovati sul plasmide. La disfunzione del plasmide è ottenuta mediante PCR mediante DNA-polimerasi estremamente nitide e ad alta fedeltà e oligonucleotidi precedentemente progettati. La legatura di prodotti PCR complementari associa geni chimerici e ripristina la cassetta di resistenza agli antibiotici, con conseguente recupero funzionale del plasmide. PRM consente la realizzazione di librerie di gene chimeriche sullo stesso sfondo plasmide. Purtroppo, la legatura di sequenze di DNA a sbavature potrebbe essere tecnicamente arduo. L'assemblaggio della chimera mediante sovrapposizioni di frammenti di PCR 1 richiede anche che le polimerasi del DNA producano prodotti blunt-end ePurificazione del DNA per ogni reazione. I geni chimerici assemblati da questa tecnica sono prodotti lineari del DNA. La clonazione di ogni costruzione nel vettore target potrebbe ritardare ulteriori analisi.

CAPRRESI beneficia di molti dei punti di forza della PRM e semplifica anche la legatura di frammenti di DNA complementari utilizzando siti di restrizione enzimatici sulle regioni di sequenza del DNA sinonimo. Per questi motivi, CAPRRESI non richiede polimeri DNA a finestrino. L'uso di sequenze di DNA sinonime restringe i siti di fusione per l'assemblaggio di chimera ma migliora l'efficienza della legatura. Un'altra importante modifica introdotta in CAPRRESI è che le chimere sono assemblate e gestite nei vettori pUC18 / 19. Questi vettori possiedono diverse funzionalità vantaggiose, come detto in precedenza. Il DNA chimico potrebbe essere ottenuto propagando il vettore di costruzione negli ospiti di E. coli . La clonazione successiva di geni chimerici nel plasmide finale ( es . , Un vettore di espressione) è a voltenecessario.

CAPRRESI si affida anche alla gestione in silico di DNA e sequenze di aminoacidi. Gli script perl ad hoc permettono di selezionare gli appropriati enzimi di restrizione per clonare geni selvatici, il calcolo di tutte le sequenze di DNA sinonimo corrispondenti a regioni di rottura (per l'assemblea chimera) e l'identificazione degli enzimi di restrizione per semplificare il recupero del plasmide. A causa di queste condizioni, CAPRRESI è un'alternativa per fusione di geni che codificano proteine. I punti critici del protocollo CAPRRESI sono: 1) la selezione di regioni di rottura e 2) la purificazione di prodotti PCR. Le regioni di rottura sono tratti in cui vengono calcolate le sequenze sinonimi, producendo siti di restrizione enzimatici che non si trovano sulle sequenze di wildtype. L'utilizzo di siti di enzimi di restrizione per l'assemblaggio di chimera elimina la necessità di DNA polimerasi che producono prodotti a punta aperta e facilita la reazione di legatura. Non tutte le regioni avranno siti impiegabili di restrizione enzimatici; foPer questo motivo, si raccomanda di spostare regioni di rottura per un amminoacido alla volta fino alla ricerca del miglior tratto di sequenza. Se il disegno in silico non consente il movimento delle regioni di rottura o le sequenze di sequenze mancano le sequenze di DNA sinonimo con opportuni siti di restrizione, si raccomanda di fondere i geni bersaglio utilizzando oligonucleotidi sovrapposti e di introdurre sequenze sinonimo di DNA nel gene di resistenza all'ampicillina (Trovato sul vettore) solo. In questo modo i geni possono essere fusi in qualsiasi parte e il ripristino del plasmide si basa sulla legatura di un unico sito (digerito con un solo enzima di restrizione). La flessibilità di CAPPRESI consente di essere eseguita in combinazione con altre tecniche.

La purificazione di prodotti PCR viene eseguita per eliminare il DNA del templato, riducendo le probabilità di contaminazione del plasmide genitore dopo la legatura di frammenti DNA complementari. L'adempimento di questi due punti critici aumenta il bac(Il numero di costruzioni correttamente assemblate), permettendo di eseguire CAPRRESI con cellule E. coli chimicamente competenti (CaCl2) o elettrocompetenti. Il primo tipo di cellule competenti rappresenta la fonte più economica di colture E. coli , utilizzate per la trasformazione batterica nella maggior parte dei laboratori. A causa di tutte le caratteristiche mostrate in precedenza, CAPRRESI rappresenta un'opzione utile per assemblare chimere.

Inoltre, CAPRRESI potrebbe lavorare in combinazione con frammenti di PCR sovrapposti o tecniche di recupero del plasmide. Ad esempio, invece di inserire due sequenze sinonimi per una parte complementare del DNA, la regione di rottura desiderata (sui geni del wildtype bersaglio) potrebbe utilizzare oligonucleotidi sovrapposti per fondere sequenze interne. L'introduzione di sequenze sinonime potrebbe essere limitata al gene ampR dei vettori pUC18 / 19, portando all'utilizzo di un solo enzima di restrizione per ripristinare i plasmiD integrità. Queste future applicazioni potrebbero rafforzare CAPRRESI permettendo la fusione di qualsiasi tipo di sequenza di DNA ( cioè non solo i geni codificanti proteine), senza compromettere l'efficienza della legatura.

Per testare CAPRRESI, due fattori chimici chimici sono stati assemblati scambiando regioni di due geni del fattore di sigma primario di tipo selvatico: rpoD ( E. coli ) e sigA ( R. etli ). Tutti i fattori primari sigma primari detengono quattro domini da σ1 a σ4 8 . La chimera 01 è costituita da RpoDσ1-σ2 e SigAσ3-σ4, mentre la chimera 02 ha SigAσ1-σ2 e RpoDσ3-σ4. L'integrità delle costruzioni chimiche è stata verificata da Sanger sequenziamento 10 ( Figura 2 ).

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Gli autori dichiarano di non avere interessi finanziari concorrenti.

Acknowledgments

Questo lavoro è stato sostenuto dal Consejo Nacional de Ciencia y Tecnología, CONACYT, México (numero di sovvenzione 154833) e Universidad Nacional Autónoma de México. Gli autori vogliono ringraziare Víctor González, Rosa I. Santamaría, Patricia Bustos e Soledad Juárez per i loro consigli amministrativi e tecnici.

Materials

Name Company Catalog Number Comments
Platinum Taq DNA polymerase High Fidelity Thermo Fisher 11304011 Produces a mix of blunt/3’-A overhang ended PCR products
High pure plasmid isolation kit Roche 11754785001 Used for all plasmid purification reactions
High pure PCR product purification kit Roche 11732676001 Used for all PCR purification reactions from agarose gels
AflII restriction enzyme New England Biolabs R0520L Recognizes sequence 5’-CTTAAG-3’ and cuts at 37 °C
KpnI-HF restriction enzyme New England Biolabs R3142L Recognizes sequence 5’-GGTACC-3’ and cuts at 37 °C
SpeI-HF restriction enzyme New England Biolabs R3133L Recognizes sequence 5’-ACTAGT-3’ and cuts at 37 °C
XbaI restriction enzyme New England Biolabs R0145L Recognizes sequence 5’-TCTAGA-3’ and cuts at 37 °C
Ampicillin sodium salt Sigma Aldrich A0166-5G Antibiotics
Nalidixic acid Sigma Aldrich N8878-5G Antibiotics
Yeast Extract Sigma Aldrich Y1625-1KG Bacterial cell culture
Casein peptone Sigma Aldrich 70171-500G Bacterial cell culture
NaCl Sigma Aldrich S9888-1KG Sodium chloride
Agar Sigma Aldrich 05040-1KG Bacterial cell culture
XbaI restriction enzyme Thermo Fisher FD0684 Fast digest XbaI enzyme
KpnI restriction enzyme Thermo Fisher FD0524 Fast digest KpnI enzyme
Quick Ligation Kit New England Biolabs M2200S Fast DNA ligation kit
AflII restriction enzyme Thermo Fisher FD0834 Fast digest AflII enzyme
SpeI restriction enzyme Thermo Fisher FD1253 Fast digest SpeI enzyme

DOWNLOAD MATERIALS LIST

References

  1. Horton, R. M., Hunt, H. D., Ho, S. N., Pullen, J. K., Pease, L. R. Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene. 77, (1), 61-68 (1989).
  2. Vos, M. J., Kampinga, H. H. A PCR amplification strategy for unrestricted generation of chimeric genes. Anal. Biochem. 380, (2), 338-340 (2008).
  3. Hawkins, N. C., Garriga, G., Beh, C. T. Creating Precise GFP Fusions in Plasmids Using Yeast Homologous Recombination. Biotechniques. 34, (1), 1-5 (2003).
  4. Sander, J. D., Joung, J. K. CRISPR-Cas systems for editing, regulating and targeting genomes. Nat Biotechnol. 32, (4), 347-355 (2014).
  5. Nagy, A. Cre recombinase: The universal reagent for genome tailoring. Genesis. 26, (2), 99-109 (2000).
  6. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods. 6, (5), 343-345 (2009).
  7. Norrander, J., Kempe, T., Messing, J. Construction of improved M13 vectors using oligodeoxynucleotide-directed mutagenesis. Gene. 26, (1), 101-106 (1983).
  8. Gruber, T. M., Gross, C. A. Multiple sigma subunits and the partitioning of bacterial transcription space. Annu Rev Microbiol. 57, 441-466 (2003).
  9. Edgar, R. C. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 32, (5), 1792-1797 (2004).
  10. Macrogen Inc. Seoul, Rep. Of Korea. Available from: http://dna.macrogen.com/eng/index.jsp (2016).
  11. Chevreux, B. MIRA: an automated genome and EST assembler. Available from: http://www.chevreux.org/thesis/index.html 1-161 (2005).
  12. Thompson, J. D., Gibson, T. J., Higgins, D. G. Multiple sequence alignment using ClustalW and ClustalX. Curr Protoc Bioinformatics. Chapter 2 (Unit 2.3) 1-22 (2002).
  13. Sambrook, J., Russell, D. W. Molecular Cloning: A laboratory manual. CSHLP. (2001).
  14. Rutherford, K., et al. Artemis: sequence visualization and annotation. Bioinformatics. 16, (10), 944-945 (2000).
CAPRRESI: Assemblaggio chimico mediante inserimento del sito enzimatico di recupero e restrizione di plasmide
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Santillán, O., Ramírez-Romero, M. A., Dávila, G. CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion. J. Vis. Exp. (124), e55526, doi:10.3791/55526 (2017).More

Santillán, O., Ramírez-Romero, M. A., Dávila, G. CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion. J. Vis. Exp. (124), e55526, doi:10.3791/55526 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter