Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

카스트레 : 플라스미드 회수 및 제한 효소 부위 삽입에 의한 키메라 조립

doi: 10.3791/55526 Published: June 25, 2017

Summary

여기, 제한 효소 사이트를 동의어 DNA 시퀀스에 삽입 및 기능 플라스미드 복구를 기반으로하는 프로토콜 인 플라스미드 회수 및 제한 효소 사이트 삽입 (CAPRRESI)에 의한 키메라 어셈블리를 제시합니다. 이 프로토콜은 단백질 코딩 유전자 융합을위한 빠르고 저렴한 방법입니다.

Abstract

여기, 우리는 플라스미드 복구 및 제한 효소 사이트 삽입 (카프레 리)에 의한 키메라 조립을 제시한다. CAPRRESI는 원래의 플라스미드 회수 방법의 많은 장점을 활용하고 제한 효소 소화를 도입하여 DNA 라이 게이션 반응을 완화합니다 (키메라 조립에 필요함). 이 프로토콜의 경우 사용자는 야생형 유전자를 동일한 플라스미드 (pUC18 또는 pUC19)에 복제합니다. 키메라가 조립되어야하는 아미노산 서열 영역의 in silico 선택 후, 사용자는 그들을 암호화하는 모든 동의어 DNA 서열을 얻는다. Ad Hoc Perl 스크립트를 사용하면 사용자가 모든 동의어 DNA 시퀀스를 결정할 수 있습니다. 이 단계 후에 다른 Perl 스크립트는 모든 동의어 DNA 시퀀스에서 제한 효소 사이트를 검색합니다. 이 in silico 분석은 pUC18 / 19 플라스미드에서 발견되는 암피실린 내성 유전자 ( ampR )를 사용하여 수행됩니다. 사용자는 synonym region 내에서 올리고 뉴클레오타이드를 디자인하여 PCR로 wildtype과 ampR 유전자를 파괴합니다. obt 후상보적인 DNA 단편을 정제하고 정제하고, 제한 효소 소화를 수행한다. 키메라 조립은 적절한 상보적인 DNA 단편을 연결함으로써 달성된다. PUC18 / 19 벡터는 작은 크기 (2,686 염기 쌍), 높은 카피 수, 유리한 시퀀싱 반응 특징 및 상업적 유용성과 같은 기술적 이점을 제공하기 때문에 CAPRRESI를 위해 선택된다. 키메라 조립을위한 제한 효소의 사용은 무딘 - 종단 제품을 생산하는 DNA 중합 효소의 필요성을 제거합니다. CAPRRESI는 단백질 코딩 유전자 융합을위한 빠르고 저렴한 방법입니다.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

키메라 유전자 어셈블리는 단백질 기능을 밝히고 생물 공학적 목적으로 분자 생물학에서 널리 사용되어왔다. 중첩 PCR 산물 증폭 1 , 플라스미드 회수 2 , 상 동성 재조합 3 , CRISPR-Cas9 시스템 4 , 부위 유도 재조합 5 및 깁슨 어셈블리 6 과 같은 유전자 융합에 대한 다른 방법이있다. 이들 각각은 서로 다른 기술적 이점을 제공합니다. 예를 들어 중복 된 PCR 디자인의 융통성, 플라스미드 회복 동안 구조의 생체 내 선택, CRISPR-Cas9 및 Gibson 시스템의 고효율성 등이 있습니다. 반면에 이러한 방법 중 일부를 수행하는 동안 약간의 어려움이 발생할 수 있습니다. 예를 들어, 처음 두 접근법은 둔기가 끝난 DNA 단편에 의존하며 이러한 유형의 산물의 결찰은 stic에 비해 기술적으로 어려울 수 있습니다연말 결찰. Site-directed 재조합은 Creoxox 시스템과 같이 원래 DNA 서열 (흉터)의 흔적을 남길 수 있습니다 5 . CRISPR-Cas9는 때로는 대상 사이트 4 이외에 다른 게놈 지역을 수정할 수 있습니다.

여기에서 플라즈미드 회수 및 제한 효소 부위 삽입 (CAPRRESI)에 의한 키메라 어셈블리를 소개합니다.이 프로토콜은 플라즈미드 회수 방법 (PRM)과 동의어 DNA 서열상의 제한 효소 부위 삽입을 결합하여 결찰 효율을 향상시키는 단백질 코딩 유전자 융합 프로토콜입니다 . 아미노산 서열의 완전성을 보장하기 위해, 제한 효소 부위는 동의어 DNA 서열 연장 부에 삽입된다. CAPPRESI의 이점 중 하나는 일반 실험실 시약 / 도구 ( 예 : 효소, 능력있는 세포, 용액 및 열 순환기)를 사용하여 수행 할 수 있으며 신속한 결과를 줄 수 있다는 것입니다 (적절한 효소가 사용되는 경우). 제한에 의존동의어 DNA 서열로부터 나오는 효소 부위는 관심있는 단백질 내부의 정확한 융합 지점의 선택을 제한 할 수있다. 그러한 경우, 중복되는 올리고 뉴클레오타이드를 사용하여 표적 유전자를 융합시키고, 벡터의 내성 유전자에 제한 효소 부위를 삽입해야한다.

CAPRRESI는 7 가지 간단한 단계로 구성됩니다 ( 그림 1 ) : 1) 클로닝 벡터 pUC18 또는 pUC19 6의 선택 ; 2) 융합 될 야생형 서열의 실 리코 (silico) 분석; 3) 키메라 조립 및 플라스미드 파괴에 대한 파괴 영역의 선택; 4) in silico 세대의 동의어 DNA 제한 효소 부위를 포함하는 염기 서열; 5) 선택된 플라스미드로의 야생형 유전자의 독립적 인 클로닝; 6) PCR에 의한 플라스미드 파괴,이어서 제한 효소 소화; 및 7) DNA 라이 게이션 및 세균 변형을 이용한 플라스미드 회수. 이 기술로 생산 된 키메라 유전자는 검증되어야한다.ith 시퀀싱.

pUC18 / 19 벡터는 작은 크기 ( 즉, 2,686 염기쌍), 높은 카피 수, 유리한 서열화 반응 특징 및 상업적 유용성과 같은 클로닝 및 키메라 조립에 기술적 장점을 제공합니다. 여기에 박테리아 배양이 저렴하고 빨리 자라기 때문에 대장균 (Escherichia coli) 숙주를 사용하여 키메라를 조립하고 처리했습니다. 이를 고려하여, 최종 표적 플라스미드로의 융합 단편의 후속 클로닝 ( 예 : 박테리아의 pRK415 또는 포유류 세포의 pCMV와 같은 발현 벡터)이 필요할 것이다.

CAPRRESI는 두 가지 주요 시그마 인자 유전자 인 E. colirpoDRhizobium etlisigA 를 융합시켜 시험 하였다 . 1 차 시그마 인자는 전사 개시에 관여하는 RNA 중합 효소 서브 유닛이며, 4 개의 도메인 ( 즉, σ1, σ2, σ3, σ4)으로 이루어져있다. 아미노산 서열은 길다.rpoDsigA에 의해 인코딩 된 단백질은 각각 613 및 685이다. RpoD와 SigA는 48 %의 동일성 (98 % 적용 범위)을 공유합니다. 이러한 1 차 시그마 요인은 영역 σ2와 σ3 사이에서 두 개의 보완적인 조각으로 나뉘어졌습니다. 키메라 01 (RpoDσ1-σ2 + SigAσ3-σ4)과 키메라 02 (SigAσ1-σ2 + RpoDσ3- σ4)의 두 가지 키메라 유전자가이 디자인에 따라 조립되었다. DNA 융합 생성물은 시퀀싱에 의해 확인되었다.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. CAPRRESI 프로토콜

참고 : 그림 1 은 전체 CAPRRESI 프로토콜을 나타냅니다. 이 기술은 in silico 디자인과 원하는 키메라의 후속 구성을 기반으로합니다.

  1. 클로닝 플라스미드, pUC18 또는 pUC19의 선택.
    1. 기술적 인 요구에 가장 적합한 pUC 벡터를 선택하십시오.
      참고 : 두 벡터는 다중 복제 사이트의 방향을 제외하고는 동일한 순서를 갖습니다. 이것은 올리고 뉴클레오티드의 디자인과 PCR 플라스미드 파괴에 중요합니다.
  2. 야생형 유전자와 pUC18 / 19 염기 서열에 대한 in silico 분석.
    1. 야생형 유전자의 DNA 서열을 얻어 FASTA 형식 파일 ( 예 : genes.fas)에 저장하십시오.
      참고 : pUC18 / 19 벡터의 시퀀스는 pUC.fas 파일에 포함되어 있습니다 ( 그림 1 , 1 단계).
    2. 어떤 제한 enz 결정ymes는 REsearch.pl 스크립트를 실행하여 wildtype 유전자와 pUC18 / 19 염기 서열을 절단하지 않습니다. 또는 온라인 도구로 제한 효소 사이트 검색을 수행하십시오 ( 그림 1 , 2 단계).
      1. 터미널에 다음을 입력하십시오.
        perl REsearch.pl 유전자.
        perl REsearch.pl pUC.fas
        참고 :이 명령은 다음 출력 파일을 생성합니다 : genes_lin.fas, genes_re.fas, pUC_lin.fas 및 pUC_re.fas.
      2. genes_re.fas와 pUC.fas 파일을 비교하여 선택한 pUC18 / 19 벡터의 다중 복제 사이트로 wildtype 유전자를 복제하기위한 적절한 제한 효소를 선택하십시오. pUC18 / 19 벡터의 암피실린 내성 유전자 ( ampR )에 상대적인 인서트의 방향을 선택하십시오.
    3. 야생형 유전자 (외부 올리고 뉴클레오타이드)의 코딩 영역을 증폭시키기 위해 포워드 및 리버스 올리고 뉴클레오티드를 디자인하십시오. 각 5 '말단에 적절한 제한 효소 부위를 포함시킨다.올리고 뉴클레오티드; 이것은 삽입 방향을 정의합니다.
      1. 포워드 올리고 뉴클레오타이드에 기능적 리보솜 결합 부위를 포함시킨다.
      2. 벡터 내에서 동일한 방향으로 두 야생형 유전자를 삽입하십시오.
  3. 키메라 어셈블리 및 플라스미드 파괴에 대한 파괴 영역의 선택.
    1. translate.pl 스크립트 ( 그림 1 , 3 단계)를 실행하여 wildtype과 ampR 유전자의 아미노산 서열을 얻습니다.
      1. 터미널에 다음을 입력하십시오.
        perl translate.pl 유전자.
        perl translate.pl ampR.fas

        참고 :이 스크립트는 다음 출력 파일을 생성합니다 : genes_aa.fas 및 ampR_aa.fas.
    2. 두 가지 야생형 아미노산 서열을 적절한 소프트웨어 ( 예 : 근육)로 전역 정렬하십시오.
    3. 키메라 asse에 대한 원하는 휴식 영역 (3-6 아미노산)을 선택하십시오mbly. 파일을 FASTA 형식의 파일 ( 예 : regions.fas)에 저장하십시오.
    4. 두 가지 야생형 유전자에서 선택된 아미노산 스트레치를 코딩하는 DNA 서열을 찾습니다.
  4. 제한 효소 사이트를 포함하는 동의어 DNA 시퀀스의 in silico 세대.
    1. 절단 영역으로 선택된 각 아미노산 서열 스트레치를 코드하는 모든 동의어 DNA 서열을 얻습니다 ( 그림 1 , 단계 4). 이러한 시퀀스는 regions.fas 파일에 저장됩니다.
      1. 터미널에 다음을 입력하십시오.
        perl synonym.pl regions.fas
        참고 :이 스크립트는 regions_syn.fas 출력 파일을 만듭니다.
    2. 동의어 DNA 서열에서 발견되는 제한 효소 부위를 검색하십시오.
      1. 터미널에 다음을 입력하십시오 : perl REsynonym.pl regions_syn.fas
        참고 :이 스크립트는 regions_syn-re.fas 출력 파일을 만듭니다..
    3. 두 야생형 유전자의 동의어 시퀀스간에 공유되는 하나의 제한 효소를 선택하십시오. 이 사이트는 제한 효소 소화를 통해 키메라를 조립하는 데 사용됩니다. 선택된 제한 효소가 야생형 유전자 나 pUC18 / 19 벡터 서열을 절단하지 않는지 확인하십시오.
      1. genes_re.fas, pUC_re.fas 및 regions_syn-re.fas 파일에있는 제한 효소를 비교하십시오.
    4. 실 리코 (Silico) 에서는 원산지를 두 야생형 유전자의 상응하는 유전자좌에서 동의어 DNA 서열로 대체합니다. synonym DNA sequence를 wildtype sequence file (genes.fas)에 추가합니다.
    5. gene.fas 파일 ( perl translate.pl genes.fas )에 포함 된 유전자의 아미노산 서열을 얻습니다.
    6. 야생형과 동의어 DNA 서열에서 번역 된 아미노산 서열을 정렬합니다. 두 시퀀스가 ​​동일한지 확인하십시오.
    7. pU에 존재하는 ampR 유전자를 가지고이 절의 모든 단계를 반복하십시오C18 / 19 벡터입니다.
      참고 : 목표는 ampR 유전자 (ampR.fas 파일)를 두 개의 보완적인 부분으로 나누는 것입니다. ampR 유전자를 파괴하기 위해 선택되는 제한 효소는 키메라 조립에 사용 된 제한 효소와 달라야 한다.
  5. 두 개의 야생형 유전자를 선택된 pUC18 / 19 벡터에 독립적으로 클로닝 (그림 1, 단계 3).
    1. 플라스미드 DNA 정제 키트를 사용하여 선택한 pUC18 / 19 플라스미드 DNA를 정제하십시오.
      1. 예를 들어, pUC18 플라스미드로 E. coli DH5α를 형질 전환시키고, 형질 전환 체를 고체 LB-0.3 mg / mL 암피실린 (Amp)상에서 37 ℃에서 밤새 성장시킨다. 형질 전환 콜로니를 선택하고 새로운 LB-0.3 mg / mL Amp 플레이트를 접종하고 37 ° C에서 밤새 배양하십시오.
      2. 이전의 배양 물을 섭취하고 37 ℃에서 6 ~ 8 시간 동안 액체 LB-0.3 mg / mL Amp에서 배양하십시오. 키트를 사용하여 플라스미드 DNA를 추출합니다.
    2. PCR은 approp를 사용하여 총 게놈 DNA에서 야생형 유전자를 증폭외부 oligonucleotides를 riate. 가능한 경우 높은 충실도의 DNA 중합 효소를 사용하십시오. 수율을 최대화하는 DNA 중합 효소를 선택하십시오. 제조업체의 지침과 올리고 뉴클레오타이드의 용융 온도에 따라 PCR을 수행하십시오.
      1. 사용 된 DNA 중합 효소, 앰플 리콘 크기, 주형 및 올리고 뉴클레오티드에 따라 PCR 사이클을 실행하십시오. 예를 들어, rpoD DNA를 증폭 하려면 50 μL 반응을 준비하십시오 : 10 μ 버퍼 5 μL, 50 mM MgSO 4 2 μL, 10 mM dNTP 믹스 1 μL, 각 10 μM 올리고 뉴클레오티드 2 μL (표 2), 2 템플릿 DNA ( 대장균 DH5α 총 DNA) μL, 초순수 35.8 μL, 고 충실도 DNA 중합 효소 0.2 μL를 넣었다. 다음 PCR주기를 실행하십시오 : 초기 변성을 위해 94 ℃에서 1 분, 30 사이클의 증폭 (94 ℃에서 30 초 변성, 60 ℃에서 30 초, 올리고 뉴클레오티드 어닐링, 68 ℃에서 2 분) 확장).
      2. 1.2 g의아가로 오스에 두 배 증류수 100 mL에 넣고 전자 레인지로 가열한다. 젤 받침대를 조립하고 빗을 수평 젤 캐스터에 넣으십시오. 겔 트레이에 용융 된 아가로 오스 용액을 채우고 고형화하십시오. 빗을 제거하십시오.
      3. 전기 영동 챔버에 젤을 넣으십시오. 1x Tris-acetate-EDTA 완충액으로 챔버를 채 웁니다. 겔 우물에 PCR 제품 50 μL를로드합니다. 시료를 전기 영동하십시오 ( 예 : 110V에서 1 시간).
      4. 전기 영동 후 느린 흔들림으로 1 mg / mL ethidium bromide 용액 100 μL를 포함하는 2 회 증류수 100 mL에서 10 분간 겔을 염색한다. 느린 흔들림에서 두 번 증류수로 겔을 10 분 동안 씻으십시오. 수평 쉐이커를 사용하십시오.
        주의 :에 티듐 브로마이드는 독성 화합물입니다. 보호용 장갑과 면화 실험용 코트를 착용하십시오.
      5. 키트를 사용하여 젤의 해당 밴드에서 야생형 유전자 DNA를 정제하십시오. 얼룩이 진 젤을 UV 챔버에 넣음으로써 밴드를 시각화하십시오 (권장 파장 : 300 nm). 젤의 노출을 최소한으로 유지하십시오. DNA 정제 키트를 사용하고 제조업체의 지침을 따르십시오.
        주의 : 자외선은 위험합니다. 보호용 방패, 안경 및 면화 실험 코트를 착용하십시오.
    3. 정제 된 야생형 유전자와 pUC18 / 19 플라스미드 DNA를 제조자의 지침에 따라 제한 효소로 분해하십시오. 가능한 경우 빠른 소화 효소를 사용하십시오. 예를 들어, 10 μL의 초순수, 2 μL의 10X 버퍼, 1 μL의 Kpn I 제한 효소 및 1 μL의 Xba I 제한 효소에서 6 μL의 pUC18 DNA (300 ng / μL)를 소화 합니다. 반응을 37 ℃에서 30 분간 둔다.
      1. 제조자의 지침에 따라 제한 효소를 비활성화하십시오. 예를 들어, 이중 소화 반응 Kpn I- Xba I을 80 ℃에서 5 분 동안 비활성화시킨다.
    4. 믹스 인서트 : 체적 비율의 벡터 DNA3 : 1이다. 라이 게이션 반응에 대해서는 제조업체의 지침을 따르십시오. 가능한 경우 빠른 연결 효소를 사용하십시오 (25 분 동안 반응을 10 분 동안 그대로 두십시오).
      참고 : 일반적으로 키트를 사용한 정제 후 DNA 농도는 소화 및 라이 게이션 반응에 충분합니다. 예를 들어, rpoD DNA ( Kpn I- Xba I, 150 ng / μL) 6 μL, pUC18 DNA ( Kpn I- Xba I, 150 ng / μL) 3 μL, 2 배 완충액 10 μL, 초순수 1 μL 물, 및 T4 DNA 리가 아제 1 μL. 25 ° C에서 10 분 동안 연결 반응을 남겨주세요.
    5. Supplementary Materials에 설명 된대로 2 ~ 4 μL의 라이 게이션 반응으로 대장균 DH5α를 형질 전환하십시오. 형질 전환 된 세포를 고체 LB / Amp / X-gal / IPTG 플레이트에 플레이트한다. 접시를 밤새 37 ° C에서 방치하십시오.
    6. 흰색의 형질 전환 대장균 콜로니를 선택하고 새 LB / Amp 플레이트에 줄무늬를 만듭니다. 접시를 밤새 37 ° C에서 방치하십시오. </ li>
    7. 보충 교재에 설명 된대로 반응을 시퀀싱 할 후보를 선택하기 위해 식민지 PCR을 수행합니다. 후보자로부터 플라스미드 DNA를 추출하십시오. 또는 인서트를 클로닝하기 위해 사용 된 것과 동일한 제한 효소로 후보 플라스미드 DNA를 분해하십시오.
    8. 시퀀싱 서비스 공급자가있는 시퀀스 후보 구성 10 . DNA 어셈블러 11 ( 그림 1 , 단계 5)을 사용하여 silico로 서열 조립하십시오.
  6. PCR에 의한 플라스미드 파쇄와 제한 효소 소화.
    1. 야생형 및 ampR 유전자의 경우 브레이크 영역에서 전방 및 후방 올리고 뉴클레오타이드를 각각 디자인하십시오. silico 에서 해당 동의어 DNA 서열 (1.4 단계에서 얻음)에 대해 야생형 단편을 대체하십시오.
      참고 :이 동의어 DNA 서열은 제한 효소 부위를 포함합니다. 정방향 및 역방향 올리고 뉴클레오타이드는 t그는 효소 부위를 제한한다. 올리고 뉴클레오타이드는 21-27 개의 뉴클레오티드, 시토신 또는 구아닌으로 끝나야하며, 제한 효소 부위를 포함해야한다. 순방향 올리고 뉴클레오타이드는 주형 DNA상의 그 표적 부위와 동일한 서열을 갖는다. 역전 올리고 뉴클레오타이드는 주형 DNA상의 표적 부위의 역 상보 서열이다.
    2. PCR 반응 ( 예 : pUC18 rpoD 및 pUC18 sigA )에 대한 DNA 템플릿으로 두 wildtype 유전자 구조를 사용하십시오. 각 구조물 (pUC18 rpoD σ1- σ2 , pUC18 rpoD σ3-σ4, pUC18 sigA σ1-σ2 및 pUC18 sigA σ3-σ4)의 두 가지 보완 부분을 얻습니다 ( 그림 1 , 단계 6).
    3. DNA 샘플을 아가로 오스 겔 1-1.2 % [w / v]에 넣으십시오. 전기 영동 ( 예, 110V에서 1 시간)에 의해 DNA 주형으로부터 PCR 생성물을 분리한다. 또는 Dpn I로 PCR 반응을 분해하여 DNA 주형을 파괴 할 수 있습니다.
      참고 : DpnI 효소는 메틸화 된 DNA 서열 (5'-GATC-3 ')만을 인식합니다.
      1. DNA 정제 키트를 사용하여 샘플을 정제하십시오. 제조업체의 지침을 따르십시오.
    4. 제조업체의 지침에 따라 모든 상보 적 DNA 단편을 적절한 제한 효소로 이중 절단하십시오. 가능한 경우 빠른 분해 효소를 사용하십시오. 예를 들어, 제조사의 프로토콜을 사용하여 Afl II 및 Spe I로 pUC18rpoDσ1-σ2 DNA 단편을 이중 절단하십시오. 37 ° C에서 15 분 동안 소화 반응을 남겨 둡니다.
    5. 제조자의 지침에 따라 제한 효소를 비활성화하십시오. 예를 들어, Afl II Spe I을 80 ℃에서 20 분 동안 비활성화시킵니다.
  7. DNA 라이 게이션 및 세균 변형을 이용한 플라스미드 회수.
    1. 원하는 키메라 유전자를 조립하기 위해 용적 1 : 1 비율로 적절한 DNA 조각을 섞는다.1, 단계 7).
      참고 : 이렇게하면 ampR 유전자의 무결성이 복원되어 기능성 단백질을 생성합니다.
      1. 예를 들어 pUC18 rpoD σ1- σ2 DNA ( Afl II- Spe I, 150 ng / μL로 분해 됨) 4 μL, pUC18 sigA σ3-σ4 DNA ( Afl II- Spe I, 150 ng / μL) 4 μL, 2 배 완충액 10 μL, 초순수 2 μL 및 T4 DNA 리가 제 1 μL; 키트 정제 후 DNA 농도는 소화 및 후속 연결에 충분합니다. 라이 게이션 반응을 25 ℃에서 10 분 동안 남겨 두십시오.
    2. 키메라 어셈블리 연결 반응 (보충 자료) 3 ~ 5 μL와 대장균 DH5α를 변환합니다. 37 ° C 밤새 LB / Amp / X-gal / IPTG 플레이트에서 변형 세포를 성장시킵니다.
    3. 흰색의 형질 전환 대장균 콜로니를 선택하고 새 LB / Amp 플레이트에 줄무늬를 만듭니다. 37시에 하룻밤 사이에 둡니다.기음.
    4. 보충 교재에 설명 된대로 시퀀싱 반응에 대한 후보자를 선택하기 위해 식민지 PCR을 수행합니다. 전기 영동 (단계 2.3.2.1에서 설명)을 수행하여 1-1.2 % (w / v) 아가로 오스 겔에서 밴드를 시각화하십시오.
    5. 긍정적 인 후보자로부터 문화를 성장시킵니다. 플라스미드 DNA 정제 키트를 사용하여 플라스미드 DNA를 추출합니다.

2. 서열 후보 키메라 구조물

  1. 플라스미드 DNA의 품질이 서열 분석 서비스 제공자의 지침에 따라 서열 분석 반응에 충분한 지 확인하십시오. 정화 키트를 사용하여 DNA를 추출합니다. 예를 들어, 시퀀스 서비스 제공 업체의 인터넷 페이지에서 샘플에 대해 권장되는 DNA 농도에 특히주의하십시오. DNA 정량 도구를 사용하여 시료의 농도를 구하십시오.
  2. 시퀀싱 서비스 제공 업체와의 서열 후보 키메라 구조 10 .
  3. se 조립 in silico DNA 어셈블러 11을 사용하여 읽기를 시작합니다.
  4. 서열 정렬 도구 9 , 12를 사용하여 실 리코 설계 키메라 시퀀스 대 어셈블 어레이를 정렬합니다. 키메라 유전자가 성공적으로 융합되었는지 확인하십시오.

3. 준비하기

참고 : 살아있는 세포와 관련된 모든 단계는 분젠 버너가 켜져있는 깨끗한 층류 후드에서 수행되어야합니다.

  1. 대장균 DH5α 유능한 세포를 생산.
    1. 대장균 - 경쟁 세포를 생산하기 위해서는 공개 된 프로토콜 13을 따르거나 보충 자료를 참조하십시오. 또는 상업적으로 이용 가능한 적격 세포를 사용하십시오.
  2. 대장균 DH5α 유능한 세포를 형질 전환.
    1. 대장균 배양 물의 화학적 형질 전환을 위해, 공개 된 프로토콜을 따른다.class = "xref"> 13 또는 보충 자료 참조. 또는 박테리아 형질 전환을 위해 일렉트로 포 레이션을 사용하십시오. 상업적으로 이용 가능한 적격 세포를 사용하는 경우에는 제조업체의 지침을 따르십시오.
  3. E. coli DH5α로부터 게놈 및 플라스미드 DNA 정제.
    1. 보충 교재에 명시된대로 핵산 추출을 시중에서 구할 수있는 키트를 사용하거나 출판 된 프로토콜을 사용하십시오 13 .
  4. 식민지 PCR을 수행하십시오.
    1. 이 기술을 사용하여 후속 시퀀싱 반응을위한 후보 형질 전환 콜로니를 확인하십시오.
      참고 :이 방법은 서열의 무결성에 대한 최종 검증을 나타내지 않습니다. 이 기술에 대한 자세한 설명은 보충 자료 에서 제공됩니다.
  5. 솔루션 준비.
    1. 만나다
  6. CAPRRESI 프로토콜에 필요한 스크립트 및 시퀀스 파일을 다운로드하십시오.
    1. 원하는 종의 완전한 게놈 서열을 포함하는 유전자 뱅크 파일을 다운로드하고, 게놈 브라우저를 사용하여 선택한 유전자의 DNA 서열을 추출하여 fasta 파일 형식으로 저장하십시오. CAPRRESI 프로토콜에 필요한 Perl 스크립트를 다운로드하십시오. 스크립트와 시퀀스 파일을 같은 디렉토리에 저장하십시오.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

그림 1 은 CAPRRESI를 나타냅니다. 이 방법을 사용하여 2 개의 키메라 유전자를 2 개의 박테리아 1 차 시그마 인자 ( 즉, 대장균 RpoD 및 R. etli SigA)의 도메인을 교환함으로써 조립 하였다. rpoDsigA 유전자의 DNA 서열은 각각 GenBank 게놈 파일 NC_000913 및 NC_007761에서 Artemis Genome Browser 14 를 사용하여 얻었다. pUC18 벡터의 DNA 서열은 NCBI 서버의 뉴클레오티드 데이타베이스로부터 얻어졌다. 제한 효소 사이트의 in silico 분석은 REsearch.pl Perl 스크립트 (단계 1.2.2 참조)를 실행하여 DNA 서열에 대해 수행되었습니다. 이러한 결과는 올리고 뉴클레오타이드 디자인에 사용되었습니다 (1.2.3 단계). 외부 올리고 뉴클레오타이드는 야생형 유전자를 pUC18 다중 클로닝 부위로 클로닝하기위한 XbaIKpnI 제한 효소의 인식 부위를 포함 하였다. 포워드 올리고 뉴클레오티드는 또한 리보일부 결합 부위 ( 표 2 ). LB / Nal broth (37 ℃, 220 ~ 250rpm)에서 재조합 된 대장균 DH5α 세포와 PY / Nal / CaCl 2 broth (30 ℃, 220 ~ 250rpm)에서 성장한 R. etli CFN42 세포에서 게놈 DNA를 추출 하였다 ). 이 샘플은 야생형 유전자 증폭을위한 DNA 주형으로 사용되었습니다 (1.5.2 단계).

야생형 유전자는 Kpn I- Xba I 제한 효소로 이중 분해시킨 아가로 오스 겔 (DNA 정제 키트)에서 정제하고 pUC18 벡터에 클로닝 된 Taq high-fidelity DNA 중합 효소를 사용하여 증폭 시켰다 . 화학적으로 유능한 대장균 DH5α 세포를 야생형 구조 pUC18 rpoD 및 pUC18 sigA (단계 1.5.5)에 상응하는 5 μL의 연결 반응으로 형질 전환시켰다. 형질 전환 세포를 37 ℃에서 성장시킨 고체 LB / Amp / X-gal / IPTG 플레이트에서 선택 하였다. Sanger sequenc에서 Wildtype 구문을 확인했습니다.10 . Sanger 서열 판독은 MIRA 11을 사용하여 in silico로 조립되었습니다 (1.5.8 단계).

야생형 유전자의 아미노산 서열은 translate.pl 스크립트 (1.3.1 단계)를 실행하여 얻은 것입니다. 야생형 유전자를 Clustal 12 와 정렬 한 후, 암피실린 내성 유전자 ( ampR )와 야생형 1 차 시그마 인자에서 아미노산 영역 TLV와 NLR을 각각 선택했다 (1.3.3 단계). 이러한 아미노산 영역은 synonym.pl 스크립트를 실행하여 이들을 인코딩하는 가능한 모든 DNA 동의어 시퀀스를 계산하는 데 사용되었습니다 (1.4.1 단계). REsynonym.pl 스크립트는 이전에 생성 된 동의어 DNA 시퀀스 (step1.4.2)에서 발견 된 제한 효소 사이트를 검색했습니다. 야생형 서열과 비교하여 가장 적은 수의 변화를 도입 한 동의어 영역이 선택되었다. 1 차 시그마 인자 유전자의 경우, Rp의 야생형 서열oD (AACTTACGT) 및 SigA (AACCTTCGC)는 AA CTTAAG G로 교환되었다. 후자는 Afl II 사이트 (굵게 표시)를 포함한다. ampR 유전자의 경우, 야생형 서열 ACGCTGGTG는 그의 동의어 인 AC ACTAGT G와 교환되었다. ampR 유전자에 삽입 된 동의어 DNA 서열은 Spe I 부위 (굵은 글씨)를 함유 하였다. 상응하는 동의어 서열에 대한 야생형의 in silico 치환을 수행하여 서열 무결성 및 올리고 뉴클레오티드 디자인을 검증 하였다 (단계 1.2-1.4).

동의어 순서 변경은 적절한 올리고 뉴클레오타이드 ( 표 2 )와 DNA 형판 (단계 1.5.2)과 같은 야생형 구조를 사용하여 PCR에 의해 도입되었습니다. 증폭 반응은 pUC18 rpoD σ1- σ2 , pUC18 rpoD σ3-σ4, pUC18 sigA σ1-σ2 및 pUC18 sigA σ3-σ4의 4 개의 상보 적 부분을 생성 하였다. 보완 부품 dis시그마 요인뿐만 아니라 ampR 유전자를 파괴했다 . 상보적인 부분은 DNA 정제 키트를 사용하여 정제했다 (1.6.3 단계).

이들 상보적인 DNA 단편을 Afl II 및 Spe I 제한 효소로 이중 분해시켰다 (단계 1.6.4). CAPRRESI 설계에 따라, pUC18 rpoD σ1- σ2 DNA 단편을 pUC18 sigA σ3-σ4와 연결하여 키메라 01을 수득하고, pUC18 sigA σ1- σ2 를 pUC18 rpoD σ3-σ4와 결합시켜 키메라 02을 조립 하였다 (단계 1.7.1-1.7 .삼). 화학적으로 유능한 대장균 DH5α 세포를 pUC18 chim01 및 pUC18 chim02 의 라이 게이션 반응 5 ㎕로 형질 전환 시켰다 (단계 1.7.4). 형질 전환 세포를 37 ℃에서 성장시킨 고체 LB / Amp / X-gal / IPTG 플레이트에서 선택 하였다 (1.7.5 단계). 키메라 구조물은 Sanger sequencing 10 (2 단계)에 의해 확인되었다. 생거 시퀀스 rEAD는 MIRA 11을 사용하여 조립되었으며 그 결과 파일은 표 3에 나열되어 있습니다. 그림 2 는 파괴 영역에서 wildtype과 chimeric 유전자의 조합 된 서열의 정렬 (근육을 사용하여 수행) 9 를 보여줍니다.

그림 1
그림 1 : CAPRRESI 개요. 표현 : 유전자 (두꺼운 화살표), 기능적 플라스미드 (검은 색 동그라미) 및 올리고 뉴클레오타이드 (얇은 검은 색 화살표). 올리고 뉴클레오티드에 삽입 된 제한 효소 부위는 색상으로 나타난다. 약어 : Wt (야생형), FWD (포워드 올리고 뉴클레오티드), REV (역전사 올리고 뉴클레오타이드), ampR (암피실린 저항성 유전자), RES (제한 효소 부위), RE (제한 효소). 더 큰 버전을 보려면 여기를 클릭하십시오.이 그림의.

그림 2
도 2 : 조립 된 야생형 및 키메라 유전자 서열의 정렬. 조립 된 DNA 서열은 MUSCLE 9를 사용하여 정렬되었다. 서열은 MIRA 11 으로 조립 하였다. 동의어 시퀀스가 ​​검은 색으로 나타납니다. Afl II 인식 사이트는 밑줄이 그어져 있습니다. IUPAC 뉴클레오티드 코드 : R (A 또는 G) 및 K (G 또는 T). 구조 : rpoD (적색), sigA (청색), 키메라 01 서열 ( rpoD σ1-σ2- sigA σ3-σ4) 및 키메라 02 서열 ( sigA σ1-σ2- rpoD σ3-σ4). 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

해결책 구성 요소 명령
수량 화합물
Luria-Bertani (LB) 수프 5 g 효모 추출물 모든 성분을 물에 녹이십시오. 압력솥. 사용하기 전까지 실온에서 보관하십시오. 고체 LB 배지의 경우, 15 g의 세균 한천을 제법에 첨가하십시오.
10 g 카제인 펩톤
10 g NaCl
최대 1 L 이중 증류수
LB / Amp / X-gal / IPTG 플레이트 100 mL 녹은 고체 LB 배지 온화한 LB 배지에 모든 성분을 첨가하십시오. 배양 접시를 채우고 응고 할 때까지 기다리십시오. 분젠 버너가 장착 된 깨끗한 층류 후드에서 단계를 수행하십시오.
100 μL 암피실린 (Amp) [100 mg / mL]
100 μL X-gal [20 mg / ml]
50 μL 1M IPTG 용액
펩톤 효모 (PY) 배지 3g 효모 추출물 모든 성분을 물에 녹이십시오. 압력솥. 사용하기 전까지 실온에서 보관하십시오. 고체 PY 브로스의 경우 15 g의 세균 한천을 제법에 첨가하십시오. R. etli 배양에 사용하기 전에 1 M CaCl 2 용액 700 μL를 첨가한다.
5 g 카제인 펩톤
최대 1 L 이중 증류수
PY / CaCl2 / Nal 플레이트 100 mL 녹은 고체 PY 브로스 온화한 PY 수프에 모든 성분을 첨가하십시오. 페트리 접시를 채우고 응고 할 때까지 기다리십시오. 분젠 버너가 장착 된 깨끗한 층류 후드에서 단계를 수행하십시오.
700 μL 1M CaCl2 용액
100 μL 나리 딘산 (Nal) [20 mg / mL]
1 M 염화칼슘 (CaCl2) 용액 11.1 g CaCl2 CaCl 2 를 물에 녹인다. 압력솥. 실온에서 보관하십시오.
최대 100 mL 이중 증류수
트리스 -EDTA (TE) 10 : 1, pH 8.0 1 mL 1M 트리스 용액 모든 구성 요소를 혼합하십시오. 압력솥. 실온에서 보관하십시오.
400 μL 0.25M EDTA 용액
최대 100 mL 이중 증류수
TE 50:20 pH 8.0 5 mL 1M 트리스 용액 모든 구성 요소를 혼합하십시오. 압력솥. 실온에서 보관하십시오. </ td>
8 mL 0.25M EDTA 용액
최대 100 mL 이중 증류수
TE 10 : 1 10 mM NaCl 용액 58.4 mg NaCl TE 10 : 1에 NaCl을 녹인다. 압력솥. 실온에서 보관하십시오.
최대 100 mL TE 10 : 1 pH 8.0 용액
용해 용액 I 80 mg 리소자임 모든 성분을 물에 녹여 혼합합니다. 필터는 0.22 μm 필터를 사용하여 살균합니다. 실온에서 보관하십시오.
2 mL 0.5 M 글루코오스 용액
400 μL 0.5 M EDTA 용액
500 μL 1M 트리스 용액
최대 20 mL 멸균 된 2 중 증류수
용해 액 II 1.2 mL 5 M 수산화 나트륨 (NaOH) 용액 모든 성분을 물에 녹이십시오. 필터는 0.22 μm 필터를 사용하여 살균합니다. 실온에서 보관하십시오.
3 mL 10 % sodium dodecyl sulfate (SDS) 용액
최대 30 mL 멸균 된 2 중 증류수
용해 액 III 29.4 g 칼륨 아세테이트 (CH3COOK) 모든 성분을 물에 녹여 혼합합니다. 필터는 0.22 μm 필터를 사용하여 살균합니다. 실온에서 보관하십시오.
11.5 mL 절대 아세트산 (CH 3 COOH)
최대 100 mL 멸균 된 2 중 증류수
1 M 염화 마그네슘 (MgCl2) 용액 9.5 g MgCl2 w에서 MgCl 2 를 용해시킨다.ater. 압력솥. 실온에서 보관하십시오.
최대 100 mL 이중 증류수
3 M 아세트산 나트륨 (CH3COONa) 용액 24.6 g CH 3 COONA CH 3 COONa를 물에 녹입니다. 압력솥. 실내 온도에 보관하십시오.
최대 100 mL 이중 증류수
10 % SDS 용액 10 g SDS SDS를 저속에서 자기 교반 막대로 물에 용해시킨다. 압력솥. 실온에서 보관하십시오.
최대 100 mL 이중 증류수
3 M CH 3 COOK 용액 29.4 g CH 3 요리 CH 3 COOK를 물에 녹입니다. 필터는 0.22 μm 필터를 사용하여 살균합니다. 실온에서 보관하십시오. 최대 100 mL 멸균 된 2 중 증류수
프로 테이나 제 K 용액 5 mg 프로 테이나 제 K TE 50:20 용액에 프로 테이나 제 K를 용해시킨다. 37 ° C에서 1 시간 가열합니다. -20 ºC에서 보관하십시오.
최대 1 mL TE 50:20 pH 8.0 용액
RNase 용액 10 mg RNase RNase를 물에 녹입니다. 95 ℃에서 10 분간 가열하십시오. -20 ºC에서 보관하십시오.
최대 1 mL 멸균 된 초순수
1 M 이소 프로필 -β-D- 티오 갈 락토 시드 (IPTG) 용액 238.3 mg IPTG IPTG를 물에 녹이십시오. 필터는 0.22 μm 필터를 사용하여 살균합니다. -20 ºC에서 보관하십시오.
최대 1 mL 멸균 된 초순수
20 mg 엑스 걸 X-gal을 물에 녹이십시오. 필터는 0.22 μm 필터를 사용하여 살균합니다. -20 ºC에서 보관하십시오.
최대 1 mL 멸균 된 초순수
페놀 : 클로로포름 : 이소 아밀 알코올 24 : 24 : 1 용액 24 mL 페놀 모든 구성 요소를 혼합하십시오. 4 ℃의 호박색으로 덮인 병에 보관하십시오. 주의! 위험한 물질. 보호 안경, 장갑 및 면화 실험 가운을 착용하십시오. 추출 후드를 사용하십시오. 취급 중에 Bunsen 버너 또는 다른 화재 원인의 전원을 켜지 마십시오. 대안 : 시판용 페놀 : 클로로포름 : 이소 아밀 알코올 25 : 24 : 1 용액
24 mL 클로로포름
1 mL 이소 아밀 알코올
0.5 M 글루코오스 용액 9 g 지루시스 포도당을 물에 녹입니다. 필터는 0.22 μm 필터를 사용하여 살균합니다. 실온에서 보관하십시오.
최대 100 mL 멸균 된 초순수
0.5M 에틸렌 디아민 테트라 아세트산 (EDTA) pH 8.0 용액 14.6 g EDTA EDTA를 물에 용해시킨다. 5 M NaOH 용액으로 pH를 조절한다. 압력솥. 실온에서 보관하십시오.
최대 100 mL 이중 증류수
0.25 M EDTA pH 8.0 용액 7.3 g EDTA EDTA를 물에 용해시킨다. 5 M NaOH 용액으로 pH를 조절한다. 압력솥. 실온에서 보관하십시오.
최대 100 mL 이중 증류수
1M 트리스 pH 8.0 용액 12.1 g 트리스 물에 트리스를 녹이십시오. pH 조절절대 염산 (HCl). 압력솥. 실온에서 보관하십시오.
최대 100 mL 이중 증류수
5 M 수산화 나트륨 (NaOH) 용액 19.9 g NaOH NaOH를 물에 녹입니다. 실온에서 보관하십시오. 주의! 가성 화합물.
최대 100 mL 멸균 된 2 중 증류수
0.1M NaOH 용액 399 mg NaOH NaOH를 물에 녹입니다. 실온에서 보관하십시오.
최대 100 mL 멸균 된 2 중 증류수
나리 딕산 (Nal) 스톡 용액 60 mg 날리 딕산 Nal을 물에 녹이십시오. 필터는 0.22 μm 필터를 사용하여 살균합니다. 4 ºC에서 보관하십시오.
최대 3 mL 0.1 MNaOH 용액
암피실린 (Amp) 스톡 용액 300 mg 암피실린 Amp를 물에 용해시킨다. 필터는 0.22 μm 필터를 사용하여 살균합니다. 4 ºC에서 보관하십시오.
최대 3 mL 멸균 된 2 중 증류수
10x 트리스 아세테이트 -EDTA 완충액 48.4 g 트리스 모든 성분을 물에 녹이십시오. 압력솥. 실온에서 보관하십시오.
20 ml 0.5 M EDTA 용액
11.44 ml 빙초산
최대 1 L 이중 증류수

표 1 : 용액 준비. 용액 준비 지침.

아니. 암호 순서 길이 (nt) 풍모
1 RpoD-FWD GC TCTAGA GA AGGAGA TATCATATGGAGCAAAACCCGCAGTCA 43 XbaI 사이트; 야생형 유전자 증폭 및 벡터 클로닝
2 RoD-REV GG GGTACC TTAATCGTCCAGGAAGCTACG 29 KpnI 사이트; 야생형 유전자 증폭 및 벡터 클로닝
SigA-FWD GC TCTAGA GA AGGAGA TATCATATGGACACCAAGGTCAAAGAG 43 XbaI 사이트; 야생형 유전자 증폭 및 벡터 클로닝
4 SigA-REV GG GGTACC TTAGCTGTCCAGAAAGCTTCT </ td> 29 KpnI 사이트; 야생형 유전자 증폭 및 벡터 클로닝
AmpR-FWD AC ACTAGT GAAAGTAAAAGAT 21 SpeI 사이트 삽입 동의어 돌연변이 ampR 유전자의 파괴
4 AmpR-REV TC ACTAGT GTTTCTGGGTGAG 21 SpeI 사이트 삽입 동의어 돌연변이 ampR 유전자의 파괴
5 σ2RpoD-FWD AA CTTAAG GCTGGTTATTTCTATCGCT 27 AflII 사이트 삽입, 동의어 변이. chim01-02의 건설
6 σ2RpoD-REV GC CTTAAG TTCGCTTCAACCATCTCTT 27 AflII 사이트 삽입, 동의어 변이. chim01-02의 건설
7 σ2SigA-FWD AA CTTAAG GCTCGTCATTTCAATCGCC 27 AflII 사이트 삽입, 동의어 변이. chim01-02의 건설
8 σ2SigA-REV GC CTTAAG TTCGCTTCGACCATTTCCT 27 AflII 사이트 삽입, 동의어 변이. chim01-02의 건설

표 2 : 올리고 뉴클레오티드 서열. 제한 효소 부위는 밑줄이 그어져 있습니다. Ribosome 바인딩 사이트 : 굵게.

구성 시퀀스 파일 품질 파일
키메라 01 chim01_out.unpadded.fasta chim01_out.unpadded.fasta.qual
chim01_A3 / B3 / E2 / F2 / G2 /H2.pdf
키메라 02 chim02_out.unpadded.fasta chim02_out.unpadded.fasta.qual
chim02_C3 / D3 / E3 / F3 / G3 / H3.pdf
RPD rpod_out.unpadded.fasta rpod_out.unpadded.fasta.qual
시가 siga_out.unpadded.fasta siga_out.unpadded.fasta.qual

표 3 : MIRA 어셈블러 및 DNA 시퀀서로 얻은 시퀀스 파일. MIRA 11 소프트웨어로 매핑 옵션을 사용하여 키메라 및 야생형 구조에서 Sanger 시퀀싱 읽기를 조립했습니다. 키메라 시퀀싱의 크로마토 그램은 PDF 파일로 나타납니다.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

CAPRRESI는 PRM 2 의 대안으로 설계되었습니다. 원본 PRM은 강력한 기술입니다. 그것은 선택된 유전자의 어떤 부분을 따라 DNA 서열의 융합을 허용한다. PRM의 경우 야생형 유전자를 동일한 플라스미드에 클로닝해야합니다. 그 후, 올리고 뉴클레오타이드는 플라스미드에서 발견되는 야생형 및 항생제 내성 유전자 내에서 설계된다. 플라스미드 혼란은 둔기가 끝난 고 충실도의 DNA 중합 효소와 이전에 고안된 올리고 뉴클레오타이드를 사용하여 PCR로 얻을 수 있습니다. 상보 적 PCR 산물의 라이 게이션은 키메라 유전자를 조립하고 항생제 내성 카세트를 복원하여 기능적 플라스미드 회복을 가져온다. PRM은 동일한 플라스미드 백그라운드에서 키메라 유전자 라이브러리의 구축을 가능하게합니다. 불행히도, blunt-ended DNA 서열의 연결은 기술적으로 힘들 수 있습니다. 겹쳐지는 PCR 단편 1에 의한 키메라 조립은 또한 DNA 중합 효소가 무딘 말단 제품을 생성하고각 반응에 대한 DNA 정제. 이 기술로 조립 된 키메라 유전자는 선형 DNA 산물입니다. 대상 벡터에 각 구성을 복제하면 추가 분석이 지연 될 수 있습니다.

CAPRRESI는 PRM의 많은 장점을 활용하고 동의어 DNA 서열 영역에 제한 효소 부위를 사용하여 상보적인 DNA 단편의 연결을 단순화합니다. 이러한 이유로 CAPRRESI는 둔기가 끝난 DNA 중합 효소를 필요로하지 않습니다. 동의어 DNA 서열의 사용은 키메라 조립을위한 융합 부위를 억제하지만 라이 게이션 효율을 향상시킨다. CAPRRESI에서 소개 된 또 다른 중요한 수정은 키메라가 조립되어 pUC18 / 19 벡터로 처리된다는 것입니다. 이들 벡터는 앞서 언급 한 바와 같이 몇 가지 유리한 특징을 가지고있다. 키메라 DNA는 E. coli 숙주에서 구축 벡터를 증식시킴으로써 얻을 수있다. 최종 플라스미드 ( 예를 들어 발현 벡터) 내로 키메라 유전자를 연속적으로 클로닝하는 것은 때로는필수.

CAPRRESI는 또한 DNA와 아미노산 서열의 in silico 취급에 의존합니다. Ad hoc Perl 스크립트는 야생형 유전자를 복제하기위한 적절한 제한 효소의 선택, 파괴 영역 (키메라 어셈블리의 경우)에 해당하는 모든 동의어 DNA 서열의 계산 및 플라스미드 복구를 단순화하기위한 제한 효소의 확인을 가능하게합니다. 이러한 조건을 감안할 때, CAPRRESI는 단백질 암호 유전자를 융합시키는 대안입니다. CAPRRESI 프로토콜의 중요한 단계는 1) 파괴 영역의 선택과 2) PCR 산물의 정제입니다. 속보 영역은 동의어 시퀀스가 ​​계산되는 스트레칭이며 야생형 시퀀스에는없는 제한 효소 사이트를 생성합니다. 키메라 조립을위한 제한 효소 부위의 사용은 평활 말단 제품을 생산하고 라이 게이션 반응을 용이하게하는 DNA 폴리머 라제에 대한 필요성을 제거합니다. 모든 지역에서 사용할 수있는 제한 효소 부위가있는 것은 아닙니다. fo이런 이유 때문에 최고의 서열 스트레치가 발견 될 때까지 한 번에 하나의 아미노산만큼 절단 부위를 이동시키는 것이 좋습니다. in silico 디자인이 파괴 영역의 이동을 허용하지 않거나 서열 스트레치가 동의어 DNA 서열을 적절한 제한 효소 부위와 결핍 시키면 중복되는 올리고 뉴클레오타이드를 사용하여 표적 유전자를 융합시키고 동의어 DNA 서열을 암피실린 내성 유전자에 도입하는 것이 바람직하다 (벡터에 발견) 만. 이러한 방식으로, 유전자는 어느 부분에서나 융합 될 수 있으며, 플라스미드 회복은 유일한 하나의 사이트 (하나의 제한 효소로 소화 됨)의 연결에 의존한다. CAPPRESI의 유연성은 다른 기술과 함께 수행 될 수 있습니다.

PCR 산물의 정제는 주형 DNA를 제거하기 위해 수행되어 상보적인 DNA 단편의 연결 후 부모 플라스미드 오염 가능성을 줄입니다. 이 두 가지 중요한 단계를 수행하면 박해가 향상됩니다.화학적으로 유능한 (CaCl2) 또는 전기 전자 성 E. coli 세포로 CAPRRESI를 수행 할 수 있도록 올바르게 조립 된 구조물의 수 (terial transformation efficiency). 첫 번째 유형의 유능한 세포는 대부분의 실험실에서 세균 변형에 사용되는 가장 경제적 인 대장균 배양 원을 의미합니다. 이전에 표시된 모든 기능으로 인해 CAPRRESI는 키메라 조립에 유용한 옵션입니다.

더욱이, CAPRRESI는 중복 된 PCR 단편 또는 플라스미드 회복 기술과 함께 작용할 수있다. 예를 들어, 상보적인 DNA 부분 당 2 개의 동의어 서열을 삽입하는 대신에, 목적하는 파괴 영역 (표적 야생형 유전자상의)은 오버래핑 올리고 뉴클레오티드를 사용하여 개재 서열을 융합시킬 수있다. 동의어 서열의 도입은 pUC18 / 19 벡터의 ampR 유전자로 제한 될 수 있으며, 플라스미 를 복원하기 위해 단지 하나의 제한 효소의 사용으로 이어진다d 무결성. 이러한 미래의 응용은 라이 게이션 효율을 저하시키지 않으면 서 임의의 유형의 DNA 서열 ( 즉, 단백질 코딩 유전자뿐만 아니라)의 융합을 허용함으로써 CAPRRESI를 강화시킬 수있다.

CAPRRESI를 시험하기 위해 2 개의 야생형 1 차 시그마 인자 유전자 인 rpoD ( 대장균 )와 sigA ( R. etli )의 영역을 교환하여 2 개의 키메라 시그마 인자를 조립했다. 모든 알려진 1 차 시그마 팩터는 σ1에서 σ4까지 4 개의 영역을 유지합니다. 키메라 01은 RpoDσ1-σ2와 SigAσ3-σ4로 구성되는 반면, 키메라 02는 SigAσ1-σ2와 RpoDσ3-σ4를 갖는다. 키메라 구조의 완전성은 Sanger sequencing 10에 의해 입증되었다 ( 그림 2 ).

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

저자는 경쟁적인 금전적 이해 관계가 없다고 선언합니다.

Acknowledgments

이 작품은 Consejo Nacional de Ciencia y Tecnología, CONACYT, México (보조금 번호 154833) 및 Universidad Nacional Autónoma de México에서 지원되었습니다. 저자는 Víctor González, Rosa I. Santamaría, Patricia Bustos 및 Soledad Juárez에게 행정적이고 기술적 인 조언을 해주신 것에 감사드립니다.

Materials

Name Company Catalog Number Comments
Platinum Taq DNA polymerase High Fidelity Thermo Fisher 11304011 Produces a mix of blunt/3’-A overhang ended PCR products
High pure plasmid isolation kit Roche 11754785001 Used for all plasmid purification reactions
High pure PCR product purification kit Roche 11732676001 Used for all PCR purification reactions from agarose gels
AflII restriction enzyme New England Biolabs R0520L Recognizes sequence 5’-CTTAAG-3’ and cuts at 37 °C
KpnI-HF restriction enzyme New England Biolabs R3142L Recognizes sequence 5’-GGTACC-3’ and cuts at 37 °C
SpeI-HF restriction enzyme New England Biolabs R3133L Recognizes sequence 5’-ACTAGT-3’ and cuts at 37 °C
XbaI restriction enzyme New England Biolabs R0145L Recognizes sequence 5’-TCTAGA-3’ and cuts at 37 °C
Ampicillin sodium salt Sigma Aldrich A0166-5G Antibiotics
Nalidixic acid Sigma Aldrich N8878-5G Antibiotics
Yeast Extract Sigma Aldrich Y1625-1KG Bacterial cell culture
Casein peptone Sigma Aldrich 70171-500G Bacterial cell culture
NaCl Sigma Aldrich S9888-1KG Sodium chloride
Agar Sigma Aldrich 05040-1KG Bacterial cell culture
XbaI restriction enzyme Thermo Fisher FD0684 Fast digest XbaI enzyme
KpnI restriction enzyme Thermo Fisher FD0524 Fast digest KpnI enzyme
Quick Ligation Kit New England Biolabs M2200S Fast DNA ligation kit
AflII restriction enzyme Thermo Fisher FD0834 Fast digest AflII enzyme
SpeI restriction enzyme Thermo Fisher FD1253 Fast digest SpeI enzyme

DOWNLOAD MATERIALS LIST

References

  1. Horton, R. M., Hunt, H. D., Ho, S. N., Pullen, J. K., Pease, L. R. Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene. 77, (1), 61-68 (1989).
  2. Vos, M. J., Kampinga, H. H. A PCR amplification strategy for unrestricted generation of chimeric genes. Anal. Biochem. 380, (2), 338-340 (2008).
  3. Hawkins, N. C., Garriga, G., Beh, C. T. Creating Precise GFP Fusions in Plasmids Using Yeast Homologous Recombination. Biotechniques. 34, (1), 1-5 (2003).
  4. Sander, J. D., Joung, J. K. CRISPR-Cas systems for editing, regulating and targeting genomes. Nat Biotechnol. 32, (4), 347-355 (2014).
  5. Nagy, A. Cre recombinase: The universal reagent for genome tailoring. Genesis. 26, (2), 99-109 (2000).
  6. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods. 6, (5), 343-345 (2009).
  7. Norrander, J., Kempe, T., Messing, J. Construction of improved M13 vectors using oligodeoxynucleotide-directed mutagenesis. Gene. 26, (1), 101-106 (1983).
  8. Gruber, T. M., Gross, C. A. Multiple sigma subunits and the partitioning of bacterial transcription space. Annu Rev Microbiol. 57, 441-466 (2003).
  9. Edgar, R. C. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 32, (5), 1792-1797 (2004).
  10. Macrogen Inc. Seoul, Rep. Of Korea. Available from: http://dna.macrogen.com/eng/index.jsp (2016).
  11. Chevreux, B. MIRA: an automated genome and EST assembler. Available from: http://www.chevreux.org/thesis/index.html 1-161 (2005).
  12. Thompson, J. D., Gibson, T. J., Higgins, D. G. Multiple sequence alignment using ClustalW and ClustalX. Curr Protoc Bioinformatics. Chapter 2 (Unit 2.3) 1-22 (2002).
  13. Sambrook, J., Russell, D. W. Molecular Cloning: A laboratory manual. CSHLP. (2001).
  14. Rutherford, K., et al. Artemis: sequence visualization and annotation. Bioinformatics. 16, (10), 944-945 (2000).
카스트레 : 플라스미드 회수 및 제한 효소 부위 삽입에 의한 키메라 조립
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Santillán, O., Ramírez-Romero, M. A., Dávila, G. CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion. J. Vis. Exp. (124), e55526, doi:10.3791/55526 (2017).More

Santillán, O., Ramírez-Romero, M. A., Dávila, G. CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion. J. Vis. Exp. (124), e55526, doi:10.3791/55526 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter