Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

CAPRRESI: montagem de quimera por recuperação de plasmídeos e restrição de inserção do site enzimático

doi: 10.3791/55526 Published: June 25, 2017

Summary

Aqui, apresentamos a montagem de quimera por recuperação de plasmídeo e inserção de site de enzima de restrição (CAPRRESI), um protocolo baseado na inserção de sites de enzimas de restrição em seqüências de DNA sinônimo e recuperação de plasmídeo funcional. Este protocolo é um método rápido e de baixo custo para a fusão de genes que codificam proteínas.

Abstract

Aqui, apresentamos a montagem da quimera por recuperação do plasmídeo e inserção do sistema enzimático de restrição (CAPRRESI). CAPRRESI beneficia de muitos pontos fortes do método original de recuperação de plasmídeos e introduz a digestão de enzimas de restrição para facilitar as reações de ligação de DNA (necessárias para a montagem da quimera). Para este protocolo, os usuários clonam os genes do tipo selvagem no mesmo plasmídeo (pUC18 ou pUC19). Após a seleção in silico de regiões de sequências de aminoácidos onde as quimeras devem ser montadas, os usuários obtêm todas as seqüências de DNA sinônimo que as codificam. Os scripts perl ad hoc permitem aos usuários determinar todas as seqüências de DNA sinônimo. Após este passo, outro script Perl procura sites de enzimas de restrição em todas as seqüências de DNA sinônimo. Esta análise in silico também é realizada utilizando o gene de resistência à ampicilina ( ampR ) encontrado em plasmídeos pUC18 / 19. Os usuários projetam oligonucleótidos dentro de regiões sinônimas para interromper genes de tipo selvagem e ampR por PCR. Depois do obtAinando e purificando fragmentos de DNA complementares, a digestão com enzimas de restrição é realizada. A montagem da quimera é conseguida ligando fragmentos de DNA complementares apropriados. Os vetores pUC18 / 19 são selecionados para CAPRRESI porque oferecem vantagens técnicas, como tamanho reduzido (2.686 pares de bases), alto número de cópias, características vantajosas de reação de sequenciação e disponibilidade comercial. O uso de enzimas de restrição para o conjunto de quimeras elimina a necessidade de polimerases de DNA que produzem produtos de extremidade contundente. CAPRRESI é um método rápido e de baixo custo para a fusão de genes que codificam proteínas.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

A montagem de genes quiméricos tem sido amplamente utilizada na biologia molecular para elucidar a função protéica e / ou para fins biotecnológicos. Existem diferentes métodos para a fusão de genes, tais como a ampliação de produto de PCR em sobreposição 1 , a recuperação de plasmídeo 2 , a recombinação homóloga 3 , os sistemas 4 de CRISPR-Cas9, a recombinação 5 dirigida ao local e a montagem 6 de Gibson. Cada um destes oferece vantagens técnicas diferentes; Por exemplo, a flexibilidade do design de PCR sobreposto, a seleção in vivo de construções durante a recuperação do plasmídeo ou a alta eficiência dos sistemas CRISPR-Cas9 e Gibson. Por outro lado, podem surgir algumas dificuldades ao executar alguns desses métodos; Por exemplo, as duas primeiras abordagens dependem de fragmentos de DNA de extremidade frouxa, e a ligação destes tipos de produtos pode ser tecnicamente desafiadora em comparação com a SticLigação com ky-ended. A recombinação direta do site pode deixar vestígios de seqüências de DNA extra (cicatrizes) no original, como no sistema CreWloxP 5 . CRISPR-Cas9 às vezes pode modificar outras regiões do genoma além do site alvo 4 .

Aqui, apresentamos a montagem de quimera por recuperação de plasmídeo e inserção de local de enzima de restrição (CAPRRESI), um protocolo para a fusão de genes codificadores de proteínas que combina o método de recuperação de plasmídeo (PRM) com a inserção de sítios de enzimas de restrição em sequências de DNA sinônimo, aumentando a eficiência de ligadura . Para garantir a integridade da sequência de aminoácidos, os sítios de enzimas de restrição são inseridos em trechos de seqüência de DNA sinônimo. Entre os benefícios do CAPPRESI, é que pode ser realizada usando reagentes / ferramentas de laboratório comuns ( por exemplo , enzimas, células competentes, soluções e termociclador) e que pode dar resultados rápidos (quando as enzimas apropriadas são usadas). Baseando-se na restriçãoOs sites enzimáticos que emergem de seqüências de DNA sinônimas podem limitar a seleção dos pontos de fusão exatos dentro das proteínas de interesse. Nesses casos, os genes alvo devem ser fundidos usando oligonucleótidos sobrepostos, e os locais de enzimas de restrição devem ser inseridos no gene de resistência do vetor.

CAPRRESI consiste em sete etapas simples ( Figura 1 ): 1) seleção do vetor de clonagem, pUC18 ou pUC19 6 ; 2) análise in silico das sequências do tipo selvagem a serem fundidas; 3) seleção de regiões de quebra para montagem de quimera e ruptura de plasmídeo; 4) geração in silico de sequências de DNA sinônimo contendo sites de enzimas de restrição; 5) clonagem independente dos genes do tipo selvagem no plasmídeo selecionado; 6) interrupção do plasmídeo por PCR, seguida de digestão com enzimas de restrição; E 7) recuperação de plasmídeo usando ligadura de DNA e transformação bacteriana. Os genes quiméricos produzidos por esta técnica devem ser verificados wSeqüenciamento.

Os vetores pUC18 / 19 oferecem vantagens técnicas para a clonagem e a montagem de quimeras, como tamanho pequeno ( ie, 2.686 pares de bases), número de cópias elevado, características de reação de seqüenciamento vantajosas e disponibilidade comercial 7 . Aqui, um hospedeiro Escherichia coli foi usado para montar e lidar com as quimeras porque as culturas bacterianas são baratas e crescem rapidamente. Diante disso, será necessária a clonagem subsequente dos fragmentos de fusão nos plasmídeos alvo finais ( por exemplo, vetores de expressão como pRK415 em bactérias ou pCMV em células de mamífero).

CAPRRESI foi testado para a fusão de dois genes primários do fator sigma: E. colirpoD e Rhizobium etlisigA . Os fatores sigma primários são subunidades de ARN polimerase responsáveis ​​pela iniciação da transcrição e consistem em quatro domínios ( ie, σ1, σ2, σ3 e σ4) 8 . A sequência de aminoácidos lengtH de proteínas codificadas por rpoD e sigA são 613 e 685, respectivamente. RpoD e SigA compartilham 48% de identidade (98% de cobertura). Esses fatores sigma primários foram divididos em dois fragmentos complementares entre as regiões σ2 e σ3. Dois genes quiméricos foram montados de acordo com este projeto: quimera 01 (RpoDσ1-σ2 + SigAσ3-σ4) e quimera 02 (SigAσ1-σ2 + RpoDσ3-σ4). Os produtos de fusão de DNA foram verificados por sequenciação.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Protocolo CAPRRESI

NOTA: A Figura 1 representa o protocolo CAPRRESI geral. Esta técnica é baseada em um projeto in silico e a construção subsequente das quimeras desejadas.

  1. Seleção do plasmídeo de clonagem, pUC18 ou pUC19.
    1. Selecione o vetor pUC que melhor se adequa às demandas técnicas.
      NOTA: Ambos os vetores têm a mesma seqüência, exceto para a orientação do site de clonagem múltipla. Isto é importante para o desenho de oligonucleótidos e a ruptura do plasmídeo PCR.
  2. Análise in silico dos genes do tipo selvagem e sequências pUC18 / 19.
    1. Obtenha as seqüências de DNA dos genes do tipo selvagem e guarde-os em um arquivo formato FASTA ( por exemplo, genes.fas).
      NOTA: As seqüências de vetores pUC18 / 19 estão contidas no arquivo pUC.fas ( Figura 1 , passo 1).
    2. Determine qual restrição enzYmes não cortam os genes do tipo selvagem e as seqüências pUC18 / 19 executando o script REsearch.pl. Alternativamente, execute uma pesquisa de site de enzimas de restrição com uma ferramenta online ( Figura 1 , etapa 2).
      1. Digite o seguinte em um terminal:
        Perl REsearch.pl genes.fas
        Perl REsearch.pl pUC.fas
        NOTA: Estes comandos criarão os seguintes arquivos de saída: genes_lin.fas, genes_re.fas, pUC_lin.fas e pUC_re.fas.
      2. Selecione as enzimas de restrição apropriadas para clonar os genes do tipo selvagem no site de clonagem múltipla do vetor pUC18 / 19 escolhido comparando os arquivos genes_re.fas e pUC.fas. Escolha a orientação da inserção em relação ao gene de resistência à ampicilina ( ampR ) do vetor pUC18 / 19.
    3. Desenhe os oligonucleótidos para trás e reverso para amplificar a região de codificação dos genes do tipo selvagem (oligonucleótidos externos). Inclua o local adequado da enzima de restrição em cada extremidade 5 'Dos oligonucleótidos; Isso irá definir a orientação da inserção.
      1. Incluir um local de ligação ao ribossoma funcional nos oligonucleótidos para a frente.
      2. Insira ambos os genes de tipo selvagem na mesma orientação dentro do vetor.
  3. Seleção das regiões de quebra para montagem de quimera e ruptura de plasmídeos.
    1. Obtenha a sequência de aminoácidos do tipo selvagem e os genes ampR executando o script translate.pl ( Figura 1 , passo 3).
      1. Digite o seguinte em um terminal:
        Perl translate.pl genes.fas
        Perl translate.pl ampR.fas

        NOTA: Este script criará os seguintes arquivos de saída: genes_aa.fas e ampR_aa.fas.
    2. Alinhe globalmente as duas sequências de aminoácidos de tipo selvagem com um software apropriado ( por exemplo, MUSCLE) 9 .
    3. Selecione as regiões de ruptura desejadas (3-6 aminoácidos) para quimera asseCom base no alinhamento da sequência. Salve-os em um arquivo no formato FASTA ( por exemplo , regions.fas).
    4. Localize as sequências de DNA que codificam os trechos de aminoácidos selecionados em ambos os genes do tipo selvagem.
  4. Geração in silico de sequências de DNA sinônimo contendo sites de enzimas de restrição.
    1. Obtenha todas as seqüências de DNA de sinônimo que codificam para cada estiramento da sequência de aminoácidos selecionado como regiões de ruptura ( Figura 1 , etapa 4); Essas seqüências foram armazenadas no arquivo regions.fas.
      1. Digite o seguinte em um terminal:
        Perl synonym.pl regions.fas
        NOTA: Este script criará o arquivo de saída region_syn.fas.
    2. Procure por sites de enzimas de restrição encontrados em seqüências de DNA sinônimo.
      1. Digite o seguinte em um terminal: perl REsynonym.pl regions_syn.fas
        NOTA: Este script criará o arquivo de saída region_syn-re.fas.
    3. Escolha uma enzima de restrição que é compartilhada entre as sequências de sinônimo de ambos os genes do tipo selvagem; Este site será usado para montar quimeras através da digestão de enzimas de restrição. Verifique se a enzima de restrição escolhida não corta nem os genes do tipo selvagem nem as sequências do vetor pUC18 / 19.
      1. Compare as enzimas de restrição encontradas nos arquivos genes_re.fas, pUC_re.fas e regions_syn-re.fas.
    4. Em silico, substitua os originais por suas seqüências de DNA sinônimo nos loci correspondentes em ambos os genes de tipo selvagem. Anexe sinônimo de seqüências de DNA ao arquivo de seqüência de tipos selvagens (genes.fas).
    5. Obtenha a sequência de aminoácidos dos genes contidos no arquivo genes.fas ( perl translate.pl genes.fas ).
    6. Alinhar as sequências de aminoácidos traduzidas a partir de sequências de DNA de tipo selvagem e sinônimo. Verifique se ambas as seqüências são as mesmas.
    7. Repita todas as etapas desta seção com o gene ampR presente no pUVetor C18 / 19.
      NOTA: O objetivo é interromper o gene ampR (arquivo ampR.fas) em duas partes complementares. A enzima de restrição selecionada para interromper o gene ampR deve ser diferente da utilizada para a montagem da quimera.
  5. Clonagem independente dos dois genes de tipo selvagem no vetor pUC18 / 19 selecionado (Figura 1, passo 3).
    1. Purificar o DNA plasmídico pUC18 / 19 escolhido usando um kit de purificação de DNA plasmídico.
      1. Por exemplo, transformar E. coli DH5a com plasmídeo pUC18 e crescer os transformantes durante a noite a 37 ° C em Ampicilina sólida LB-0.3 mg / mL (Amp). Escolha uma colônia de transformantes, inocule uma nova placa Amp LB-0.3 mg / mL e aumente durante a noite a 37 ° C.
      2. Faça parte da cultura anterior e cresça-a em LB-0.3 mg / mL Amp líquido por 6-8 h a 37 ° C. Extraia o DNA do plasmídeo usando um kit.
    2. PCR amplifica genes de tipo selvagem a partir do DNA genômico total usando o apropriadoOligonucleótidos externos de riato. Use, se possível, uma polimerase de DNA de alta fidelidade. Selecione a DNA polimerase que maximiza o rendimento. Execute PCR de acordo com as diretrizes do fabricante e a temperatura de fusão dos oligonucleótidos.
      1. Execute ciclos de PCR, dependendo da polimerase de DNA, tamanho de amplicão, modelo e oligonucleótidos utilizados. Por exemplo, para amplificar o DNA de rpoD , prepare uma reação de 50 μL: 5 μL de tampão 10x, 2 μL de MgSO4 50 mM, 1 μL de mistura dNTP 10 mM, 2 μL de cada oligonucleótido 10 μM (Tabela 2), 2 ΜL de ADN modelo (DNA total de E. coli DH5a), 35,8 μL de água ultra-pura e 0,2 μL de DNA-polimerase de alta fidelidade. Execute os seguintes ciclos de PCR: 1 min a 94 ° C para a desnaturação inicial seguido de 30 ciclos de amplificação (30 s a 94 ° C para desnaturação, 30 s a 60 ° C para recozir os oligonucleótidos e 2 min a 68 ° C Para estender).
      2. Dissolver 1,2 g deAgarose em 100 mL de água de dupla destilação, aquecendo-os no microondas. Monte uma bandeja de gel e pente e coloque-os no rotor de gel horizontal. Encha a bandeja de gel com a solução de agarose derretida e deixe solidificar. Remova o pente.
      3. Coloque o gel na câmara de eletroforese. Câmara de enchimento com tampão 1x Tris-acetato-EDTA. Carregar 50 μL de produtos de PCR nos poços de gel. Eletroforese as amostras ( por exemplo , a 110 V por 1 h).
      4. Após a eletroforese, mancha o gel em 100 mL de água duplamente destilada contendo 100 μL de solução de brometo de etidio 1 mg / mL durante 10 minutos com agitação lenta. Lave o gel em água duplamente destilada durante mais 10 minutos em agitação lenta; Use um agitador horizontal.
        Cuidado: O brometo de etidio é um composto tóxico; Use luvas de proteção e um casaco de laboratório de algodão.
      5. Purifique o DNA do gene do tipo selvagem das faixas correspondentes do gel usando um kit. Visualize as bandas colocando o gel corado em uma câmara UV (Comprimento de onda recomendado: 300 nm). Mantenha a exposição do gel ao mínimo. Use um kit de purificação de DNA e siga as instruções do fabricante.
        Atenção: a radiação UV é perigosa; Use um escudo protetor, óculos e um casaco de laboratório de algodão.
    3. Digest purificado wildtype genes e pUC18 / 19 plasmídeo DNA com as enzimas de restrição de acordo com as instruções do fabricante. Use possíveis enzimas de digestão rápida quando possível. Por exemplo, digerir 6 μL de DNA de pUC18 (300 ng / μL) em 10 μL de água ultrapura, 2 μL de tampão 10X, 1 μL de enzima de restrição Kpn I e 1 μL de enzima de restrição Xba I. Deixe a reacção a 37 ° C durante 30 min.
      1. Inactive as enzimas de restrição de acordo com as diretrizes do fabricante. Por exemplo, inactivar a reacção de digestão dupla Kpn I- Xba I a 80 ° C durante 5 min.
    4. Inserção de mistura: DNA de vetor em uma rati volumétricaO de 3: 1. Siga as instruções do fabricante para uma reação de ligadura. Utilize enzimas de ligação rápidas quando possível (deixe a reação a 25 ° C durante 10 min).
      NOTA: Tipicamente, a concentração de DNA após a purificação usando os kits é suficientemente boa para reações de digestão e ligadura. Por exemplo, adicione 6 μL de ADN de rpoD ( Kpn I- Xba I, 150 ng / μL), 3 μL de ADN de pUC18 ( Kpn I- Xba I, 150 ng / μL), 10 μL de tampão 2x, 1 μL de ultrapura Água e 1 μL de T4 DNA ligase. Deixe a reacção de ligação a 25 ° C durante 10 min.
    5. Transforme o DH5a de E. coli com 2-4 μL da reação de ligação, conforme descrito nos Materiais Suplementares. Placa as células transformadas em placas sólidas LB / Amp / X-gal / IPTG. Deixe as placas durante a noite a 37 ° C.
    6. Selecione as colônias de E. coli transformantes de cor branca e arrase-as em uma nova placa LB / Amp. Deixe as placas durante a noite a 37 ° C. </ Li>
    7. Execute uma PCR de colônia para escolher os candidatos para seqüenciar a reação, conforme descrito nos Materiais Suplementares. Extrair o DNA do plasmídeo dos candidatos. Alternativamente, digerir o DNA do plasmídeo candidato com as mesmas enzimas de restrição usadas para clonar as inserções.
    8. Construções de candidatos de seqüência com um provedor de serviços de seqüenciamento 10 . Monte a sequência em silico usando um ensamblador de DNA 11 ( Figura 1 , etapa 5).
  6. Interrupção do plasmídeo por PCR seguido de digestão com enzimas de restrição.
    1. Desenhe em silico os oligonucleótidos avançados e reversos em regiões de ruptura para genes de tipo selvagem e ampR , respectivamente. Substituir em silico o fragmento de tipo selvagem pela sua correspondente sequência de DNA de sinônimo (obtida no passo 1.4).
      NOTA: Esta seqüência de DNA sinônimo contém um site de enzimas de restrição. Os oligonucleótidos avançados e reversos se sobrepõem em tO site da enzima de restrição. Os oligonucleótidos devem variar de 21 a 27 nucleótidos, terminam com uma citosina ou guanina e contêm um site de enzimas de restrição. Um oligonucleótido para a frente tem a mesma sequência que a sua região alvo no modelo de DNA. Um oligonucleótido reverso é a sequência complementar reversa da região alvo no modelo de DNA.
    2. Use as duas construções de genes de tipo selvagem como o modelo de DNA para reações de PCR ( por exemplo, pUC18 rpoD e pUC18 sigA ). Obtenha duas partes complementares de cada construção (pUC18 rpoD σ1-σ2, pUC18 rpoD σ3-σ4, pUC18 sigA σ1-σ2 e pUC18 sigA σ3-σ4) ( Figura 1 , etapa 6).
    3. Carregar amostras de DNA em um gel de agarose 1-1.2% [p / v]. Separar os produtos de PCR do modelo de DNA por eletroforese ( por exemplo, 110 V por 1 h). Alternativamente, digerir as reações de PCR com Dpn I para quebrar o modelo de DNA.
      NOTA: DpnA enzima reconhece apenas sequências de DNA metiladas (5'-GATC-3 ').
      1. Purifique as amostras usando um kit de purificação de DNA. Siga as diretrizes do fabricante.
    4. Duplique todos os fragmentos de DNA complementares com as enzimas de restrição apropriadas de acordo com as instruções do fabricante. Utilize enzimas de restrição de digestão rápida quando possível. Por exemplo, digerimente o fragmento de DNA pUC18rpoDσ1-σ2 com Afl II e Spe I usando o protocolo do fabricante. Deixe a reação de digestão a 37 ° C durante 15 min.
    5. Inactive as enzimas de restrição de acordo com as diretrizes do fabricante. Por exemplo, inactive Afl II- Spe I a 80 ° C durante 20 min.
  7. Recuperação de plasmídeos usando ligadura de DNA e transformação bacteriana.
    1. Misture os fragmentos de DNA adequados numa proporção volumétrica 1: 1 para montar o gene quimérico desejado ( figura1, passo 7).
      NOTA: Desta forma, a integridade do gene ampR é restaurada, produzindo uma proteína funcional.
      1. Por exemplo, misture 4 μL de pUC18 rpoD σ1-σ2 DNA (digerido com Afl II- Spe I, 150 ng / μL), 4 μL de pUC18 sigA σ3-σ4 DNA ( Afl II- Spe I, 150 ng / μL), 10 μL de tampão 2x, 2 μL de água ultrapura e 1 μL de T4 DNA ligase; A concentração de DNA após a purificação do kit é suficientemente boa para digestão e subseqüente ligadura. Deixe a reação de ligação a 25 ° C durante 10 min.
    2. Transforme E. coli DH5a com 3-5 μL da reação de ligadura da montagem da quimera (Materiais Suplementares). Crescer as células transformantes em placas LB / Amp / X-gal / IPTG durante a noite a 37 ° C durante a noite.
    3. Selecione as colônias de E. coli transformantes de cor branca e arrase-as em uma nova placa LB / Amp. Deixe as placas durante a noite em 37° C.
    4. Execute uma PCR de colônia para escolher candidatos para uma reação de seqüenciamento, conforme descrito nos Materiais Suplementares. Visualize bandas em um gel de agarose de 1-1,2% (p / v) realizando eletroforese (descrito no passo 2.3.2.1).
    5. Cultive culturas de candidatos positivos. Extrair DNA de plasmídeo deles usando um kit de purificação de DNA de plasmídeo.

2. Construcções quiméricas candidatas a sequências

  1. Certifique-se de que a qualidade do DNA do plasmídeo seja suficientemente boa para a reação de seqüenciamento, seguindo as diretrizes do provedor de serviços de sequências. Extraia DNA usando kits de purificação. Por exemplo, na página da internet do provedor de serviço de seqüência, preste especial atenção à concentração de DNA recomendada para as amostras. Obtenha a concentração de amostras usando um instrumento de quantificação de DNA.
  2. Construções quiméricas candidatas de seqüência com um provedor de serviço de seqüenciamento 10 .
  3. Assemble se Lendo com uma incubadora de DNA in silico 11 .
  4. Alinhe as seqüências quiméricas montadas em silo em silico usando ferramentas de alinhamento de seqüência 9 , 12 . Verifique se o gene quimérico foi fundido com sucesso.

3. Preparação de preparações

NOTA: Todas as etapas envolvendo células vivas devem ser realizadas em uma capa limpa de fluxo laminar com o queimador Bunsen.

  1. Produção de células competentes de E. coli DH5a.
    1. Para produzir células compatíveis com E. coli , siga os protocolos 13 publicados ou consulte os Materiais Suplementares . Alternativamente, use células competentes comercialmente disponíveis.
  2. Células competentes de E. coli DH5α transformadoras.
    1. Para a transformação química das culturas de E. coli , siga os protocolos publicadosClass = "xref"> 13 ou veja os Materiais Suplementares . Alternativamente, use eletroporação para transformação bacteriana. Se forem utilizadas células competentes comercialmente disponíveis, siga as diretrizes do fabricante.
  3. ADN genômico e plasmídico purificante de E. coli DH5a.
    1. Execute a extração de ácido nucleico, como indicado nos Materiais Suplementares , usando kits comercialmente disponíveis ou seguindo protocolos publicados 13 .
  4. Execute PCR de colônia.
    1. Use esta técnica para identificar colônias de transformantes candidatas para reação subseqüente de seqüenciamento.
      NOTA: Este método não representa uma verificação final da integridade das seqüências. Uma descrição detalhada desta técnica está disponível nos Materiais Suplementares .
  5. Preparando as soluções.
    1. Vejo
  6. Faça o download dos scripts e arquivos de seqüência necessários para o protocolo CAPRRESI.
    1. Baixe arquivos de banco de genes contendo a sequência de genoma completa das espécies desejadas, extraie a seqüência de DNA do gene escolhido usando um navegador de genoma e guarde-o no formato de arquivo fasta. Baixe os scripts Perl necessários para o protocolo CAPRRESI. Armazene os scripts e os arquivos de seqüência no mesmo diretório.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

A Figura 1 mostra CAPRRESI. Usando este método, dois genes quiméricos foram montados trocando os domínios de dois fatores sigma primários bacterianos ( isto é, E. coli RpoD e R. etli SigA). As seqüências de DNA dos genes rpoD e sigA foram obtidas usando o Artemis Genome Browser 14 dos arquivos Genoma GenBank NC_000913 e NC_007761, respectivamente. A sequência de DNA do vetor pUC18 foi obtida a partir do banco de dados de nucleotídeos do servidor NCBI. As análises in silico de sítios de enzimas de restrição foram realizadas em seqüências de DNA executando o script Perse de REsearch.pl (ver passo 1.2.2). Estes resultados foram utilizados para o design de oligonucleótidos (passo 1.2.3). Os oligonucleótidos externos incluíram locais de reconhecimento para as enzimas de restrição Xba I e Kpn I para clonar genes do tipo selvagem no site de clonagem múltipla pUC18. O oligonucleótido para a frente também incluiu um riboAlgum site de ligação ( Tabela 2 ). O ADN genómico foi extraído de células de E. coli DH5a crescidas em caldas LB / Nal (37 ° C, 220-250 rpm) e R. etli CFN42 cultivadas em caldo PY / Nal / CaCl2 (30 ° C, 220-250 rpm ). Essas amostras foram usadas como modelos de DNA para amplificação genética de tipo selvagem (passo 1.5.2).

Os genes de tipo Wildtype foram amplificados usando uma polimerase de DNA de alta fidelidade Taq, que foi purificada a partir de géis de agarose (kit de purificação de DNA), digerida duas vezes com enzimas de restrição Kpn I- Xba I e clonada no vetor pUC18. As células DH5a de E. coli, quimicamente competentes, foram transformadas com 5 μL da reacção de ligação correspondente às construções de tipo selvagem pUC18 rpoD e pUC18 sigA (passo 1.5.5). As células transformantes foram seleccionadas em placas de LB / Amp / X-gal / IPTG sólidas crescidas a 37 ° C. As construções Wildtype foram verificadas pela Sanger sequenc10 . As leituras de seqüência de Sanger foram montadas em silico usando MIRA 11 (passo 1.5.8).

As sequências de aminoácidos de genes de tipo selvagem foram obtidas executando o script translate.pl (passo 1.3.1). Depois de alinhar os genes do tipo selvagem com Clustal 12 , as regiões de aminoácidos TLV e NLR foram selecionadas no gene da resistência à ampicilina ( ampR ) e nos fatores sigma primários do tipo selvagem, respectivamente (passo 1.3.3). Essas regiões de aminoácidos foram usadas para calcular todas as possíveis sequências de sinônimo de DNA que as codificam executando o script synonym.pl (etapa 1.4.1). O script REsynonym.pl buscou sites de enzimas de restrição encontrados nas seqüências de DNA de sinônimo geradas anteriormente (passo 1.4.2). As regiões sinônimas que apresentaram o menor número de alterações em comparação com as seqüências de tipos selvagens foram selecionadas. Para os principais genes do fator sigma, as seqüências de tipos selvagens de RpOD (AACTTACGT) e SigA (AACCTTCGC) foram trocados por AA CTTAAG G. Este último incluiu um site Afl II (negrito). Para o gene ampR, a seqüência de tipo selvagem ACGCTGGTG foi trocada pelo seu sinônimo, AC ACTAGT G. A seqüência de DNA sinônimo inserida no gene ampR continha um site Spe I (negrito). A substituição in silico do tipo selvagem para as seqüências sinônimas correspondentes foi feita para verificar a integridade da sequência e o design do oligonucleótido (etapas 1.2-1.4).

As alterações de sequência de sinónimo foram introduzidas por PCR usando os oligonucleótidos apropriados ( Tabela 2 ) e construções de tipo selvagem como modelos de DNA (passo 1.5.2). As reações de amplificação produziram quatro partes complementares: pUC18 rpoD σ1-σ2, pUC18 rpoD σ3-σ4, pUC18 sigA σ1-σ2 e pUC18 sigA σ3-σ4. As partes complementares disRuptou não apenas os fatores sigma, mas também os genes ampR . As partes complementares foram purificadas usando um kit de purificação de DNA (etapa 1.6.3).

Estes fragmentos de ADN complementares foram digeridos duas vezes com as enzimas de restrição Afl II e Spe I (passo 1.6.4). De acordo com o design CAPRRESI, os fragmentos de DNA pUC18 rpoD σ1-σ2 foram ligados com pUC18 sigA σ3-σ4 para obter a quimera 01 e pUC18 sigA σ1-σ2 foi ligado com pUC18 rpoD σ3-σ4 para montar a quimera 02 (passos 1.7.1-1.7 .3). As células DH5a de E. coli, quimicamente competentes, foram transformadas com 5 μL da reacção de ligação de pUC18 chim01 e pUC18 chim02 (passo 1.7.4). As células transformantes foram seleccionadas em placas de LB / Amp / X-gal / IPTG sólidas crescidas a 37 ° C (passo 1.7.5). As construções quiméricas foram verificadas pela sequenciação de Sanger 10 (passo 2). Sanger sequence rOs eads foram montados usando MIRA 11 , e seus arquivos resultantes estão listados na Tabela 3 . A Figura 2 mostra os alinhamentos (realizados usando MUSCLE) 9 de seqüências montadas de tipos selvagens e genes quiméricos nas regiões de quebra.

figura 1
Figura 1: visão geral CAPRRESI. Representações: genes (flechas grossas), plasmídeos funcionais (círculos fechados) e oligonucleótidos (flechas finas e de ponta preta). Os sítios de enzimas de restrição inseridos em oligonucleótidos aparecem em cores. Abreviações: Wt (tipo selvagem), FWD (oligonucleótido para a frente), REV (oligonucleótido reverso), ampR (gene de resistência à ampicilina), RES (sítio de enzima de restrição), RE (enzima de restrição). Clique aqui para ver um verso maiorSobre esta figura.

Figura 2
Figura 2: Alinhamento de seqüências de genes montados tipo selvagem e quiméricas. As seqüências de DNA montadas foram alinhadas usando MUSCLE 9 . As seqüências foram montadas com MIRA 11 . As seqüências de sinônimo aparecem em preto. O site de reconhecimento Afl II aparece sublinhado. Código de nucleótido IUPAC: R (A ou G) e K (G ou T). Construcções: rpoD (vermelho), sigA (azul), sequência de quimera 01 ( rpoD σ1-σ2- sigA σ3-σ4) e sequência de quimera 02 ( sigA σ1-σ2- rpoD σ3-σ4). Clique aqui para ver uma versão maior dessa figura.

Solução Componentes Instruções
Quantidade Composto
Caldo Luria-Bertani (LB) 5 g extracto de levedura Dissolver todos os componentes na água. Autoclave. Armazenar à temperatura ambiente até o uso. Para caldo LB sólido, adicione 15 g de agar bacteriológico à receita.
10 g Peptona caseína
10 g NaCl
Até 1 L Água destilada dupla
Placas LB / Amp / X-gal / IPTG 100 mL Caldo LB sólido fundido Adicione todos os componentes ao caldo LB temperado. Encha as placas de Petri e espere até que elas se solidificem. Execute etapas em uma capa limpa de fluxo laminar com o queimador Bunsen.
100 μL Ampicilina (Amp) [100 mg / mL]
100 μL X-gal [20 mg / ml]
50 μL Solução 1T IPTG
Caldo de peptona (PY) 3 g extracto de levedura Dissolver todos os componentes na água. Autoclave. Armazenar à temperatura ambiente até o uso. Para caldo PY sólido, adicione 15 g de agar bacteriológico à receita. Para a cultura de R. etli, adicione 700 μL de solução de CaCl2 1 M antes da utilização.
5 g Peptona caseína
Até 1 L Água destilada dupla
Placas PY / CaCl 2 / Nal 100 mL Caldo PY sólido derretido Adicione todos os componentes ao caldo temperado PY. Encha as placas de Petri e espere até se solidificar. Execute etapas em uma capa limpa de fluxo laminar com o queimador Bunsen.
700 μL Solução 1 M de CaCl2
100 μL Ácido nalidíxico (Nal) [20 mg / mL]
Solução de cloreto de cálcio 1 M (CaCl2) 11,1 g CaCl 2 Dissolver o CaCl2 na água. Autoclave. Armazenar em temperatura ambiente.
Até 100 mL Água destilada dupla
Tris-EDTA (TE) 10: 1 pH 8,0 1 mL Solução Tris 1 M Misture todos os componentes. Autoclave. Armazenar em temperatura ambiente.
400 μL Solução EDTA 0,25 M
Até 100 mL Água destilada dupla
TE 50:20 pH 8,0 5 mL Solução Tris 1 M Misture todos os componentes. Autoclave. Armazenar à temperatura ambiente. </ Td>
8 mL Solução EDTA 0,25 M
Até 100 mL Água destilada dupla
Solução 10 mM de NaCl 10: 1 58,4 mg NaCl Dissolver NaCl em TE 10: 1. Autoclave. Armazenar em temperatura ambiente.
Até 100 mL TE 10: 1 pH 8,0 solução
Solução de lise I 80 mg Lisozima Dissolver e misturar todos os componentes na água. Filtre a esterilização usando um filtro de 0,22 μm. Armazenar em temperatura ambiente.
2 mL Solução de glicose 0,5 M
400 μL Solução EDTA 0,5 M
500 μL Solução Tris 1 M
Até 20 mL Água esterilizada de dupla destilação
Solução de lise II 1,2 mL Solução de hidróxido de sódio 5 M (NaOH) Dissolver todos os componentes na água. Filtre a esterilização usando um filtro de 0,22 μm. Armazenar em temperatura ambiente.
3 mL Solução a 10% de dodecilsulfato de sódio (SDS)
Até 30 mL Água esterilizada de dupla destilação
Solução de lise III 29,4 g Acetato de potássio (CH3 COOK) Dissolver e misturar todos os componentes na água. Filtre a esterilização usando um filtro de 0,22 μm. Armazenar em temperatura ambiente.
11,5 mL Ácido acético absoluto (CH3COOH)
Até 100 mL Água esterilizada de dupla destilação
Solução de cloreto de magnésio 1 M (MgCl2) 9,5 g MgCl 2 Dissolver MgCl 2 em wAter. Autoclave. Armazenar em temperatura ambiente.
Até 100 mL Água destilada dupla
Solução de acetato de sódio 3 M (CH3COONa) 24,6 g CH 3 COONa Dissolver CH3 COONa em água. Autoclave. Armazenar em temperatura ambiente
Até 100 mL Água destilada dupla
Solução SDS 10% 10 g SDS Dissolver SDS em água com uma barra de agitação magnética a baixa velocidade. Autoclave. Armazenar em temperatura ambiente.
Até 100 mL Água destilada dupla
Solução 3 M CH 3 COOK 29,4 g CH 3 COOK Dissolver CH 3 COOK em água. Filtre a esterilização usando um filtro de 0,22 μm. Armazenar em temperatura ambiente. Até 100 mL Água esterilizada de dupla destilação
Solução de proteinase K 5 mg Proteinase K Dissolver a proteinase K na solução TE 50:20. Calor a 37 ºC por 1 h. Armazenar a -20 ºC.
Até 1 mL TE 50:20 pH 8.0 solução
Solução RNase 10 mg RNase Dissolver RNase em água. Calor a 95 ºC por 10 min. Armazenar a -20 ºC.
Até 1 mL Água ultrapura esterilizada
Solução de 1 M isopropil-p-D-tiogalactósido (IPTG) 238,3 mg IPTG Dissolver IPTG em água. Filtre a esterilização usando um filtro de 0,22 μm. Armazenar a -20 ºC.
Até 1 mL Água ultrapura esterilizada
20 mg X-gal Dissolver X-gal na água. Filtre a esterilização usando um filtro de 0,22 μm. Armazenar a -20 ºC.
Até 1 mL Água ultrapura esterilizada
Fenol: clorofórmio: solução de álcool isoamílico 24: 24: 1 24 mL fenol Misture todos os componentes. Armazenar em uma garrafa de âmbar a 4 ºC. CUIDADO! Material perigoso. Use óculos de proteção, luvas e bata de laboratório de algodão. Use um capô de extração. NÃO ligue o queimador de Bunsen ou qualquer outra fonte de fogo durante o manuseio. Alternativa: use fenol comercial: clorofórmio: álcool isoamílico Solução 25: 24: 1
24 mL clorofórmio
1 mL Álcool isoamílico
Solução de glicose 0,5 M 9 g GLucose Dissolver a glicose na água. Filtre a esterilização usando um filtro de 0,22 μm. Armazenar em temperatura ambiente.
Até 100 mL Água ultrapura esterilizada
Ácido etilenodiaminotetracético 0,5 M (EDTA) pH 8,0 solução 14,6 g EDTA Dissolver EDTA em água. Ajuste o pH com solução de NaOH 5 M. Autoclave. Armazenar em temperatura ambiente.
Até 100 mL Água destilada dupla
Solução EDTA 0,25 M pH 8,0 7,3 g EDTA Dissolver EDTA em água. Ajuste o pH com solução de NaOH 5 M. Autoclave. Armazenar em temperatura ambiente.
Até 100 mL Água destilada dupla
Solução 1 M Tris pH 8,0 12,1 g Tris Dissolver Tris na água. Ajuste o pH comÁcido clorídrico absoluto (HCl). Autoclave. Armazenar em temperatura ambiente.
Até 100 mL Água destilada dupla
Solução de hidróxido de sódio 5 M (NaOH) 19,9 g NaOH Dissolver NaOH em água. Armazenar em temperatura ambiente. CUIDADO! Composto cáustico.
Até 100 mL Água esterilizada de dupla destilação
Solução de NaOH 0,1 M 399 mg NaOH Dissolver NaOH em água. Armazenar em temperatura ambiente.
Até 100 mL Água esterilizada de dupla destilação
Solução-mãe de ácido nalidíxico (Nal) 60 mg Ácido nalidíxico Dissolver Nal na água. Filtre a esterilização usando um filtro de 0,22 μm. Armazenar a 4 ºC.
Até 3 mL 0,1 MNSolução aOH
Ampicilina (Amp) stock solution 300 mg Ampicilina Dissolver Amp em água. Filtre a esterilização usando um filtro de 0,22 μm. Armazenar a 4 ºC.
Até 3 mL Água esterilizada de dupla destilação
10x tampão tris-acetato-EDTA 48,4 g Tris Dissolver todos os componentes na água. Autoclave. Armazenar em temperatura ambiente.
20 ml Solução EDTA 0,5 M
11,44 ml ácido acético glacial
Até 1 L Água destilada dupla

Tabela 1: Preparação da solução. Instruções para a preparação da solução.

Não. Código Seqüência Comprimento (nt) Características
1 RpoD-FWD GC TCTAGA GA AGGAGA TATCATATGGAGCAAAACCCGCAGTCA 43 Site XbaI ; Amplificação de genes de tipo selvagem e clonagem vetorial
2 RoD-REV GG GGTACC TTAATCGTCCAGGAAGCTACG 29 Site KpnI ; Amplificação de genes de tipo selvagem e clonagem vetorial
3 SigA-FWD GC TCTAGA GA AGGAGA TATCATATGGCAACCAAGGTCAAAGAG 43 Site XbaI ; Amplificação de genes de tipo selvagem e clonagem vetorial
4 SigA-REV GG GGTACC TTAGCTGTCCAGAAAGCTTCT </ Td> 29 Site KpnI ; Amplificação de genes de tipo selvagem e clonagem vetorial
3 AmpR-FWD AC ACTAGT GAAAGTAAAAGAT 21 Site específico inserido, mutação de sinônimo. Perturbação do gene ampR
4 AmpR-REV TC ACTAGT GTTTCTGGGTGAG 21 Site específico inserido, mutação de sinônimo. Perturbação do gene ampR
5 Σ2RpoD-FWD AA CTTAAG GCTGGTTATTTCTATCGCT 27 AflII site inserido, mutação de sinônimo. Construção de chim01-02
6 Σ2RpoD-REV GC CTTAAG TTCGCTTCAACCATCTCTT 27 AflII site inserido, mutação de sinônimo. Construção de chim01-02
7 Σ2SigA-FWD AA CTTAAG GCTCGTCATTTCAATCGCC 27 AflII site inserido, mutação de sinônimo. Construção de chim01-02
8 Σ2SigA-REV GC CTTAAG TTCGCTTCGACCATTTCCT 27 AflII site inserido, mutação de sinônimo. Construção de chim01-02

Tabela 2: Seqüências de oligonucleótidos. Os sites de enzimas de restrição aparecem sublinhados. Site de ligação ao ribosoma: negrito.

Construção Arquivo de sequência Arquivo de qualidade
Quimera01 Chim01_out.unpadded.fasta Chim01_out.unpadded.fasta.qual
Chim01_A3 / B3 / E2 / F2 / G2 /H2.pdf
Quimera02 Chim02_out.unpadded.fasta Chim02_out.unpadded.fasta.qual
Chim02_C3 / D3 / E3 / F3 / G3 / H3.pdf
RpoD Rpod_out.unpadded.fasta Rpod_out.unpadded.fasta.qual
SigA Else_out.unpadded.fasta Else_out.unpadded.fasta.qual

Tabela 3: arquivos de seqüência obtidos com o montador MIRA e o seqüenciador de DNA. As leituras de seqüestro de Sanger de construções quiméricas e de tipo selvagem foram montadas com o software MIRA 11 usando a opção de mapeamento. Os cromatogramas de sequenciação de quimera aparecem como arquivos PDF.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

CAPRRESI foi projetado como uma alternativa ao PRM 2 . O PRM original é uma técnica poderosa; Ele permite a fusão de seqüências de DNA ao longo de qualquer parte dos genes selecionados. Para PRM, os genes de tipo selvagem devem ser clonados no mesmo plasmídeo. Depois disso, os oligonucleótidos são projetados dentro de genes de resistência de tipos selvagens e antibióticos encontrados no plasmídeo. A interrupção do plasmídeo é conseguida através de PCR utilizando polimerases de DNA de extrema extremidade e de alta fidelidade e oligonucleótidos previamente concebidos. A ligação de produtos de PCR complementares reúne genes quiméricos e restaura a cassete de resistência aos antibióticos, resultando em recuperação funcional do plasmídeo. PRM permite a construção de bibliotecas de genes quiméricos no mesmo fundo de plasmídeo. Infelizmente, a ligação de sequências de DNA de extremidade frouxa pode ser tecnicamente árdua. A montagem da quimera por fragmentos de PCR 1 sobrepostos também exige que as polimerases de DNA produzam produtos de extremidade frouxa ePurificação de DNA para cada reação. Os genes quiméricos reunidos por esta técnica são produtos de DNA linear. A clonagem de cada construção no vetor alvo pode atrasar a análise posterior.

O CAPRRESI beneficia de muitos dos pontos fortes de PRM e também simplifica a ligação de fragmentos de DNA complementares usando locais de enzimas de restrição em regiões sintéticas de sequência de DNA. Por estas razões, o CAPRRESI não requer polimerases de DNA de extremidade contundente. O uso de sinônimo de seqüências de DNA restringe os locais de fusão para a montagem da quimera, mas aumenta a eficiência da ligação. Outra modificação importante introduzida no CAPRRESI é que as quimeras são montadas e manipuladas em vetores pUC18 / 19. Esses vetores possuem vários recursos vantajosos, como afirmado anteriormente. O ADN quimérico pode ser obtido pela propagação do vetor de construção em hospedeiros de E. coli . A subsequente clonagem de genes quiméricos no plasmídeo final ( por exemplo , um vector de expressão) às vezes érequeridos.

CAPRRESI também conta com o tratamento in silico de DNA e de sequências de aminoácidos. Os scripts perl ad hoc permitem a seleção das enzimas de restrição apropriadas para clonar genes de tipo selvagem, o cálculo de todas as seqüências de DNA de sinônimo correspondentes a regiões de ruptura (para montagem de quimera) e a identificação de enzimas de restrição para simplificar a recuperação de plasmídeos. Dadas estas condições, CAPRRESI é uma alternativa para a fusão de genes que codificam proteínas. As etapas críticas do protocolo CAPRRESI são: 1) a seleção de regiões de quebra e 2) a purificação de produtos de PCR. As regiões de ruptura são trechos onde as seqüências sinônimas são calculadas, produzindo sites de enzimas de restrição que não são encontrados em seqüências de tipos selvagens. O uso de locais de enzimas de restrição para o conjunto de quimeras elimina a necessidade de polimerases de DNA que produzem produtos de extremidade frouxa e aliviam a reação de ligação. Nem todas as regiões terão sites de enzimas de restrição utilizáveis; ParaPor esse motivo, recomenda-se mover as regiões de ruptura por um aminoácido de cada vez até encontrar o melhor estiramento da sequência. Se o design in silico não permite o movimento das regiões de quebra ou os trechos de seqüência possuem sinônimo de seqüências de DNA com locais de enzimas de restrição adequados, recomenda-se a fusão de genes alvo usando oligonucleótidos sobrepostos e a introduzir sequências de DNA sinônimo no gene de resistência à ampicilina (Encontrado apenas no vetor). Desta forma, os genes podem ser fundidos em qualquer parte e a recuperação do plasmídeo depende da ligação de um site único (digerido com apenas uma enzima de restrição). A flexibilidade da CAPPRESI permite que ela seja realizada em combinação com outras técnicas.

A purificação de produtos de PCR é realizada para eliminar DNA de molde, diminuindo as chances de contaminação de plasmídeos parental após a ligação de fragmentos de DNA complementares. Cumprir estes dois passos críticos melhora o bacEficiência de transformação terial (o número de construções corretamente montadas), permitindo que CAPRRESI seja realizado com células de E. coli quimicamente competentes (CaCl 2 ) ou eletrocompetentes. O primeiro tipo de células competentes representa a fonte mais barata de culturas de E. coli , empregadas para a transformação bacteriana na maioria dos laboratórios. Por causa de todos os recursos mostrados anteriormente, CAPRRESI representa uma opção útil para a montagem de quimeras.

Além disso, o CAPRRESI poderia funcionar em combinação com fragmentos de PCR sobrepostos ou técnicas de recuperação de plasmídeos. Por exemplo, em vez de inserir duas seqüências de sinônimo por porção de DNA complementar, a região de quebra desejada (nos genes de tipo selvagem alvo) poderia usar oligonucleótidos sobrepostos para fundir seqüências intervenientes. A introdução de seqüências de sinônimos pode ser restrita ao gene ampR de vetores pUC18 / 19, levando ao uso de apenas uma enzima de restrição para restaurar o plasmiD integridade. Essas futuras aplicações poderiam fortalecer o CAPRRESI, permitindo a fusão de qualquer tipo de seqüências de DNA ( ou seja, não apenas genes codificadores de proteínas), sem comprometer a eficiência da ligação.

Para testar CAPRRESI, dois fatores sigma quiméricos foram montados trocando regiões de dois genes do fator sigma primário de tipo selvagem: rpoD ( E. coli ) e sigA ( R. etli ). Todos os fatores sigma primários conhecidos possuem quatro domínios, σ1 a σ4 8 . A quimera 01 consiste em RpoDσ1-σ2 e SigAσ3-σ4, enquanto a quimera 02 tem SigAσ1-σ2 e RpoDσ3-σ4. A integridade das construções quiméricas foi verificada pela seqüência 10 de Sanger ( Figura 2 ).

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Os autores declaram que não têm interesses financeiros concorrentes.

Acknowledgments

Este trabalho foi apoiado pelo Conselho Nacional de Ciência e Tecnologia, CONACYT, México (número de concessão 154833) e pela Universidade Nacional Autônoma do México. Os autores agradecem a Víctor González, Rosa I. Santamaría, Patricia Bustos e Soledad Juárez pelo seu conselho administrativo e técnico.

Materials

Name Company Catalog Number Comments
Platinum Taq DNA polymerase High Fidelity Thermo Fisher 11304011 Produces a mix of blunt/3’-A overhang ended PCR products
High pure plasmid isolation kit Roche 11754785001 Used for all plasmid purification reactions
High pure PCR product purification kit Roche 11732676001 Used for all PCR purification reactions from agarose gels
AflII restriction enzyme New England Biolabs R0520L Recognizes sequence 5’-CTTAAG-3’ and cuts at 37 °C
KpnI-HF restriction enzyme New England Biolabs R3142L Recognizes sequence 5’-GGTACC-3’ and cuts at 37 °C
SpeI-HF restriction enzyme New England Biolabs R3133L Recognizes sequence 5’-ACTAGT-3’ and cuts at 37 °C
XbaI restriction enzyme New England Biolabs R0145L Recognizes sequence 5’-TCTAGA-3’ and cuts at 37 °C
Ampicillin sodium salt Sigma Aldrich A0166-5G Antibiotics
Nalidixic acid Sigma Aldrich N8878-5G Antibiotics
Yeast Extract Sigma Aldrich Y1625-1KG Bacterial cell culture
Casein peptone Sigma Aldrich 70171-500G Bacterial cell culture
NaCl Sigma Aldrich S9888-1KG Sodium chloride
Agar Sigma Aldrich 05040-1KG Bacterial cell culture
XbaI restriction enzyme Thermo Fisher FD0684 Fast digest XbaI enzyme
KpnI restriction enzyme Thermo Fisher FD0524 Fast digest KpnI enzyme
Quick Ligation Kit New England Biolabs M2200S Fast DNA ligation kit
AflII restriction enzyme Thermo Fisher FD0834 Fast digest AflII enzyme
SpeI restriction enzyme Thermo Fisher FD1253 Fast digest SpeI enzyme

DOWNLOAD MATERIALS LIST

References

  1. Horton, R. M., Hunt, H. D., Ho, S. N., Pullen, J. K., Pease, L. R. Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene. 77, (1), 61-68 (1989).
  2. Vos, M. J., Kampinga, H. H. A PCR amplification strategy for unrestricted generation of chimeric genes. Anal. Biochem. 380, (2), 338-340 (2008).
  3. Hawkins, N. C., Garriga, G., Beh, C. T. Creating Precise GFP Fusions in Plasmids Using Yeast Homologous Recombination. Biotechniques. 34, (1), 1-5 (2003).
  4. Sander, J. D., Joung, J. K. CRISPR-Cas systems for editing, regulating and targeting genomes. Nat Biotechnol. 32, (4), 347-355 (2014).
  5. Nagy, A. Cre recombinase: The universal reagent for genome tailoring. Genesis. 26, (2), 99-109 (2000).
  6. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods. 6, (5), 343-345 (2009).
  7. Norrander, J., Kempe, T., Messing, J. Construction of improved M13 vectors using oligodeoxynucleotide-directed mutagenesis. Gene. 26, (1), 101-106 (1983).
  8. Gruber, T. M., Gross, C. A. Multiple sigma subunits and the partitioning of bacterial transcription space. Annu Rev Microbiol. 57, 441-466 (2003).
  9. Edgar, R. C. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 32, (5), 1792-1797 (2004).
  10. Macrogen Inc. Seoul, Rep. Of Korea. Available from: http://dna.macrogen.com/eng/index.jsp (2016).
  11. Chevreux, B. MIRA: an automated genome and EST assembler. Available from: http://www.chevreux.org/thesis/index.html 1-161 (2005).
  12. Thompson, J. D., Gibson, T. J., Higgins, D. G. Multiple sequence alignment using ClustalW and ClustalX. Curr Protoc Bioinformatics. Chapter 2 (Unit 2.3) 1-22 (2002).
  13. Sambrook, J., Russell, D. W. Molecular Cloning: A laboratory manual. CSHLP. (2001).
  14. Rutherford, K., et al. Artemis: sequence visualization and annotation. Bioinformatics. 16, (10), 944-945 (2000).
CAPRRESI: montagem de quimera por recuperação de plasmídeos e restrição de inserção do site enzimático
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Santillán, O., Ramírez-Romero, M. A., Dávila, G. CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion. J. Vis. Exp. (124), e55526, doi:10.3791/55526 (2017).More

Santillán, O., Ramírez-Romero, M. A., Dávila, G. CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion. J. Vis. Exp. (124), e55526, doi:10.3791/55526 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter