Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

CAPRRESI: Plazmid Geri Kazanım ve Kısıtlama Enzim Yerinin Eklenmesi ile Chimera Meclisi

doi: 10.3791/55526 Published: June 25, 2017

Summary

Burada, sinomi DNA sekanslarına restriksiyon enzim sahalarının yerleştirilmesi ve fonksiyonel plazmid geri kazanımına dayanan bir protokol olan plazmit geri kazanım ve restriksiyon enzim yeri ekleme (CAPRRESI) ile kinera montajını sunuyoruz. Bu protokol protein kodlayan genlerin eritilmesi için hızlı ve düşük maliyetli bir yöntemdir.

Abstract

Burada, plazmid geri kazanım ve kısıtlama enzim bölgesi ekleme (CAPRRESI) ile kinera montajını sunuyoruz. CAPRRESI orijinal plazmid geri kazanım yönteminin pek çok avantajından yararlanır ve DNA ligasyon reaksiyonlarını kolaylaştırmak için kısıtlama enzimi sindirimini sağlar (kimera montajı için gerekli). Bu protokol için, kullanıcılar aynı plazmite vahşi tip genleri klonlamışlardır (pUC18 veya pUC19). Kimeraların birleştirilmesi gereken amino asit dizisi bölgelerinin in silico seçiminden sonra, kullanıcılar şifreleyen tüm eşanlamlı DNA dizilerini elde eder. Geçici Perl betiği, kullanıcıların tüm eş anlamlı DNA dizilerini belirlemelerini sağlar. Bu adımdan sonra, başka bir Perl betiği tüm eş anlamlı DNA dizileri üzerinde kısıtlama enzim siteleri arar. Bu siliko analiz de pUC18 / 19 plazmidlerinde bulunan ampisilin direnç genini ( ampR ) kullanarak gerçekleştirilir. Kullanıcılar, PCR ile wildfit ve ampR genlerini parçalamak için eşanlamlı bölgeler içerisindeki oligonükleotidleri tasarlarlar . Obt'dan sonraTamamlayıcı DNA fragmanlarını arındırma ve saflaştırma, kısıtlama enzimi sindirimi gerçekleştirilir. Şimera montajı, uygun tamamlayıcı DNA fragmanlarının bağlanmasıyla gerçekleştirilir. Küçük ebat (2.686 baz çifti), yüksek kopya sayısı, avantajlı sıralama reaksiyon özellikleri ve ticari kullanılabilirlik gibi teknik avantajlar sundukları için CAPRRESI için pUC18 / 19 vektörleri seçilmiştir. Kimera montajı için restriksiyon enzimlerinin kullanımı, künt uçlu ürünler üreten DNA polimerazlarına olan ihtiyacı ortadan kaldırır. CAPRRESI, protein kodlayan genlerin eritilmesi için hızlı ve düşük maliyetli bir yöntemdir.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Kimerik gen montajı, protein fonksiyonunu ve / veya biyoteknolojik amaçları aydınlatmak için moleküler biyolojide yaygın şekilde kullanılmaktadır. Çakışan PCR ürün amplifikasyonu 1 , plasmid geri kazanım 2 , homolog rekombinasyon 3 , CRISPR-Cas9 sistemleri 4 , bölgeye yönelik rekombinasyon 5 ve Gibson topluluğu 6 gibi genleri kaynaştırmak için farklı yöntemler mevcuttur. Bunların her biri farklı teknik avantajlar sunmaktadır; Örtüşen PCR tasarımının esnekliği, plazmid geri kazanım sırasında yapıların in vivo seçimi veya CRISPR-Cas9 ve Gibson sistemlerinin yüksek etkinliği. Öte yandan, bu yöntemlerin bazılarını yerine getirirken bazı zorluklar ortaya çıkabilir; Örneğin, ilk iki yaklaşım kör uçlu DNA fragmanlarına dayanır ve bu tür ürünlerin ligasyonu stik ile karşılaştırıldığında teknik açıdan zor olabilirKy-bitişli ligasyon. Site yönlendirmeli rekombinasyon, CreoLuxP sisteminde olduğu gibi, orijinal üzerinde fazladan DNA dizileri izi bırakabilir ( 5) . CRISPR-Cas9 bazen hedef bölgeye ek olarak diğer genom bölgelerini de değiştirebilir 4 .

Burada, plasmid geri kazanım yöntemini (PRM) eşanlamlı DNA dizileri üzerindeki kısıtlama enzimi alanlarının eklenmesi ile birleştiren protein kodlayıcı genlerin kaynaştırılması için bir protokol olan plazmid kurtarma ve restriksiyon enzim bölgesi ekleme (CAPRRESI) ile kinera montajı başlattığımızdan, ligasyon verimliliğini arttırıyoruz . Amino asit dizilimi bütünlüğünü sağlamak için, sınırlama enzimi sahaları, eş anlamlı DNA sekansı uzantılarına eklenir. CAPPRESI'nin yararları sıradan laboratuar reaktifleri / araçları ( örneğin enzimler, yetkili hücreler, çözeltiler ve termosikleler) kullanılarak gerçekleştirilebilmesi ve hızlı enzim (uygun enzim kullanıldığında) hızlı sonuçlar verebilmesidir. Kısıtlamaya güvenmekEş anlamlı DNA sekanslarından çıkan enzim siteleri, ilgi proteinleri içindeki tam füzyon noktalarının seçimini sınırlayabilir. Bu gibi durumlarda, hedef genler örtüşen oligonükleotidler kullanılarak kaynaştırılmalı ve sınır enzimi alanları vektörün direnç geni üzerine eklenmelidir.

CAPRRESI yedi basit adımdan oluşur ( Şekil 1 ): 1) klonlama vektörü, pUC18 veya pUC196'nın seçilmesi; 2) kaynaştırılacak olan vahşi tipli dizilerin in silico analizinde; 3) kimera montajı ve plasmid bozulması için kırılma bölgelerinin seçilmesi; 4) sınırlama enzimi alanlarını içeren eşanlamlı DNA sekanslarının üretilmesi; 5) vahşi tiplendirilmiş genlerin seçilen plazmite bağımsız olarak klonlanması; 6) PCR ile plasmid parçalanması, ardından kısıtlama enzimi sindirimi; Ve 7) DNA ligasyonu ve bakteri dönüşümü kullanılarak plazmid geri kazanım. Bu teknikle üretilen kimerik genler,Sıralama.

PUC18 / 19 vektörleri, küçük boy ( yani 2,686 baz çiftleri), yüksek kopya sayısı, avantajlı sıralama reaksiyon özellikleri ve ticari kullanılabilirlik 7 gibi klonlama ve kimera montajı için teknik avantajlar sunar. Burada, kimera bir araya getirmek ve işlemek için bir Escherichia coli ana ürünü kullanıldı, çünkü bakteri kültürleri ucuzdur ve hızlı büyürler. Bu durumda, füzyon fragmanlarının nihai hedef plasmidlere daha sonra klonlanması gerekecektir ( örn., Bakterilerde pRK415 veya memeli hücrelerinde pCMV gibi ifade vektörleri).

CAPRRESI, iki primer sigma faktörü geninin füzyonu için test edildi: E. colirpoD ve Rhizobium etlisigA . Birincil sigma faktörleri, transkripsiyonun başlatılmasından sorumlu RNA polimeraz altbirimleridir ve bunlar dört alan ( yani, σ1, σ2, σ3 ve σ4) 8'den oluşur . Amino asit dizisi lengtRpoD ve sigA tarafından kodlanan proteinlerin sırasıyla sırasıyla 613 ve 685'dir . RpoD ve SigA% 48 kimliğe sahiptir (% 98 kapsama alanı). Bu primer sigma faktörleri, bölgeler σ2 ve σ3 arasında iki tamamlayıcı parçaya ayrıldı. Bu tasarıma göre iki şimerik gen toplandı: chimera 01 (RpoDσ1-σ2 + SigAσ3-σ4) ve kimerik 02 (SigAσ1-σ2 + RpoDσ3-σ4). DNA füzyon ürünleri sıralamayla doğrulanmıştır.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. CAPRRESI Protokolü

NOT: Şekil 1 , genel CAPRRESI protokolünü gösterir. Bu teknik, siliko tasarıma ve arzulanan kimeraların oluşturulmasına dayanır.

  1. Klonlama plasmidinin seçimi, pUC18 veya pUC19.
    1. Teknik taleplere en iyi uyan pUC vektörünü seçin.
      NOT: Her iki vektör birden fazla klonlama alanının yönlendirilmesi haricinde aynı sıraya sahiptir. Bu, oligonükleotidlerin tasarımı ve PCR plazmiti parçalanması için önemlidir.
  2. Vahşi tipli genlerin ve pUC18 / 19 dizilerinin in silico analizi.
    1. Vahşi tipli genlerin DNA dizilerini elde edin ve bir FASTA format dosyasına kaydedin ( ör . Genes.fas).
      NOT: pUC18 / 19 vektörlerinin sekansları pUC.fas dosyasında bulunur ( Şekil 1 , adım 1).
    2. Hangi kısıtlama enzimini belirleyinYmes, REsearch.pl komut dosyasını çalıştırarak vahşi tipli genleri ve pUC18 / 19 dizilerini kesmeyin. Alternatif olarak, bir çevrimiçi araç ile bir kısıtlama enzim bölgesi araştırması yapın ( Şekil 1 , adım 2).
      1. Bir terminalin içine aşağıdakileri yazın:
        Perl REsearch.pl genes.fas
        Perl REsearch.pl pUC.fas
        NOT: Bu komutlar aşağıdaki çıktı dosyalarını oluşturur: genes_lin.fas, genes_re.fas, pUC_lin.fas ve pUC_re.fas.
      2. Yabanıl tip genleri, genes_re.fas ve pUC.fas dosyalarını karşılaştırarak seçilen pUC18 / 19 vektörünün çoklu klonlama alanına klonlamak için uygun kısıtlama enzimlerini seçin. Ekin pUC18 / 19 vektörünün ampisilin direnç genine ( ampR ) göre yönünü seçin.
    3. Vahşi tip genlerin kodlama bölgesini (dış oligonükleotidler) büyütmek için ileri ve ters oligonükleotitler tasarlayın. Her 5 'ucuna uygun kısıtlama enzimi bölgesi dahil edinOligonükleotitlerin; Bu insert yönünü belirleyecektir.
      1. İleri oligonükleotidlerde fonksiyonel bir ribozom bağlama sitesi ekleyin.
      2. Her iki vahşi türevi geni de vektörün içine aynı yönde yerleştirin.
  3. Kimera montajı ve plazmid bozulması için kırılma bölgelerinin seçimi.
    1. Translate.pl komut dosyasını çalıştırarak vahşi ve ampR genlerinin amino asit dizisini elde edin ( Şekil 1 , adım 3).
      1. Bir terminalin içine aşağıdakileri yazın:
        Perl translate.pl genes.fas
        Perl translate.pl ampr.fas

        NOT: Bu betik aşağıdaki çıktı dosyalarını oluşturacaktır: genes_aa.fas ve ampR_aa.fas.
    2. İki vahşi amino asit sekansını uygun bir yazılımla ( örn . KASÇI) küresel olarak hizalayın 9 .
    3. Kimera asse için istenen kırılma bölgelerini seçin (3-6 amino asit)Sıralı hizalamaya dayalı olarak mbly. Onları FASTA formatındaki bir dosyaya kaydedin ( ör . , Regions.fas).
    4. Seçilen amino asit uzayı kodlayan DNA sekanslarını her iki yabanıl tip gen üzerinde bulun.
  4. Restriksiyon enzimi alanlarını içeren eşanlamlı DNA sekanslarının üretimi.
    1. Kırma bölgeleri olarak seçilen her bir amino asit sekansı gerginliği için kodlayan tüm eş anlamlı DNA dizilerini elde edin ( Şekil 1 , adım 4); Bu sekanslar regions.fas dosyasında saklandı.
      1. Bir terminalin içine aşağıdakileri yazın:
        Perl synonym.pl regions.fas
        NOT: Bu betik regions_syn.fas çıktı dosyasını oluşturacaktır.
    2. Sinonim DNA dizileri üzerinde bulunan kısıtlama enzim sitelerini arayın.
      1. Bir terminal içine aşağıdakileri yazın: perl REsynonym.pl regions_syn.fas
        NOT: Bu betik, regions_syn-re.fas çıktı dosyasını oluşturacaktır.
    3. Her iki vahşi tipli genin eşanlamlı sekansları arasında paylaşılan bir kısıtlama enzimi seçin; Bu site kısıtlama enzimi sindirimi yoluyla kimeraları bir araya getirmek için kullanılacaktır. Seçilen kısıtlama enziminin, ne vahşi tip genleri ne de pUC18 / 19 vektör sekanslarını kesmediğini doğrulayın.
      1. Genes_re.fas, pUC_re.fas ve regions_syn-re.fas dosyalarında bulunan kısıtlama enzimlerini karşılaştırın.
    4. Silikonun orijinallerini, eşanlamlı DNA dizileri için, her iki vahşi türe ait genin karşılık gelen lokuslarında değiştirin. Eşanlamlı DNA dizilerini vahşi dizi dosyasına (genes.fas) ekleyin.
    5. Genes.fas dosyasında bulunan genlerin amino asit dizisini elde edin ( perl translate.pl genes.fas ).
    6. Vahşi ve eş anlamlı DNA dizilerinden çevrilen amino asit dizilerini hizalayın. Her iki dizinin de aynı olduğunu doğrulayın.
    7. PU üzerinde bulunan ampR geni ile bu bölümün tüm adımlarını tekrarlayınC18 / 19 vektör.
      NOT: Amaç, ampR genini (dosya ampr.fas) iki tamamlayıcı parçaya bölmektir. AmpR genini bozmak için seçilen kısıtlama enzimi, kimera montajı için kullanılanlardan farklı olmalıdır.
  5. İki vahşi türe ait genin seçilen pUC18 / 19 vektörüne bağımsız olarak klonlanması (Şekil 1, adım 3).
    1. Seçilen pUC18 / 19 plasmid DNA'sını bir plazmid DNA saflaştırma kiti kullanarak saflaştırın.
      1. Örneğin E. coli DH5α'nın pUC18 plazmid ile transforme edilmesi ve transformantların 37 ° C'de katı LB-0.3 mg / mL ampisilin (Amp) üzerinde büyümesini sağlayın. Bir transformant koloni seçin, yeni bir LB-0.3 mg / mL Amp plakası inoküle edin ve gece boyunca 37 ° C'de büyütün.
      2. Önceki kültürden bir miktar alın ve 6-8 saat boyunca 37 ° C'de sıvı LB-0.3 mg / mL Amp içinde büyütün. Plazmid DNA'sını bir kit kullanarak çıkarın.
    2. PCR kullanılarak, toplam genomik DNA'dan vahşi tip genler yükseltilirHarici oligonükleotidleri saflaştır. Mümkünse yüksek kaliteli DNA polimeraz kullanın. Verimi en üst düzeye çıkaran DNA polimerazını seçin. PCR, üreticinin talimatlarına ve oligonükleotidlerin erime sıcaklığına göre gerçekleştirilir.
      1. Kullanılan DNA polimeraz, amplikon boyutu, şablonu ve oligonükleotitlere bağlı olarak PCR döngülerini çalıştırın. Örneğin, rpoD DNA'sını çoğaltmak için, 50 μL reaksiyon hazırlayın: 5 uL 10x tampon, 2 μL 50 mM MgSO 4 , 10 mM dNTP karışımı 1 uL, her 10-μM oligonükleotidin 2 μL (Tablo 2), 2 Şablon DNA'sı ( E. coli DH5α toplam DNA), 35.8 μL ultra saf su ve 0.2 μL yüksek doğrulukta DNA polimeraz. Aşağıdaki PCR döngülerini çalıştırın: İlk denatürasyon için 1 dakika, ardından 30 çevrim amplifikatörü (denatürasyon için 94 ° C'de 30 saniye, oligonükleotidlerin tavlanması için 60 ° C'de 30 saniye ve 68 ° C'de 2 dakika) genişletmek).
      2. 1.2 g çözünürAgaroz, mikrodalga fırında ısıtılarak 100 mL'lik iki damıtılmış suda yıkanır. Bir jel tepsi ve tarağı toplayın ve yatay jel şist içine koyun. Jel tepsisini eritilmiş agaroz çözeltisi ile doldurun ve katılaşmasına izin verin. Tarağı çıkarın.
      3. Jel elektroforez odasına yerleştirilir. Odaya 1x Tris-asetat-EDTA tamponu doldurun. Jel kuyularına 50 μL PCR ürünü yükleyin. Örnekleri elektroforez ( örn . 110 V'de 1 saat boyunca).
      4. Elektroforezden sonra, jel yavaşça çalkalanarak 10 dakika boyunca 100 mg'lık 1 mg / mL etidyum bromür çözeltisi içeren 100 ml'lik çift damıtılmış suyla lekelenir. Jeli yavaşça sallayarak iki kez damıtılmış suda 10 dakika daha yıkayın; Yatay bir çalkalayıcı kullanın.
        Dikkat: Etidyum bromür toksik bir bileşiktir; Koruyucu eldiven ve pamuklu bir laboratuar önlüğü giyin.
      5. Bir kit kullanarak jelin ilgili bantlarından vahşi tipli gen DNA'yı saflaştırın. Boyanmış jelin bir UV odacığa yerleştirilmesi ile bantları görselleştirin (Önerilen dalga boyu: 300 nm). Jelin maruziyetini asgari seviyede tutun. Bir DNA saflaştırma kiti kullanın ve üreticinin talimatlarını izleyin.
        Dikkat: UV radyasyonu tehlikelidir; Koruyucu bir kalkan, bardak ve pamuk laboratuar ceketi takın.
    3. Üreticinin talimatlarına göre kısıtlama enzimleri ile saflaştırılmış vahşi tipli genleri ve pUC18 / 19 plasmid DNA'yı özümleyin. Mümkünse hızlı sindirim enzimlerini kullanın. Örneğin, ultrafure su 10 uL, 10X tampon 2 mcL, Kpn I kısıtlama enzimi 1 uL ve Xba I kısıtlama enzimi 1 mcL pUC18 DNA (300 ng / μL) sindirmek 6 mcL. Reaksiyonu 30 dakika boyunca 37 ° C'de bırakın.
      1. Restriksiyon enzimlerini üreticinin talimatlarına göre etkisiz hale getirin. Örneğin, çift sindirim reaksiyonunu Kpn I- Xba I'i 80 ° C'de 5 dakika boyunca etkisiz hale getirin.
    4. Karışım ekleme: hacimsel bir rasattaki vektör DNAO 3: 1. Ligasyon reaksiyonu için üreticinin talimatlarını izleyin. Mümkünse hızlı ligasyon enzimlerini kullanın (reaksiyonu 10 dakika boyunca 25 ° C'de bırakın).
      NOT: Tipik olarak, kitleri kullanarak saflaştırma sonrası DNA konsantrasyonu, sindirim ve ligasyon reaksiyonları için yeterlidir. Örneğin, 6 μL rpoD DNA ( Kpn I- Xba I, 150 ng / μL), 3 μL pUC18 DNA ( Kpn I- Xba I, 150 ng / μL), 10 uL 2x tampon, 1 μL ultra safi ilave edin Su ve 1 uL T4 DNA ligazı. Ligasyon reaksiyonu 25 ° C'de 10 dakika bekletilir.
    5. Yardımcı Materyaller'de açıklandığı üzere E. coli DH5α'yı ligasyon reaksiyonundan 2-4 uL ile değiştirin. Dönüştürülen hücreleri katı LB / Amp / X-gal / IPTG plakalarına yerleştirin. Plakaları gece boyunca 37 ° C'de bırakın.
    6. Beyaz renkli transformant E. coli kolonilerini seçin ve yeni bir LB / Amp plakası üzerine çizin. Plakaları gece boyunca 37 ° C'de bırakın </ Li>
    7. Ek Malzemelerde açıklandığı gibi, reaksiyonun dizilimi için adayları seçmek için bir koloni PCR yapın. Adalardan plazmid DNA'yı çıkarın. Alternatif olarak, insertleri klonlamak için kullanılan aynı restriksiyon enzimleriyle aday plasmid DNA'yı sindirin.
    8. Sıralı servis sağlayıcı ile sıra adayı yapılandırmaları 10 . Bir DNA birleştirici 11 ( Şekil 1 , adım 5) kullanarak diziyi siliko olarak toplayın .
  6. PCR ile plazma bozunumu, ardından kısıtlama enzimi sindirimi.
    1. Sırasıyla vahşi tip ve ampR genleri için kırılma bölgelerindeki silico ileri ve ters oligonükleotidlerde tasarım. Eşdeğer DNA sekansı için vahşi tip fragmanı (adım 1.4'te elde edilen) siliko olarak değiştirin.
      NOT: Bu eşanlamlı DNA sekansı bir sınır enzim bölgesi içerir. İleri ve geri oligonükleotidler tO kısıtlama enzimi sitesi. Oligonükleotidler 21-27 nükleotid arasında değişmeli ve bir sitozin veya guanin ile sonuçlanmalı ve bir kısıtlama enzimi bölgesi içermelidir. Bir ileri oligonükleotit, şablon DNA üzerindeki hedef bölgesi ile aynı sekansa sahiptir. Bir ters oligonükleotit, şablon DNA üzerindeki hedef bölgenin ters tamamlayıcı dizisidir.
    2. PCR reaksiyonları için DNA şablonu olarak iki vahşi tipli gen yapısını kullanın ( örn., PUC18 rpoD ve pUC18 sigA ). Her bir yapının iki tamamlayıcı parçası elde edin (pUC18 rpoD σ1-σ2, pUC18 rpoD σ3-σ4, pUC18 sigA σ1-σ2 ve pUC18 sigAσ3-σ4) ( Şekil 1 , adım 6).
    3. DNA örneklerini agaroz jel içine% 1-1.2 [w / v] yükleyin. PCR ürünlerini DNA şablondan elektroforez ile ayırın ( örn . 1 saat boyunca 110 V). Alternatif olarak, DNA şablonunu kırmak için Dpn I ile PCR reaksiyonlarını sindirin .
      NOT: DpnBen enzim sadece metillenmiş DNA dizilerini tanır (5'-GATC-3 ').
      1. Bir DNA saflaştırma kiti kullanarak numuneleri saflaştırın. Üreticinin yönergelerini izleyin.
    4. Üreticinin talimatlarına göre tüm tamamlayıcı DNA parçalarını uygun kısıtlama enzimleri ile iki kez sindirin. Mümkünse hızlı özüt restriksiyon enzimlerini kullanın. Örneğin, pUC18rpoDσ1-σ2 DNA fragmanını Afl II ve Spe I ile üreticinin protokolünü kullanarak çift-sindirin. Sindirim reaksiyonunu 37 ° C'de 15 dakika bekletin.
    5. Restriksiyon enzimlerini üreticinin talimatlarına göre etkisiz hale getirin. Örneğin, Afl II- Spe I'i 80 ° C'de 20 dakika boyunca etkisiz hale getirin.
  7. DNA ligasyonu ve bakteriyel transformasyon kullanılarak plazma geri kazanım.
    1. İstenilen kimerik geni birleştirmek için uygun DNA fragmanlarını hacimsel 1: 1 oranında karıştırın ( Şekil 31, adım 7).
      NOT: Bu yolla ampR geninin bütünlüğü restore edilerek işlevsel bir protein üretilir.
      1. Örneğin, 4 μL pUC18 rpoD σ1-σ2 DNA ( Afl II- Spe I ile sindirim, 150 ng / μL), 4 uL pUC18 sigA σ3-σ4 DNA'sı ( Afl II- Spe I, 150 ng / μL) 10 uL 2x tampon, 2 uL ultra saf su ve 1 uL T4 DNA ligaz; Kitin arındırılmasından sonraki DNA konsantrasyonu, sindirim ve daha sonra ligasyon için yeterlidir. Ligasyon reaksiyonu 25 ° C'de 10 dakika bekletilir.
    2. E. coli DH5α'yı 3-5 μL'lik kinera montaj ligasyon reaksiyonu ile (Takviye Malzemeleri) değiştirin. Gece boyunca 37 ° C'de gece boyunca LB / Amp / X-gal / IPTG plakalardaki transformant hücreleri büyütün.
    3. Beyaz renkli transformant E. coli kolonilerini seçin ve yeni bir LB / Amp plakası üzerine çizin. Plakaları gece 37'de bırakın° C.
    4. Tamamlayıcı Materyaller'de açıklandığı gibi, bir sekanslama reaksiyonu için aday seçmek için bir koloni PCR yapın. % 1-1.2 (w / v) agaroz jelinde bantları elektroforez yaparak gözlemleyin (adım 2.3.2.1'de açıklanmıştır).
    5. Olumlu adaylardan kültürler kazanın. Plazmid DNA saflaştırma kiti kullanarak onlardan plazmid DNA'yı çıkarın.

2. Sıra Adayı Şimerik Yapılar

  1. Sekans servis sağlayıcısının yönergelerini izleyerek, plasmid DNA'nın kalitesinin sıralama reaksiyonu için yeterince iyi olduğundan emin olun. DNA'yı arıtma kitleri kullanarak çıkarın. Örneğin, sekans hizmet sağlayıcısının İnternet sayfasında, numuneler için önerilen DNA konsantrasyonuna özel dikkat gösterin. Bir DNA kantifikasyon cihazı kullanarak numunelerin konsantrasyonunu elde edin.
  2. Sıralı aday kimerik yapılar ile sıralama servis sağlayıcı 10 .
  3. Birleştirin se In silico DNA assembler ile okuma okuma 11 .
  4. Sıralı hizalama takımları 9 , 12 kullanarak toplayılmış karşı silico- tasarlanmış kimerik sekansları hizalayın. Kimerik genin başarıyla kaynaştığını doğrulayın.

3. Hazırlıklar Yapmak

NOT: Canlı hücreleri içeren tüm basamaklar, Bunsen brülörü açıkken temiz bir lamine akış kaputunda yapılmalıdır.

  1. E. coli DH5α-yetkili hücreleri üretmek.
    1. E. coli-uyumlu hücreleri üretmek için, yayınlanmış protokolleri izleyin veya Ek Malzemelere bakın . Alternatif olarak, piyasada bulunan yetkili hücreleri kullanın.
  2. Dönüşen E. coli DH5α-yetkili hücreler.
    1. E. coli kültürlerinin kimyasal transformasyonu için, yayınlanan protokolleri takip edinClass = "xref"> 13 veya Ek Malzemelere bakın . Alternatif olarak bakteriyel transformasyon için elektroporasyon kullanın. Piyasada bulunan yetkili hücreler kullanılıyorsa, üreticinin yönergelerini izleyin.
  3. E. coli DH5α'dan genomik ve plasmid DNA'yı saflaştırma.
    1. Ek Malzemelerde belirtildiği gibi, piyasada bulunan kitleri kullanarak veya yayınlanan protokolleri takip eden nükleik asit ekstraksiyonu gerçekleştirin 13 .
  4. Koloni PCR yapın.
    1. Sonradan sıralama reaksiyonu için aday transformant kolonileri tanımlamak için bu tekniği kullanın.
      NOT: Bu yöntem, dizilerin bütünlüğünün son bir doğrulamasını temsil etmez. Bu tekniğin ayrıntılı bir açıklaması Yardımcı Materyaller'de mevcuttur .
  5. Çözümlerin hazırlanması.
    1. Görmek
  6. CAPRRESI protokolü için gereken komut dosyalarını ve sıra dosyalarını indirin.
    1. İstenen türlerin tüm genom dizisini içeren gen bank dosyalarını indirin, bir genom tarayıcı kullanarak seçilen genin DNA dizisini çıkarın ve fasta dosya biçiminde kaydedin. CAPRRESI protokolü için gerekli olan Perl komut dosyalarını indirin. Komut dizilerini ve sıra dosyalarını aynı dizinde saklayın.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Şekil 1 , CAPRRESI'yi tasvir etmektedir. Bu yöntemi kullanarak, iki kimerik gen, iki bakteriyel primer sigma faktörünün alanlarını değiştirerek ( yani, E. coli RpoD ve R. etli SigA) toplandı. RpoD ve sigA genlerinin DNA dizileri sırasıyla GenBank genom dosyalarından Artemis Genome Browser 14 kullanılarak NC_000913 ve NC_007761'den elde edildi. PUC18 vektörünün DNA sekansı, NCBI sunucusunun nükleotit veritabanından elde edildi. In silico analizlerinde, REsearch.pl Perl komut dosyasını çalıştırarak DNA dizileri üzerinde kısıtlama enzim siteleri yapılmıştır (bkz. Adım 1.2.2). Bu sonuçlar oligonükleotid dizaynı için kullanılmıştır (basamak 1.2.3). Harici oligonükleotitler, vahşi tip genleri pUC18 çoklu klonlama alanına klonlamak için Xba I ve Kpn I sınırlama enzimleri için tanıma bölgeleri içermektedir. İleriye yönelik oligonükleotid ayrıca bir riboBazı bağlayıcı bölge ( Tablo 2 ). Genomik DNA, LB / Nal çorbası (37 ° C, 220-250 rpm) içinde yetiştirilen E. coli DH5α hücrelerinden ve PY / Nal / CaCl2 suyu (30 ° C, 220-250 rpm'de yetiştirilen R. etli CFN42 hücreleri) ). Bu numuneler, vahşi tipli gen amplifikasyonu için DNA şablonları olarak kullanıldı (aşama 1.5.2).

Vahşi tipli genler, Agaroz jellerinden (DNA saflaştırma kiti) saflaştırılan, Kpn I- Xba I sınır enzimleri ile çift sindirim uygulanmış ve pUC18 vektörüne klonlanmış bir Taq yüksek doğruluklu DNA polimerazı kullanılarak amplifiye edildi. Kimyasal olarak yetkili E. coli DH5α hücreleri, vahşi yapı konstraktları pUC18 rpoD ve pUC18 sigA'ya (adım 1.5.5) tekabül eden ligasyon reaksiyonundan 5 uL ile dönüştürüldü. Transformant hücreler, 37 ° C'de büyütülmüş katı LB / Amp / X-gal / IPTG plakalarında seçildi. Wildtype yapıları Sanger dizilimi ile doğrulanmıştır10 . Sanger sıra okumaları, MIRA 11 kullanılarak birleştirildi (adım 1.5.8).

Vahşi tipli genlerden elde edilen amino asit dizileri, translate.pl komut dosyası çalıştırılarak elde edildi (adım 1.3.1). Vahşi tip genlerin Clustal 12 ile hizalandıktan sonra sırasıyla ampisilin direnç geni ( ampR ) ve vahşi tip primer sigma faktörleri üzerinde amino asit bölgeleri TLV ve NLR seçildi (basamak 1.3.3). Bu amino asit bölgeleri, synonym.pl komut dosyasını çalıştırarak onları kodlayan olası tüm DNA eşanlamlı sekanslarını hesaplamak için kullanılmıştır (adım 1.4.1). REsynonym.pl betiği, daha önce üretilen eşanlamlı DNA dizilerinde bulunan kısıtlama enzimi siteleri aradı (adım1.4.2). Vahşi tipli dizilerle karşılaştırıldığında en düşük sayıda değişiklik getiren eşanlamlı bölgeler seçildi. Birincil sigma faktörü genleri için, Rp'nin vahşi tipli dizileriAA CTTAAG G için oD (AACTTACGT) ve SigA (AACCTTCGC) değiştirildi. İkincisi bir Afl II bölgesi (koyu) içeriyordu. AmpR geni için, vahşi dizi ACGCTGGTG eşanlamlısı AC ACTAGT G ile değiştirilmiştir. Amf genine eklenen eşanlamlı DNA dizisi, bir Spe I bölgesini (cesur) içermektedir. Eşdeğer eş anlamlı sekanslar için vahşi türevin in siliko ikamesi sekans bütünlüğünü ve oligonükleotit tasarımını doğrulamak için yapıldı (basamaklar 1.2-1.4).

Eş anlamlı sekans değişiklikleri uygun oligonükleotitler ( Tablo 2 ) ve DNA şablonları olarak vahşi yapılar (adım 1.5.2) kullanılarak PCR ile ortaya atılmıştır. Amplifikasyon reaksiyonları dört tamamlayıcı parça üretti: pUC18 rpoD σ1-σ2, pUC18 rpoD σ3-σ4, pUC18 sigA σ1-σ2 ve pUC18 sigA σ3-σ4. Tamamlayıcı parçalar disSadece sigma faktörlerini değil aynı zamanda ampR genlerini de bozdu . Tamamlayıcı parçalar, bir DNA saflaştırma kiti (adım 1.6.3) kullanılarak arıtıldı.

Bu tamamlayıcı DNA parçaları, Afl II ve Spe I sınır enzimleri ile çift sindirilmişlerdir (adım 1.6.4). CAPRRESI tasarımına göre, DNA fragmanları pUC18 rpoD σ1-σ2, pUC18 sigA σ3-σ4 ile bağlandı ve chimera 01 elde edildi ve pUC18 sigA σ1-σ2 pUC18 rpoD σ3-σ4 ile bağlandı ve chimera 02 (adım 1.7.1-1.7) birleştirildi .3). Kimyasal olarak yetkili E. coli DH5α hücreleri, pUC18 chim01 ve pUC18 chim02'nin (adım 1.7.4) ligasyon reaksiyonundan 5 uL ile dönüştürülmüştür. Transformant hücreler, 37 ° C'de yetiştirilen katı LB / Amp / X-gal / IPTG plakaları üzerinde seçildi (basamak 1.7.5). Şimerik yapılar Sanger sıralama 10 ile doğrulandı (adım 2). Sanger dizisi rEads, MIRA 11 kullanılarak toplandı ve elde edilen dosyalar Tablo 3'te listelenmiştir. Şekil 2 , bölünmüş bölgelerdeki yabanıl tip ve kimerik genlerin bir araya getirilmiş dizilerinin hizalamalarını (MUSCLE kullanılarak gerçekleştirilmiştir) göstermektedir.

Şekil 1
Şekil 1: CAPRRESI'ye genel bakış. Temsiller: genler (kalın oklar), fonksiyonel plazmidler (kapalı daireler) ve oligonükleotitler (ince, siyah uçlu oklar). Oligonükleotidlere yerleştirilen restriksiyon enzim yerleri renklerde görülür. Kısaltmalar: Wt (vahşi tip), FWD (ileri oligonükleotid), REV (ters oligonükleotid), ampR (ampisilin direnç geni), RES (sınırlama enzimi bölgesi), RE (sınır enzimi). Daha büyük bir versiyon görüntülemek için lütfen tıklayınız.Bu rakamın üzerinde.

şekil 2
Şekil 2: Toplanan vahşi ve kimerik gen dizilerinin hizalanması. Birleştirilmiş DNA dizileri MASCLE 9 kullanılarak hizalandı. Diziler MIRA 11 ile birleştirildi. Eş anlamlı diziler siyah renkte görünüyor. Afl II tanıma bölgesi altı çizili görünmektedir. IUPAC nükleotid kodu: R (A veya G) ve K (G veya T). Yapılar: rpoD (kırmızı), sigA (mavi), şimera 01 dizisi ( rpoD σ1-σ2-sigAσ3-σ4) ve kimerik 02 serisi ( sigA σ1-σ2- rpoD σ3-σ4). Bu rakamın daha büyük bir versiyonunu görmek için lütfen tıklayınız.

Çözüm Bileşenler talimatlar
miktar bileşik
Luria-Bertani (LB) suyu 5 g Maya özütü Tüm bileşenleri suda özün. Otoklav. Kullanıma kadar oda sıcaklığında saklayın. Katı LB suyu için tarife 15 g bakteriolojik agar ekleyin.
10 g Kazein pepton
10 g NaCl
1 L'ye kadar Çift damıtılmış su
LB / Amp / X-gal / IPTG plakaları 100 mL Eritilmiş katı LB suyu Tüm bileşenleri ılıman LB suyu için ekleyin. Petri kaplarını doldurun ve sertleşene kadar bekleyin. Bunsen brülörü açık olan bir temiz lamine akış davlumbazında basamakları gerçekleştirin.
100 uL Ampisilin (Amp) [100 mg / mL]
100 uL X-gal [20 mg / ml]
50 uL 1 M IPTG çözümü
Peptone maya (PY) suyu 3 gr Maya özütü Tüm bileşenleri suda özün. Otoklav. Kullanıma kadar oda sıcaklığında saklayın. Katı PY çorbası için tarife 15 g bakteriolojik agar ekleyin. R. etli kültürü için, kullanımdan önce 700 μL 1 M CaCl 2 solüsyonu ilave edin.
5 g Kazein pepton
1 L'ye kadar Çift damıtılmış su
PY / CaCl 2 / Nal plakalar 100 mL Eritilmiş katı PY suyu Ilıman PY suyu için tüm bileşenleri ekleyin. Petri kaplarını doldurun ve sertleşene kadar bekleyin. Bunsen brülörü açık olan bir temiz lamine akış davlumbazında basamakları gerçekleştirin.
700 μL 1 M CaCI2 çözeltisi
100 uL Nalidiksik asit (Nal) [20 mg / mL]
1 M kalsiyum klorür (CaCl2) çözeltisi 11.1 g CaCl2 CaCI2'yi suda çözün. Otoklav. Oda sıcaklığında saklayın.
100 mL'ye kadar Çift damıtılmış su
Tris-EDTA (TE) 10: 1 pH 8.0 1 mL 1 M Tris çözeltisi Tüm bileşenleri karıştırın. Otoklav. Oda sıcaklığında saklayın.
400 μL 0.25 M EDTA çözeltisi
100 mL'ye kadar Çift damıtılmış su
TE 50:20 pH 8.0 5 mL 1 M Tris çözeltisi Tüm bileşenleri karıştırın. Otoklav. Oda sıcaklığında muhafaza edin. </ Td>
8 mL 0.25 M EDTA çözeltisi
100 mL'ye kadar Çift damıtılmış su
TE 10: 1 10 mM NaCl çözeltisi 58.4 mg NaCl NaCl'yi TE 10: 1'de eritin. Otoklav. Oda sıcaklığında saklayın.
100 mL'ye kadar TE 10: 1 pH 8.0 çözeltisi
Lizis çözeltisi I 80 mg lizozim Çözün ve tüm bileşenleri suda karıştırın. Filtre, 0.22 um'lik bir filtre kullanarak sterilize edin. Oda sıcaklığında saklayın.
2 mL 0.5 M glükoz çözeltisi
400 μL 0.5 M EDTA çözeltisi
500 uL 1 M Tris çözeltisi
20 mL'ye kadar Sterilize edilmiş çift damıtılmış su
Lizis çözeltisi II 1.2 mL 5 M sodyum hidroksit (NaOH) çözeltisi Tüm bileşenleri suda özün. Filtre, 0.22 um'lik bir filtre kullanarak sterilize edin. Oda sıcaklığında saklayın.
3 mL % 10 sodyum dodesil sülfat (SDS) çözeltisi
30 mL'ye kadar Sterilize edilmiş çift damıtılmış su
Lizis çözeltisi III 29.4 g Potasyum asetat (CH3 COOK) Çözün ve tüm bileşenleri suda karıştırın. Filtre, 0.22 um'lik bir filtre kullanarak sterilize edin. Oda sıcaklığında saklayın.
11.5 mL Mutlak asetik asit (CH3COOH)
100 mL'ye kadar Sterilize edilmiş çift damıtılmış su
1 M magnezyum klorür (MgCI2) çözeltisi 9.5 g MgCI2 MgCl2'yi wonra. Otoklav. Oda sıcaklığında saklayın.
100 mL'ye kadar Çift damıtılmış su
3 M sodyum asetat (CH3COONa) çözeltisi 24.6 gr CH3 COONa CH 3 COONa'yı suda eritin. Otoklav. Oda sıcaklığında saklayın
100 mL'ye kadar Çift damıtılmış su
% 10 SDS çözeltisi 10 g SDS SDS'yi düşük hızda manyetik bir karıştırma çubuğu ile su içerisinde eritin. Otoklav. Oda sıcaklığında saklayın.
100 mL'ye kadar Çift damıtılmış su
3 M CH 3 PİŞİRME çözümü 29.4 g CH 3 COOK CH 3 PİŞİRME suyunu suda çözün. Filtre, 0.22 um'lik bir filtre kullanarak sterilize edin. Oda sıcaklığında saklayın. 100 mL'ye kadar Sterilize edilmiş çift damıtılmış su
Proteinaz K çözeltisi 5 mg Proteinaz K Proteinaz K'yi TE 50:20 çözeltisinde çözün. 37 ° C'de 1 saat ısıtılır. -20 ºC'de saklayın.
1 mL'ye kadar TE 50:20 pH 8.0 çözeltisi
RNaz çözeltisi 10 mg RNaz RNaz'ı suda özün. 95 ºC'de 10 dakika ısıtın. -20 ºC'de saklayın.
1 mL'ye kadar Sterilize edilmiş ultra saf su
1 M izopropil-β-D-tiogalaktız (IPTG) çözeltisi 238.3 mg IPTG IPTG'yi suyla çözün. Filtre, 0.22 um'lik bir filtre kullanarak sterilize edin. -20 ºC'de saklayın.
1 mL'ye kadar Sterilize edilmiş ultra saf su
20 mg X-gal X-gal'yi suda çözün. Filtre, 0.22 um'lik bir filtre kullanarak sterilize edin. -20 ºC'de saklayın.
1 mL'ye kadar Sterilize edilmiş ultra saf su
Fenol: kloroform: izoamil alkol 24: 24: 1 çözeltisi 24 mL fenol Tüm bileşenleri karıştırın. 4ºC'de kehribar kapaklı bir şişede saklayın. DİKKAT! Tehlikeli Madde. Koruyucu gözlük, eldiven ve pamuklu laboratuar önlüğü giyin. Bir davlumbaz kullanın. Kullanım sırasında Bunsen brülörünü veya diğer ateş kaynağını KULLANMAYIN. Alternatif: Ticari fenol kullanın: kloroform: izoamil alkol 25: 24: 1 çözeltisi
24 mL kloroform
1 mL Izoamil alkol
0.5 M glükoz çözeltisi 9 g glucose Glikozu suda eritin. Filtre, 0.22 um'lik bir filtre kullanarak sterilize edin. Oda sıcaklığında saklayın.
100 mL'ye kadar Sterilize edilmiş ultra saf su
0.5 M etilendiamintetraasetik asit (EDTA) pH 8.0 çözeltisi 14.6 gr EDTA EDTA'yı suda eritin. PH'ı 5 M NaOH çözeltisi ile ayarlayın. Otoklav. Oda sıcaklığında saklayın.
100 mL'ye kadar Çift damıtılmış su
0.25 M EDTA pH 8.0 çözeltisi 7,3 g EDTA EDTA'yı suda eritin. PH'ı 5 M NaOH çözeltisi ile ayarlayın. Otoklav. Oda sıcaklığında saklayın.
100 mL'ye kadar Çift damıtılmış su
1 M Tris pH 8.0 çözeltisi 12.1 g Tris Tris'i suda çözün. Ile pH ayarlamaMutlak hidroklorik asit (HC1). Otoklav. Oda sıcaklığında saklayın.
100 mL'ye kadar Çift damıtılmış su
5 M sodyum hidroksit (NaOH) çözeltisi 19.9 g NaOH NaOH'yi suda eritin. Oda sıcaklığında saklayın. DİKKAT! Kostik bileşik.
100 mL'ye kadar Sterilize edilmiş çift damıtılmış su
0.1 M NaOH çözeltisi 399 mg NaOH NaOH'yi suda eritin. Oda sıcaklığında saklayın.
100 mL'ye kadar Sterilize edilmiş çift damıtılmış su
Nalidixik asit (Nal) stok solüsyonu 60 mg Nalidiksik asit Nal'ı suda çözün. Filtre, 0.22 um'lik bir filtre kullanarak sterilize edin. 4 ºC'de saklayın.
3 mL'ye kadar 0.1 MNAOH çözeltisi
Ampisilin (Amp) stok çözeltisi 300 mg ampisilin Amp'yi suda çözün. Filtre, 0.22 um'lik bir filtre kullanarak sterilize edin. 4 ºC'de saklayın.
3 mL'ye kadar Sterilize edilmiş çift damıtılmış su
10x tris-asetat-EDTA tamponu 48.4 g Tris Tüm bileşenleri suda özün. Otoklav. Oda sıcaklığında saklayın.
20 ml 0.5 M EDTA çözeltisi
11.44 ml Buzlu asetik asit
1 L'ye kadar Çift damıtılmış su

Tablo 1: Çözelti hazırlama. Çözelti hazırlama talimatları.

Yok hayır. kod Sıra Uzunluk (nt) Özellikler
1 RpoD-FWD GC TCTAGA GA AGGAGA TATCATATGGAGCAAAACCCGCAGTCA 43 XbaI bölgesi; Vahşi tip gen amplifikasyonu ve vektör klonlaması
2 Rod-REV GG GGTACC TTAATCGTCCAGGAAGCTACG 29 KpnI sitesi; Vahşi tip gen amplifikasyonu ve vektör klonlaması
3 SigA-FWD GC TCTAGA GA AGGAGA TATCATATGGCAACCAAGGTCAAAGAG 43 XbaI bölgesi; Vahşi tip gen amplifikasyonu ve vektör klonlaması
4 SigA-REV GG GGTACC TTAGCTGTCCAGAAAGCTTCT </ Td> 29 KpnI sitesi; Vahşi tip gen amplifikasyonu ve vektör klonlaması
3 AmpR-FWD AC ACTAGT GAAAGTAAAAGAT 21 SpeI sitesi yerleştirildi, eşanlamlı mutasyon. AmpR geninin bozulması
4 AmpR-REV TC ACTAGT GTTTCTGGGTGAG 21 SpeI sitesi yerleştirildi, eşanlamlı mutasyon. AmpR geninin bozulması
5 σ2RpoD-FWD AA CTTAAG GCTGGTTATTTCTATCGCT 27 Site eklendi, eş anlamlı mutasyon. Chim01-02 inşaatı
6 σ2RpoD-REV GC CTTAAG TTCGCTTCAACCATCTCTT 27 Site eklendi, eş anlamlı mutasyon. Chim01-02 inşaatı
7 σ2SigA-FWD AA CTTAAG GCTCGTCATTTCAATCGCC 27 Site eklendi, eş anlamlı mutasyon. Chim01-02 inşaatı
8 σ2SigA-REV GC CTTAAG TTCGCTTCGACCATTTCCT 27 Site eklendi, eş anlamlı mutasyon. Chim01-02 inşaatı

Tablo 2: Oligonükleotid dizileri. Restriksiyon enzim siteleri altı çizili görünür. Ribozom bağlayıcı bölge: kalın.

İnşaat Sıra dosyası Kalite dosyası
chimera01 chim01_out.unpadded.fasta chim01_out.unpadded.fasta.qual
chim01_A3 / B3 / E2 / F2 / G2 /H2.pdf
chimera02 chim02_out.unpadded.fasta chim02_out.unpadded.fasta.qual
chim02_C3 / D3 / E3 / F3 / G3 / H3.pdf
rpoD rpod_out.unpadded.fasta rpod_out.unpadded.fasta.qual
sigA siga_out.unpadded.fasta siga_out.unpadded.fasta.qual

Tablo 3: MIRA assembler ve DNA sequencer ile elde edilen sekans dosyaları. Sanger dizilim okumaları kimerik ve vahşi yapılar haritalama seçeneğini kullanarak MIRA 11 yazılımı ile birleştirildi. Kimera dizilişinin kromatogramları PDF dosyaları olarak görünür.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

CAPRRESI, PRM 2'ye alternatif olarak tasarlandı. Orijinal PRM güçlü bir tekniktir; Seçilen genlerin herhangi bir kısmı boyunca DNA sekanslarının kaynaşmasına izin verir. PRM için, vahşi tipli genler aynı plazmid içine klonlanmalıdır. Bundan sonra, oligonükleotidler, plasmidde bulunan vahşi tip ve antibiyotik direnç genleri içinde tasarlanır. Plazmid parçalanması, künt uçlu, yüksek doğrulukta DNA polimerazları ve önceden tasarlanmış oligonükleotitler kullanılarak PCR ile sağlanır. Tamamlayıcı PCR ürünlerinin ligasyonu, kimerik genleri toplar ve antibiyotik direnç kasetini düzenler, böylece fonksiyonel plazmid iyileşmesi sağlanır. PRM, aynı plazmid arka planında kimerik gen kütüphanelerinin oluşturulmasını sağlar. Maalesef, künt uçlu DNA sekanslarının ligasyonu teknik olarak zor olabilir. Çakışan PCR fragmanları 1 tarafından meydana getirilen kimera montajı ayrıca DNA polimerazlarının kör uçlu ürünleri üretmesini veHer reaksiyon için DNA saflaştırması. Bu teknikle toplanan kimerik genler doğrusal DNA ürünleridir. Her bir yapının hedef vektöre kopyalanması daha ileri analizlerin yapılmasını geciktirebilir.

CAPRRESI, PRM'nin güçlü yanlarının birçoğundan yararlanır ve eşanlamlı DNA sekans bölgeleri üzerinde kısıtlama enzimi alanlarını kullanarak tamamlayıcı DNA fragmanlarının ligasyonunu basitleştirir. Bu nedenlerden dolayı, CAPRRESI, künt uçlu DNA polimerazları gerektirmez. Eşanlamlı DNA sekanslarının kullanılması, kimera montajı için füzyon bölgelerini sınırlar, ancak ligasyon verimliliğini arttırır. CAPRRESI'de tanıtılan bir başka önemli değişiklik, kimerik silahların pUC18 / 19 vektörlerinde toplanması ve işlenmesidir. Bu vektörler daha önce belirtildiği gibi birçok avantajlı özelliğe sahiptir. Şimerik DNA, inşaat vektörünü E. coli konukçularına yayarak elde edilebilir. Kimerik genlerin son plazmite ( örn . , Bir ekspresyon vektörü) klonlanması, bazengereklidir.

CAPRRESI ayrıca DNA ve amino asit sekanslarının in silico işlemesine dayanır. Geçici Perl betiği, vahşi tiplendirilmiş genlerin klonlanması için uygun kısıtlama enzimlerinin seçilmesini, kırılma bölgelerine karşılık gelen tüm eşanlamlı DNA sekanslarının hesaplanmasını (kimera montajı için) ve plazmid geri kazanımını basitleştirmek için restriksiyon enzimlerinin belirlenmesini sağlar. Bu koşullar göz önüne alındığında CAPRRESI, protein kodlayan genlerin kaynaştırılması için bir alternatiftir. CAPRRESI protokolünün kritik adımları şunlardır: 1) kırılma bölgelerinin seçimi ve 2) PCR ürünlerinin saflaştırılması. Bölünme bölgeleri, eş anlamlı sekansların hesaplandığı ve yabani tip sekanslarda bulunmayan kısıtlama enzim siteleri üreten uzantılardır. Kimera montajı için kısıtlama enzimi alanlarının kullanılması, künt uçlu ürünler üreten ve ligasyon reaksiyonunu kolaylaştıran DNA polimerazlarına olan ihtiyacı ortadan kaldırır. Tüm bölgelerde kullanılabilir kısıtlama enzim siteleri bulunmayacaktır; foBu sebepten, en iyi sekans gerginliği bulunana dek bir seferde kırma bölgelerinin bir amino asit ile hareket ettirilmesi önerilir. In silico tasarım kırılma bölgelerinin hareketi için izin vermezse veya eşanlamlı DNA sekanslarının uygun restriksiyon enzimi mevkilerine sahip olmaması durumunda, hedef genleri örtüşen oligonükleotidler kullanarak kaynaştırmak ve eşanlamlı DNA sekanslarını ampisilin direnç genine sokmak önerilir (Vektörde bulunur). Bu yolla, genler herhangi bir bölümde kaynaştırılabilir ve plazmid geri kazanımı, tek bir sitenin ligasyonuna dayanır (yalnızca bir kısıtlama enzimi ile sindirilir). CAPPRESI'nin esnekliği, diğer tekniklerle birlikte yapılmasını sağlar.

PCR ürünlerinin saflaştırılması şablon DNA'yı ortadan kaldırmak için gerçekleştirilir ve tamamlayıcı DNA fragmanlarının bağlanmasından sonra ebeveyn plasmid kontaminasyon şansını azaltır. Bu iki kritik adımın yerine getirilmesi, baseni arttırırCAPRRESI'nin kimyasal olarak yetkili (CaCl2) veya elektrokompetan E. coli hücreleriyle gerçekleştirilmesine izin veren, anten transformasyon verimliliği (doğru olarak monte edilmiş konstrüksiyonların sayısı). Yetkili hücrelerin ilk türü, çoğu laboratuarda bakteri dönüşümü için kullanılan en ucuz E. coli kaynağını temsil eder. CAPRRESI, daha önce gösterilen özelliklerin hepsinden dolayı, kimera montajı için kullanışlı bir seçenektir.

Üstelik, CAPRRESI örtüşen PCR fragmanları veya plasmid geri kazanım teknikleri ile birlikte çalışabilir. Örneğin, tamamlayıcı DNA kısmı başına iki eş anlamlı dizinin eklenmesi yerine, arzu edilen kırma bölgesi (hedef yabani genler üzerinde), araya giren dizileri kaynaştırmak için çakışan oligonükleotidleri kullanabilir. Sinonim sekanslarının girişi pUC18 / 19 vektörlerinin ampR geni ile sınırlandırılabilir ve plazmiti onarmak için sadece bir kısıtlama enzimi kullanılmasına neden olabilirD bütünlüğü. Bu gelecekteki uygulamalar, ligasyon verimliliğinden ödün vermeden herhangi bir DNA dizisinin ( yani sadece protein kodlayan genlerin değil) kaynaşmasına izin vererek CAPRRESI'yi güçlendirebilir.

CAPRRESI testi için, iki vahşi birincil sigma faktör geni: rpoD ( E. coli ) ve sigA ( R. etli ) bölgelerinin değiş tokuşu ile iki kimerik sigma faktörü toplandı. Bilinen tüm birincil sigma faktörleri dört alan içerir: σ1 - σ4 8 . Kimer 01, RpoDσ1-σ2 ve SigAσ3-σ4'ten oluşurken, kimera 02'nin SigAσ1-σ2 ve RpoDσ3-σ4'ü vardır. Kimerik yapıların bütünlüğü Sanger sıralama 10 ile doğrulandı ( Şekil 2 ).

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarlar rakip mali çıkarlarının olmadığını beyan ettiler.

Acknowledgments

Bu çalışma Consejo Nacional de Ciencia y Tecnología, CONACYT, Meksika (hibe numarası 154833) ve Universidad Nacional Autónoma de Mexico tarafından desteklendi. Yazarlar, Víctor González, Rosa I. Santamaría, Patricia Bustos ve Soledad Juarez'e idari ve teknik tavsiyeler için teşekkür etmek istiyorlar.

Materials

Name Company Catalog Number Comments
Platinum Taq DNA polymerase High Fidelity Thermo Fisher 11304011 Produces a mix of blunt/3’-A overhang ended PCR products
High pure plasmid isolation kit Roche 11754785001 Used for all plasmid purification reactions
High pure PCR product purification kit Roche 11732676001 Used for all PCR purification reactions from agarose gels
AflII restriction enzyme New England Biolabs R0520L Recognizes sequence 5’-CTTAAG-3’ and cuts at 37 °C
KpnI-HF restriction enzyme New England Biolabs R3142L Recognizes sequence 5’-GGTACC-3’ and cuts at 37 °C
SpeI-HF restriction enzyme New England Biolabs R3133L Recognizes sequence 5’-ACTAGT-3’ and cuts at 37 °C
XbaI restriction enzyme New England Biolabs R0145L Recognizes sequence 5’-TCTAGA-3’ and cuts at 37 °C
Ampicillin sodium salt Sigma Aldrich A0166-5G Antibiotics
Nalidixic acid Sigma Aldrich N8878-5G Antibiotics
Yeast Extract Sigma Aldrich Y1625-1KG Bacterial cell culture
Casein peptone Sigma Aldrich 70171-500G Bacterial cell culture
NaCl Sigma Aldrich S9888-1KG Sodium chloride
Agar Sigma Aldrich 05040-1KG Bacterial cell culture
XbaI restriction enzyme Thermo Fisher FD0684 Fast digest XbaI enzyme
KpnI restriction enzyme Thermo Fisher FD0524 Fast digest KpnI enzyme
Quick Ligation Kit New England Biolabs M2200S Fast DNA ligation kit
AflII restriction enzyme Thermo Fisher FD0834 Fast digest AflII enzyme
SpeI restriction enzyme Thermo Fisher FD1253 Fast digest SpeI enzyme

DOWNLOAD MATERIALS LIST

References

  1. Horton, R. M., Hunt, H. D., Ho, S. N., Pullen, J. K., Pease, L. R. Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene. 77, (1), 61-68 (1989).
  2. Vos, M. J., Kampinga, H. H. A PCR amplification strategy for unrestricted generation of chimeric genes. Anal. Biochem. 380, (2), 338-340 (2008).
  3. Hawkins, N. C., Garriga, G., Beh, C. T. Creating Precise GFP Fusions in Plasmids Using Yeast Homologous Recombination. Biotechniques. 34, (1), 1-5 (2003).
  4. Sander, J. D., Joung, J. K. CRISPR-Cas systems for editing, regulating and targeting genomes. Nat Biotechnol. 32, (4), 347-355 (2014).
  5. Nagy, A. Cre recombinase: The universal reagent for genome tailoring. Genesis. 26, (2), 99-109 (2000).
  6. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods. 6, (5), 343-345 (2009).
  7. Norrander, J., Kempe, T., Messing, J. Construction of improved M13 vectors using oligodeoxynucleotide-directed mutagenesis. Gene. 26, (1), 101-106 (1983).
  8. Gruber, T. M., Gross, C. A. Multiple sigma subunits and the partitioning of bacterial transcription space. Annu Rev Microbiol. 57, 441-466 (2003).
  9. Edgar, R. C. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 32, (5), 1792-1797 (2004).
  10. Macrogen Inc. Seoul, Rep. Of Korea. Available from: http://dna.macrogen.com/eng/index.jsp (2016).
  11. Chevreux, B. MIRA: an automated genome and EST assembler. Available from: http://www.chevreux.org/thesis/index.html 1-161 (2005).
  12. Thompson, J. D., Gibson, T. J., Higgins, D. G. Multiple sequence alignment using ClustalW and ClustalX. Curr Protoc Bioinformatics. Chapter 2 (Unit 2.3) 1-22 (2002).
  13. Sambrook, J., Russell, D. W. Molecular Cloning: A laboratory manual. CSHLP. (2001).
  14. Rutherford, K., et al. Artemis: sequence visualization and annotation. Bioinformatics. 16, (10), 944-945 (2000).
CAPRRESI: Plazmid Geri Kazanım ve Kısıtlama Enzim Yerinin Eklenmesi ile Chimera Meclisi
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Santillán, O., Ramírez-Romero, M. A., Dávila, G. CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion. J. Vis. Exp. (124), e55526, doi:10.3791/55526 (2017).More

Santillán, O., Ramírez-Romero, M. A., Dávila, G. CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion. J. Vis. Exp. (124), e55526, doi:10.3791/55526 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter