Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biology

तकनीक प्रेरित और यों सेलुलर बुढ़ापा को

doi: 10.3791/55533 Published: May 1, 2017

Summary

सेलुलर बुढ़ापा, सेल चक्र गिरफ्तारी के अपरिवर्तनीय राज्य, विभिन्न सेलुलर तनाव द्वारा प्रेरित किया जा सकता है। यहाँ, हम सेलुलर बुढ़ापा और तरीकों के लिए प्रेरित करने बुढ़ापा के मार्करों आकलन करने के लिए प्रोटोकॉल का वर्णन।

Abstract

कोशिकीय तनाव या क्षति के जवाब में, proliferating कोशिकाओं एक विशिष्ट कार्यक्रम है कि लंबी अवधि के सेल चक्र गिरफ्तारी के एक राज्य शुरुआत करता है, सेलुलर बुढ़ापा करार दिया पैदा कर सकते हैं। वृद्ध होनेवाला कोशिकाओं का संचय जीवधारी उम्र बढ़ने के साथ और इन विट्रो में नित्य संवर्धन के माध्यम से होता है। वृद्ध होनेवाला कोशिकाओं भ्रूण के विकास, ऊतक की मरम्मत और उत्थान, ट्यूमर दमन, और उम्र बढ़ने सहित कई जैविक प्रक्रियाओं, प्रभावित करते हैं। वृद्ध होनेवाला कोशिकाओं की पहचान शामिल है, लेकिन वृद्धि हुई बुढ़ापा जुड़े β-galactosidase गतिविधि (SA-β-गल) सीमित नहीं हैं; p16 INK4A, p53, और p21 के स्तर; डीएनए की क्षति के उच्च स्तर, γ-H2AX सहित; बुढ़ापा जुड़े हेट्रोक्रोमैटिन Foci (SAHF) के गठन; और एक बुढ़ापा जुड़े स्रावी phenotype (SASP), एक घटना समर्थक भड़काऊ साइटोकिन्स और संकेत अणुओं के एक नंबर के स्राव की विशेषता के अधिग्रहण। यहाँ, हम दोनों replicative के लिए प्रोटोकॉल का वर्णन औरसंवर्धित कोशिकाओं में डीएनए की क्षति प्रेरित बुढ़ापा। इसके अलावा, हम SA-β-गल, γ-H2AX और SAHF धुंधला सहित कई बुढ़ापा जुड़े मार्करों, का उपयोग करते हुए वृद्ध होनेवाला फेनोटाइप नजर रखने के लिए, और कोशिका चक्र नियामकों और SASP कारकों में से प्रोटीन और mRNA के स्तर अंदाजा लगाना तकनीक पर प्रकाश डाला। इन विधियों विभिन्न मॉडल और ऊतकों में बुढ़ापा के आकलन के लिए आवेदन किया जा सकता है।

Introduction

आधे से अधिक एक सदी पहले, हेफिलिक और उनके सहयोगियों ने बताया कि किस तरह untransformed कोशिकाओं संस्कृति में पैदा करना है, लेकिन केवल समय 1 की एक निश्चित अवधि के लिए। मानव fibroblasts के लंबे समय तक संवर्धन कोशिकाओं proliferating बंद करने के लिए कारण होता है; तथापि, वे पाचन सक्रिय थे, और इस सेलुलर बुढ़ापा बुलाया गया था। बुढ़ापा tumorigenesis बाधा के लिए फायदेमंद हो सकता है, लेकिन यह भी, हानिकारक हो सकता है के रूप में यह है कि उम्र बढ़ने के 2, 3 के साथ होता है पुनर्योजी क्षमता के नुकसान के लिए योगदान माना जाता है। वृद्ध होनेवाला कोशिकाओं ऊतकों में जमा करने के लिए के रूप में 4 साल की उम्र मनुष्य और भ्रूण के विकास, घाव भरने, ऊतक की मरम्मत, और उम्र से संबंधित सूजन 2 सहित जैविक प्रक्रियाओं, की संख्या में फंसाया गया है दिखाया गया है।

संस्कृति में कोशिकाओं के नित्य passaging replicative बुढ़ापा, जो जोड़ा गया है लाती हैउदासीनता और जीनोमिक अस्थिरता टेलोमेर करने के लिए। डीएनए की क्षति और ओंकोजींस सहित विभिन्न सेल तनाव,, भी बुढ़ापा 3 हो सकता है। टेलोमेर उदासीनता के अलावा अन्य कारकों की वजह से बुढ़ापा अक्सर तनाव प्रेरित या समय से पहले बुढ़ापा कहा जाता है और आम तौर पर p16 INK4A / Rb मार्ग 5 पर निर्भर करता है। हालांकि proliferating, untransformed कोशिकाओं आम तौर पर आकार में धुरी दिखाई देते हैं, वृद्ध होनेवाला कोशिकाओं कुछ विशेषताओं वाले, एक फ्लैट, बड़े आकृति विज्ञान और वृद्धि की बुढ़ापा जुड़े β-galactosidase गतिविधि (SA-β-गल) (आंकड़े 1 और 2) सहित के रूप में पहचाना जा सकता है। वृद्ध होनेवाला कोशिकाओं में भी डीएनए की क्षति मार्करों जमा, γ-H2AX (चित्रा 3) 6, और, संभावित, बुढ़ापा जुड़े हेट्रोक्रोमैटिन फोकी (SAHF) (चित्रा 4) 7 सहित। वृद्ध होनेवाला कोशिकाओं कोशिका चक्र नियामकों के उच्च स्तर, पी सहित 16 (p16 INK4A) और / या p21 और p53 (चित्रा 5) 8, 9। इसके अलावा, हाल ही के डेटा से पता चला है वृद्ध होनेवाला कोशिकाओं पूर्व-शोथ साइटोकिन्स और chemokines के एक नंबर के स्राव द्वारा गैर स्वायत्त प्रभाव हो सकता है कि बुढ़ापा जुड़े स्रावी phenotype (SASP) 10 कहा जाता है। हालांकि इस SASP घटना कोशिका प्रकार से कोशिका प्रकार के लिए भिन्न हो सकते हैं, सामान्य रूप में, यह इंटरल्युकिन 6 (आईएल -6), आईएल -8, granulocyte-बृहतभक्षककोशिका कॉलोनी उत्तेजक कारक (जीएम-सीएसएफ), growth- में वृद्धि से प्रदर्शित किया गया है विनियमित ओंकोजीन α (GRO-α), और GRO-β, दूसरों के बीच (चित्रा 6)। विशेष रूप से तनाव या नुकसान है कि बुढ़ापा लाती भी स्रावी फेनोटाइप 11, 12, 13 को प्रभावित कर सकते। SASP ELISAs या साइटोकाइन / प्रोटीन सरणियों का उपयोग कर स्रावित प्रोटीन के स्तर को मापने के द्वारा पता लगाया जा सकतारों = "xref"> 10, 14। हालांकि बाद ट्रांस्क्रिप्शनल तंत्र SASP प्रोटीन के स्तर 11, नियमित कर सकते हैं 15, 16, 17, mRNA स्तर में परिवर्तन भी कई मामलों में पता लगाया जा सकता। इन परिवर्तनों को आम तौर पर और अधिक संवेदनशील और प्रोटीन के स्तर का मापन से अंदाजा लगाना आसान होता है। अन्य वृद्ध होनेवाला मार्कर भी लगातार डीएनए की क्षति परमाणु फोकी, बुढ़ापा (डीएनए निशान) 18 मजबूत क्रोमेटिन परिवर्तन के साथ डीएनए सेगमेंट नामक और विभिन्न अन्य मार्करों 3, 19, 20 सहित, मूल्यांकन किया जा सकता।

यहाँ, हम SA-β-Gal, γ-H2AX, SAHF सहित बुढ़ापा के कई मार्करों, को मापने के लिए संस्कृति में कोशिकाओं में बुढ़ापा उत्प्रेरण और यह भी के लिए आम तकनीकों का वर्णन है, और प्रोटीन और senesce के mRNAnce जुड़े अणुओं।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. उत्प्रेरण replicative बुढ़ापा

  1. पिघलना कम पारित होने के मानव द्विगुणित fibroblasts (जैसे, WI-38 और शिशु मृत्यु दर-90) या अन्य सेल लाइनों।
    नोट: यहाँ, मानव द्विगुणित fibroblasts इस्तेमाल किया गया है, लेकिन इन प्रोटोकॉल ऐसे endothelial, उपकला, या मीजेनकाइमल स्टेम कोशिका के रूप में अन्य प्रकार की कोशिकाओं, में बुढ़ापा का आकलन किया जा सकता है। संवर्धन की स्थिति अलग विकास दर या विकास की स्थिति की वजह से इस्तेमाल किया विभिन्न प्रकार की कोशिकाओं के लिए अनुकूलित किया जा सकता है।
    नोट: कोशिकाओं proliferating हो सकता है और एक धुरी आकारिकी (एक योजनाबद्ध और उदाहरण के लिए चित्र 2 के लिए चित्रा 1 देखें) होना चाहिए। आदर्श रूप में, कोशिकाओं संभव replicative वृद्ध होनेवाला कोशिकाओं होने से बचाने के प्रयोगों के शुरू में 30 <एक जनसंख्या दोहरीकरण स्तर (पीडीएल) होनी चाहिए।
    1. निम्न समीकरण पीडीएल = लॉग (एन एफ / एन 0) / log2, जहां एन अंतिम सेल नंबर और है का उपयोग कर कोशिकाओं के पीडीएल की गणना करें <em> एन 0 वरीयता प्राप्त कोशिकाओं 21 की प्रारंभिक संख्या है।
  2. संस्कृति Dulbecco संशोधित ईगल मध्यम (DMEM) में वाई-38 कोशिकाओं 10% भ्रूण गोजातीय सीरम (एफबीएस), 1% अनावश्यक अमीनो एसिड होता है, और 1% पेनिसिलिन / स्ट्रेप्टोमाइसिन के साथ पूरक।
  3. DMEM में शिशु मृत्यु दर 90 कोशिकाओं 10% एफबीएस और 1% पेनिसिलिन / स्ट्रेप्टोमाइसिन के साथ पूरक के लिए आगे बढ़ें।
  4. 37 डिग्री सेल्सियस पर सभी कोशिकाओं को बढ़ने और 5% सीओ 2. लगातार कोशिकाओं को बढ़ने और हर 2 विभाजित - 4 घ जब कोशिकाओं तक पहुँचने ~ 70 - 80% संगम। एक प्रकाश सूक्ष्मदर्शी का उपयोग करके सेल संगम की निगरानी करें। उच्च संगम के साथ कोशिकाओं से बचें, के रूप में इस निषेध संपर्क की वजह से कोशिकाओं की वृद्धि को प्रभावित कर सकते हैं।
  5. वृद्ध होनेवाला कोशिकाओं की रूपात्मक उपस्थिति के लिए एक प्रकाश खुर्दबीन के नीचे कोशिकाओं की निगरानी करें और के लिए (आंकड़े 1 और 2 देखें) जब वहाँ अगले करने के लिए एक उप-संस्कृति से पीडीएल में कोई परिवर्तन नहीं है।

2. डीएनए नुकसान प्रेरित बुढ़ापा

    (जैसे, WI-38, शिशु मृत्यु दर-90, या किसी अन्य प्रकार की कोशिका) एक विरल घनत्व (यानी ~ 300,000 कोशिकाओं / 6 सेमी पकवान) विश्लेषण के प्रकार (प्रोटीन के लिए यानी एक 6 सेमी पकवान के लिए एक उपयुक्त डिश में / आरएनए मार्करों या SA-β-गल धुंधला के लिए एक 6 अच्छी तरह से पकवान)। उपयोग जल्दी पारित होने कोशिकाओं है कि युवा और proliferating (<30 पीडीएल) कर रहे हैं और उन्हें थाली ताकि कोशिकाओं लगभग 50 कर रहे हैं - अगले दिन पर 60% संगामी।
  1. एक गिलास एक वैक्यूम से जुड़े पिपेट का उपयोग कर विकास का माध्यम निकालें और 1x फॉस्फेट बफर खारा (पीबीएस) जोड़कर कोशिकाओं को धोने। दो धोने के कुल के लिए इस चरण को दोहराएँ। दोनों एक "नकली" माना जाता है और एक आयनीकरण करने वाले विकिरण (आईआर) के लिए इलाज हालत के लिए (एक 6 सेमी पकवान के लिए ~ 750 μL) पीबीएस की एक पतली परत जोड़ें।
  2. आईआर के 10 ग्रे (Gy) की एक खुराक के लिए कोशिकाओं का पर्दाफाश करने के एक गामा irradiator का उपयोग करें; यह सबसे सेल लाइनों के लिए एक विशिष्ट संपर्क में है। एक हुड में, पीबीएस हटाने और विकास माध्यम से बदल दें। वैकल्पिक रूप से, ख के साथ कोशिकाओं का इलाज20 माइक्रोग्राम / 2 घंटे के लिए एमएल पर leomycin।
  3. हर 48 -7 2 ​​घंटे कोशिकाओं पर मध्यम बदलें और यदि आवश्यक हो तो कोशिकाओं अलग हो गए।
  4. आईआर उपचार के बाद 10 घ - वृद्ध होनेवाला मार्करों 7 के लिए रूपात्मक परिवर्तन (एक योजनाबद्ध और चित्रा 2 प्रतिनिधि सेल छवियों के लिए के लिए चित्रा 1 देखें) और परख के लिए एक प्रकाश खुर्दबीन के नीचे कोशिकाओं की निगरानी करें।
    नोट: यह प्रोटोकॉल आईआर द्वारा प्रेरित बुढ़ापा वर्णन करता है। बुढ़ापा भी bleomycin (स्थितियों के लिए ऊपर देखें) सहित अन्य तनाव, द्वारा प्रेरित किया जा सकता है एच 22 22, 23, कीमोथेरेपी दवाओं 24, सिगरेट का धुआँ 25, बदलने वृद्धि कारक (TGF) -β1 26, 27, और अन्य तरीकों 21 , 28, 29।

3. धुंधला सेलबुढ़ापा जुड़े β-galactosidase के लिए ls

  1. धुंधला करने से पहले, रूपात्मक परिवर्तन की निगरानी के लिए एक प्रकाश खुर्दबीन के नीचे कोशिकाओं की जांच।
    नोट: वृद्ध होनेवाला कोशिकाओं आम तौर पर बढ़े और फ्लैट कर रहे हैं, proliferating कोशिकाओं है, जो एक धुरी आकारिकी (एक योजनाबद्ध और प्रतिनिधि परिणामों के लिए चित्र 2 के लिए चित्रा 1 देखें) है के विपरीत है। Proliferating कोशिकाओं एक नकारात्मक नियंत्रण के रूप में इस्तेमाल किया जा सकता है, और आईआर या किसी अन्य डीएनए को नुकसान पहुँचाए एजेंट (धारा 2 देखें) के साथ इलाज किया कोशिकाओं सकारात्मक नियंत्रण के रूप में इस्तेमाल किया जा सकता।
  2. एक वाणिज्यिक किट (देखें सामग्री तालिका) से अभिकर्मकों का उपयोग कर SA-β-गल गतिविधि यों। सभी अभिकर्मकों पिघलना और 37 डिग्री सेल्सियस के लिए उन्हें वार्मिंग से कमरे के तापमान के लिए उन्हें लाने के लिए।
    1. धुंधला समाधान और बंधक के समाधान के लिए आवश्यक की राशि की गणना।
      नोट: आमतौर पर, एक 1 एमएल मात्रा एक 6 अच्छी तरह से थाली में एक अच्छी तरह से करने के लिए पर्याप्त है। अलग प्लेट आकार इस्तेमाल किया जा सकता है, लेकिन एक 6 अच्छी तरह से थाली आकार wel हैप्रत्येक शर्त के लिए तीन प्रतियों में एक परख प्रदर्शन करने के लिए एल-उपयुक्त है। यह घनत्व आमतौर पर कोशिकाओं की एक अतिरिक्त संख्या का उपयोग कर के बिना गिनती करने के लिए क्षेत्र के अनुसार कोशिकाओं के लिए पर्याप्त संख्या में उपलब्ध कराता है।
    2. आसुत जल से धुंधला समाधान 01:10 पतला।
    3. आसुत जल से बंधक समाधान 01:10 पतला।
    4. के 1 एमएल में जैसे, एक्स-गल की 20 मिलीग्राम, एन, एन dimethylformamide (DMF में एक्स-गल (5-ब्रोमो-4-क्लोरो 3-indolyl-β-D-galactopyranoside) के एक 20x शेयर समाधान तैयार करें DMF)। किट का उपयोग को अधिकतम करने के लिए, राशि प्रत्येक परख के लिए आवश्यक करने के लिए एक्स-गल बाहर मापने और उसके बाद भंग करने के लिए DMF के गणना की राशि जोड़। वैकल्पिक रूप से, एक महीने के लिए एक प्रकाश की रक्षा की ट्यूब में -20 डिग्री सेल्सियस पर स्टॉक समाधान की दुकान। कमजोर और एक्स-गल समाधान के भंडारण के लिए केवल polypropylene (अपारदर्शी) ट्यूब का प्रयोग करें।
    5. 1x धुंधला समाधान के 930 μL, धुंधला पूरक एक के 10 μL, धुंधला पूरक बी के 10 μL, और 20 मिलीग्राम के 50 μL / एमएल एक्स: β-गल धुंधला समाधान तैयारDMF में -gal। कितने कुओं दाग करने की आवश्यकता के आधार पर एक मास्टर मिश्रण बनाओ।
  3. ध्यान से एक हस्तांतरण पिपेट या समकक्ष का उपयोग कर कोशिकाओं से मध्यम निकालें।
  4. धीरे कमरे के तापमान पीबीएस 1x के साथ एक बार कोशिकाओं को धोने।
  5. अच्छी तरह से प्रत्येक के लिए 1 1x की एमएल बंधक समाधान जोड़ें और 10 के लिए सेते हैं - आर टी पर 15 मिनट।
  6. एक हस्तांतरण विंदुक के साथ बंधक समाधान निकालें।
    नोट: बंधक समाधान (1x) 2% formaldehyde और 0.2% glutaraldehyde होता है और प्रयोगशाला सुरक्षा कार्यालय की सिफारिशों के अनुसार एक खतरनाक कचरे के रूप में निपटाया जाना चाहिए।
  7. धीरे 1x पीबीएस के साथ दो बार कोशिकाओं को धोने।
  8. पीबीएस पूरी तरह से निकालें और कुओं (1 एमएल / अच्छी तरह से एक 6 अच्छी तरह से थाली) के लिए 1x β-गल धुंधला समाधान जोड़ें। एल्यूमीनियम पन्नी के साथ पूरी तरह से थाली कवर और 24 के लिए सेते हैं - एक 37 डिग्री सेल्सियस इनक्यूबेटर में 48 घंटे (अधिमानतः सीओ 2 के अभाव में, के रूप में इस बफर का पीएच कम और धुंधला प्रभावित कर सकते हैं)।
    1. धुंधला के लिए 24 घंटे पर कोशिकाओं की जाँच करें, और अगर दाग भी हल्का है, एक और 24 घंटे के लिए सेते हैं।
  9. ऊष्मायन समय के बाद, β-गल समाधान निकालें और 1x पीबीएस के साथ बदलना।
    नोट: यह कदम पृष्ठभूमि रंग के कुछ को हटा जब इमेजिंग और भी एक्स-गल समाधान के खतरनाक spilling से बचाता है।
    नोट: β-गल समाधान ठीक से का निपटान, प्रयोगशाला सुरक्षा कार्यालय की सिफारिशों के अनुसार।
  10. एक संलग्न कैमरा एक 10x या उच्चतर उद्देश्य का उपयोग कर के साथ एक प्रकाश माइक्रोस्कोप पर कोशिकाओं की जांच; SA-β-गल पॉजिटिव कोशिकाओं नीला हो जाएगा। प्रयोग के लिए छवियों की वांछित संख्या प्राप्त। अगर SA-β-गल पॉजिटिव कोशिकाओं का प्रतिशत गिनती, छवियों की उपयुक्त संख्या प्रति अच्छी तरह से (> 5) मात्रा के लिए प्राप्त करते हैं। सुनिश्चित करें कि छवियों अच्छी तरह से प्रत्येक के भीतर देखने के विभिन्न क्षेत्रों से गैर-अतिव्यापी हैं।
  11. SA-β-गल पॉजिटिव (नीला) की संख्या की गणना कुल कोशिकाओं की संख्या की तुलना में कोशिकाओंSA-β-गल पॉजिटिव कोशिकाओं के प्रतिशत की गणना करने के। शर्तों के अनुसार> 100 कोशिकाओं की गणना करें।
    नोट: प्रतिनिधि तस्वीरें भी आंकड़े के लिए इस्तेमाल किया जा सकता है। ध्यान दें कि सेल confluency गिनती कोशिकाओं अगर महत्वपूर्ण है, के रूप में बहुत अधिक सेल यह मुश्किल प्रत्येक कोशिका को अलग करने के लिए और भी कुछ मात्रा और आँकड़ों के लिए कोशिकाओं के लिए पर्याप्त संख्या में नहीं दे सकता है बनाते हैं। प्रकाशन के लिए आंकड़े के लिए चित्र सबसे अच्छा संकल्प पर हैं, .tiff फ़ाइलें के रूप में सहेजा हालांकि .jpeg फ़ाइलें भी उपयुक्त हैं। रंग छवियों 300 dpi होना चाहिए।

4. γ-H2AX के लिए धुंधला कोशिकाओं

  1. एक 24 अच्छी तरह से थाली में कांच coverslips पर धारा 1 या 2 से कोशिकाओं प्लेट।
  2. अगले दिन, 1x पीबीएस के साथ कोशिकाओं को धोने। ध्यान से कुल्ला, वृद्ध होनेवाला कोशिकाओं coverslips के लिए अच्छी तरह से पालन नहीं करते के रूप में और आसानी से धोने के दौरान हटाया जा सकता है। वैकल्पिक रूप से, सीधे धोने के बिना कोशिकाओं को ठीक।
  3. पीबीएस निकालें और के लिए पीबीएस में ताज़ा तैयार 3.7% formaldehyde के साथ कोशिकाओं को ठीकआरटी पर 10 मिनट।
  4. समाधान निकालें और 10 मिनट के लिए पीबीएस में 0.2% ट्राइटन X-100 के साथ कोशिकाओं permeabilize।
  5. आरटी पर 2 घंटे के लिए पीबीएस में 5% एफबीएस में समाधान और ब्लॉक निकालें।
  6. 5% एफबीएस में γ-H2AX (Ser139) विरोधी phospho और FITC संयुग्म के साथ 4 डिग्री सेल्सियस पर 37 डिग्री सेल्सियस या हे / एन में 2 घंटे के लिए / सेते पीबीएस। लाइट से बचाएँ।
  7. 60 मिनट - 30 के कुल के लिए 37 डिग्री सेल्सियस पर 6x पीबीएस के साथ - 3 धो लें।
  8. DAPI साथ दाग (पतला 1: पीबीएस में 15,000) आर टी पर 10 मिनट के लिए।
  9. पीबीएस के साथ धो 3x।
  10. जल्दी पानी से धो लवण को हटा दें और 3 का उपयोग एक गिलास स्लाइड पर coverslip माउंट करने के लिए - antifade अभिकर्मक के 5 μL। वैकल्पिक रूप से, एक बढ़ते समाधान DAPI युक्त का उपयोग करें।
  11. चलो यह सूखी हे / एन और एक 63X या उच्चतर उद्देश्य का उपयोग कर एक फ्लोरोसेंट या कोंफोकल माइक्रोस्कोप पर दाग कोशिकाओं कल्पना।
  12. नीचे वर्णित दो किसी भी विधि का उपयोग करके γ-H2AX फोकी यों। आंख से या तो प्रोटोकॉल एक फ्लोरोसेंट माइक्रोस्कोप का उपयोग कर के लिए स्कोर। आदर्श रूप में, हमेंईए कोंफोकल माइक्रोस्कोप। जेड वर्गों ले लो और आदेश सभी पता लगाने योग्य फोकी कल्पना करने के लिए में एक ही विमान में संघनित (proliferating और वृद्ध होनेवाला कोशिकाओं में γ-H2AX धुंधला के लिए प्रतिनिधि छवियों 3 चित्र में दिखाया जाता है)। इमेजिंग सॉफ्टवेयर का उपयोग कर आंख से फोकी गणना; सामान्य रूप में, ~ 100 - 200 नाभिक गिनती के लिए पर्याप्त हैं।
    1. कोशिकाओं है कि γ-H2AX पॉजिटिव फोकी का प्रतिशत मात्रा ठहराना करने के लिए, प्रत्येक कोशिका है कि कम से कम एक फोकस दिखाई और DAPI से सना हुआ नाभिक की कुल संख्या से विभाजित गिनती।
    2. γ-H2AX फोकी की संख्या यों के लिए, सेल प्रति γ-H2AX फोकी गिनती।
      नोट: γ-H2AX की स्तरों विशिष्ट तनाव या नुकसान है कि बुढ़ापा प्रेरित के आधार पर भिन्न हो सकती है।

5. SAHF मार्करों के लिए धुंधला कोशिकाओं

नोट: मानव वृद्ध होनेवाला कोशिकाओं अक्सर गाढ़ा डीएनए / क्रोमेटिन के परमाणु क्षेत्रों होगा। वृद्ध होनेवाला कोशिकाओं, इन heterochromatic क्षेत्रों मेंइस तरह के E2F परिवार के सदस्यों के रूप में प्रसार को बढ़ावा देने जीन, की अभिव्यक्ति को बाधित करने के लिए लगा रहे हैं। SAHF DAPI के पुनर्गठन से देखे जा सकते हैं; Histone H3 (H3K9Me2 और H3K9Me3) पर Lys9 की di- और त्रि मेथिलिकरण सहित हेट्रोक्रोमैटिन जुड़े हिस्टोन के निशान, की उपस्थिति से; और HP1 हेट्रोक्रोमैटिन प्रोटीन 1 (HP1) सहित क्रोमेटिन-का पुनर्गठन प्रोटीन, द्वारा, हीरा (हिस्टोन repressor ए), और ASF1a (विरोधी गुप्तता समारोह -1 a) 30 chromatin करने के लिए। हम एक ओंकोजीन प्रेरित बुढ़ापा मॉडल (OIS) के उपयोग करने के लिए चुना है के रूप में SAHF OIS मॉडल 30 में अधिक महत्वपूर्ण है। IDH4 कोशिकाओं SV40 बड़ी टी प्रतिजन की उपस्थिति के कारण डेक्सामेथासोन की उपस्थिति में पैदा करना, लेकिन मध्यम 31 से डेक्सामेथासोन को हटाने के बाद वृद्ध होनेवाला हो जाते हैं। SAHF DAPI धुंधला द्वारा और ऊपर सूचीबद्ध विशिष्ट मार्कर के खिलाफ एंटीबॉडी के साथ धुंधला द्वारा पता लगाया जा सकता है। यहाँ, हम visualizat के लिए DAPI और H3K9Me2 धुंधला का वर्णनकोशिकाओं 28 में SAHF के आयन।

  1. DMEM में IDH4 कोशिकाओं 10% एफबीएस, 1% पेनिसिलिन / स्ट्रेप्टोमाइसिन, और 1 माइक्रोग्राम / एमएल डेक्सामेथासोन के साथ पूरक के लिए आगे बढ़ें। बुढ़ापा प्रेरित करने के डेक्सामेथासोन हटाने और मध्यम बदलें कि वह लकड़ी का कोयला-छीन एफबीएस होता है; इस नए माध्यम में 10 दिनों ~ के लिए बढ़ती के बाद, IDH4 कोशिकाओं वृद्ध होनेवाला 31 हो गया है।
  2. प्लेट IDH4 कोशिकाओं या धारा 1 या 2 से कोशिकाओं, एक 24 अच्छी तरह से थाली में ऊपर वर्णित है, कांच coverslips पर।
  3. अगले दिन, 1x पीबीएस के साथ कोशिकाओं को धोने। ध्यान से कुल्ला, वृद्ध होनेवाला कोशिकाओं coverslips के लिए अच्छी तरह से पालन नहीं करते के रूप में और आसानी से धोने के दौरान हटाया जा सकता है। वैकल्पिक रूप से, सीधे धोने के बिना कोशिकाओं को ठीक।
  4. पीबीएस निकालें और आरटी पर 10 मिनट के लिए पीबीएस में ताज़ा तैयार 3.7% formaldehyde के साथ कोशिकाओं को ठीक।
  5. कोशिकाओं 1x पीबीएस के साथ 3 बार धोएं।
  6. समाधान निकालें और 5 मिनट के लिए पीबीएस में 0.2% ट्राइटन X-100 के साथ कोशिकाओं permeabilize।
  7. 1x साथ कोशिकाओं को धो लेंपीबीएस। पीबीएस निकालें और अवरुद्ध बफर 3% बीएसए युक्त जोड़कर coverslips ब्लॉक (w / v) आर टी पर 5 मिनट के लिए पीबीएस में। हमेशा बीएसए कण पदार्थ को निकालने के लिए उपयोग करने से पहले युक्त समाधान फ़िल्टर करें।
  8. अवरुद्ध बफर निकालें और इस तरह के विरोधी H3KMe2 एंटीबॉडी के रूप में SAHF मार्कर के खिलाफ प्राथमिक एंटीबॉडी के साथ कोशिकाओं सेते (चित्रा 4; जानकारी के लिए सामग्री तालिका देखें)। अवरुद्ध बफर में एंटीबॉडी पतला और 1 के लिए सेते हैं - आर टी पर 2 घंटे।
  9. प्राथमिक एंटीबॉडी समाधान निकालें और 1% (v / v) ट्राइटन पीबीएस में X-100 के साथ coverslips 3 बार धोएं।
  10. अवरुद्ध बफर (सामग्री तालिका) में माध्यमिक एंटीबॉडी पतला और आरटी पर 1 घंटे के लिए सेते हैं। लाइट से बचाएँ।
  11. कोशिकाओं 1x पीबीएस के साथ दो बार धोएं। आरटी पर 10 मिनट के लिए;: DAPI साथ दाग (पीबीएस में 15,000 देख सामग्री तालिका 1 पतला)।
  12. धो coverslips 1x पीबीएस के साथ 3 गुना।
    1. जल्दी पानी से धो लवण दूर करने के लिए एकantifade अभिकर्मक के 5 μL - nd 3 का उपयोग एक गिलास स्लाइड पर प्रत्येक coverslip माउंट। वैकल्पिक रूप से, एक बढ़ते समाधान DAPI युक्त का उपयोग करें।
    2. चलो सूखी हे / एन और एक 63X या उच्चतर उद्देश्य (चित्र 4 में प्रतिनिधि परिणाम) का उपयोग कर एक फ्लोरोसेंट या कोंफोकल माइक्रोस्कोप पर दाग कोशिकाओं कल्पना। SAHF यों धारा 4 में वर्णित है।
      नोट: निर्धारण नियंत्रण प्राथमिक प्रतिरक्षी या कोई प्राथमिक एंटीबॉडी (यानी अकेले माध्यमिक) immunofluorescence धुंधला के लिए एक नकारात्मक नियंत्रण के रूप में इस्तेमाल किया जाना चाहिए।

6. immunoblotting द्वारा बुढ़ापा जुड़े प्रोटीन का विश्लेषण

ध्यान दें: वृद्ध होनेवाला फेनोटाइप p16 INK4A, p21, और p53 सहित कोशिका चक्र नियामकों, की अपरेगुलेशन की विशेषता है। यह प्रोटोकॉल सेल lysates में इन प्रोटीनों की स्तर की मात्रा का वर्णन करेंगे। इन तकनीकों में से एक किस्म का उपयोग प्रेरित बुढ़ापा आकलन करने के लिए इस्तेमाल किया जा सकतातरीकों 21, 28, 29।

  1. सेलुलर बुढ़ापा प्रेरित धारा 1 और 2 में या किसी अन्य विधि का 21, 28, 29 का उपयोग करके बताया गया है। सेलुलर बुढ़ापा मार्कर का विश्लेषण करने के लिए, 6 सेमी व्यंजन में थाली कोशिकाओं और (आरएनए अलगाव निर्देश के लिए धारा 7 देखें) एक साथ दोनों प्रोटीन और आरएनए का विश्लेषण।
  2. सेल संस्कृति मध्यम निकालें। बर्फ की एक ट्रे पर कोशिकाओं रखो।
    1. कोशिकाओं ठंड 1x पीबीएस के साथ 2 बार धो लें। पकवान झुकाएँ सुनिश्चित करने के लिए कि सभी पीबीएस इतनी के रूप में प्रक्रिया के लिए इस्तेमाल किया मात्रा के मामले में के रूप में सटीक होना करने के लिए aspirated है।
    2. पीबीएस के अंतिम धोने श्वास के बाद, पकवान के लिए (एक 6 सेमी पकवान के लिए) ठंड 1x पीबीएस के 200 μL जोड़ें। एक सेल स्क्रेपर का उपयोग कर कोशिकाओं को स्क्रैप।
    3. आरएनए अलगाव के लिए एक RNase मुक्त ट्यूब में सेल / पीबीएस मिश्रण पिपेट। लो लगभग 150 &# 181; इस मिश्रण है और यह पिपेट एक नया ट्यूब में की एल। यह विभाज्य प्रोटीन विश्लेषण के लिए इस्तेमाल किया जाएगा, इसलिए प्रत्येक ट्यूब से एक ही राशि पिपेट कर लें।
  3. ल्य्से 75 जोड़कर कोशिकाओं - (60 मिमी Tris-एचसीएल पीएच 6.8, 12.5% ​​ग्लिसरॉल, 2% एसडीएस, 5% β-mercaptoethanol (BME), और bromophenol नीले संशोधित 2x Laemmli के नमूने बफर के 100 μL, के रूप में बनाया जा सकता है एक बड़ा बैच, aliquoted, और -20 डिग्री सेल्सियस प्रयोग से पहले तक) अथवा समकक्ष नमूना बफर में संग्रहीत।
    1. lysis बफर और अपकेंद्रित्र के 100 μL 15,000 XG पर 10 मिनट के लिए 4 डिग्री सेल्सियस पर सेल मलबे को हटाने के लिए - वैकल्पिक रूप से, कोशिकाओं 75 में lyse। एक साफ ट्यूब में सतह पर तैरनेवाला और पिपेट निकालें। एक ब्रैडफोर्ड प्रोटीन परख या एक बराबर प्रोटीन परख प्रोटीन के बराबर लोड हो रहा है सुनिश्चित करने के लिए lysates पर इस्तेमाल किया जा सकता है।
      नोट: प्रोटीन assays नमूना बफर में lysed नमूनों पर नहीं किया जा सकता।
    2. lysate के 25 से μL बाहर ले लो और 2x नमूना बफर के 15 μL जोड़ें। विंदुक और करनमूना बफर में wn कोशिकाओं lyse।
      नोट: lysis बफर या नमूना बफर के वॉल्यूम सेल संगम के आधार पर समायोजित किया जा सकता है। नमूना परमाणु lysing की वजह से "भावुक" है, तो अधिक नमूना बफर या पीबीएस को कमजोर करने में जोड़ें। नमूने -20 डिग्री सेल्सियस प्रयोग से पहले तक पर संग्रहित किया जा सकता है।
  4. एक 18% Tris-ग्लाइसिन जेल पर एक गर्मी ब्लॉक पर 95 डिग्री सेल्सियस पर 5 मिनट (या समतुल्य उपकरण) और लोड नमूना बफर में lysed नमूने की ~ 40 μL के लिए नमूने उबालें।
    नोट: एक ढाल जेल (4-15%) या एक 14% Tris-ग्लाइसिन जेल भी कम आणविक भार प्रोटीन का पता लगाने के लिए पर्याप्त हैं। एक्रिलामाइड जैल के विभिन्न प्रकार भी इस्तेमाल किया जा सकता है, लेकिन यह सुनिश्चित करें कि जैल और सिस्टम निम्न आणविक भार प्रोटीन का पता लगाने के लिए पर्याप्त हैं।
    1. 20 मिनट के लिए एक निरंतर 100 वी पर 1x चल बफर का उपयोग कर (स्टैकिंग जेल के माध्यम से) चलाने के लिए और ~ 180 वी पर 60 मिनट जेल की निगरानी करें तो डाई सामने बस चलाता है या जेल के नीचे स्थित है, ताकि कम आणविक वजन प्रोटीन आर नहीं हैजेल के बंद संयुक्त राष्ट्र।
  5. (100% मेथनॉल के साथ पहले से लथपथ सक्रिय करने के लिए) एक PVDF झिल्ली को एक्रिलामाइड जेल में स्थानांतरित करें। तो एक गीला हस्तांतरण कर रही है, केवल 1 घंटे (बनाम सामान्य ~ 1.75 ज) हस्तांतरण के लिए आवश्यक है। उचित हस्तांतरण प्रणाली के लिए तदनुसार समायोजित करें; पूर्व दाग आणविक भार मार्कर का उपयोग हस्तांतरण दक्षता का आकलन करने में सहायता कर सकते हैं।
  6. पानी में झिल्ली धो लें। नमूनों की बराबर लोड करने के लिए निगरानी के लिए एक रक्तवर्ण रंग दाग का प्रयोग करें। रक्तवर्ण रंग पानी से धो लें।
    1. आंदोलन के साथ 4 डिग्री सेल्सियस पर आर टी या हे / एन पर 1 घंटे के लिए TBST में 5% गैर वसा शुष्क दूध में झिल्ली (50 मिमी Tris-एचसीएल पीएच 7.5, 150 मिमी NaCl, और 0.1% बीच 20) को ब्लॉक करें।
  7. धो TBST के साथ एक बार दाग और आरटी पर 1 घंटे के लिए 5% दूध TBST (dilutions और एंटीबॉडी सिफारिशों के लिए सामग्री तालिका देखें) में पतला प्राथमिक एंटीबॉडी के साथ सेते हैं।
  8. TBST के साथ दो त्वरित धोने प्रदर्शन और उसके बाद की कुल ~ 30 मिनट (के लिए ~ 15 मिनट के प्रत्येक था एक शेकर पर दो बार धोनेज)।
  9. आरटी पर 40 मिनट के लिए एक उच्च माध्यमिक एंटीबॉडी के साथ सेते हैं। दोहराएँ कदम 6.10।
  10. हाल में किए गए पश्चिमी धब्बा सब्सट्रेट के साथ सेते हैं और फिल्म को विकसित करने या एक chemiluminescence पाठक पर इसे पढ़ा।
  11. P16 INK4A एंटीबॉडी पहले से जांच immunoblot (चित्रा 5)। पानी के साथ 15 मिनट, 0.2 एन NaOH के साथ 15 मिनट, और पानी के साथ 15 मिनट के लिए विकासशील द्वारा झिल्ली पट्टी। चरण 6.9 विरोधी p21 एंटीबॉडी का उपयोग कर के साथ आगे बढ़ें।
  12. प्रति समाधान अलग करना के 50 एमएल ताजा जोड़ा BME के ​​300 μL के साथ झिल्ली 62.5 मिमी Tris-एचसीएल पीएच 6.8 और 2% एसडीएस का उपयोग कर निकाल देते हैं।
  13. 30 मिनट के लिए 50 डिग्री सेल्सियस पर सेते हैं और टीबीएस और फिर TBST के साथ बड़े पैमाने पर धो। प्रोटीन लोडिंग नियंत्रण के लिए विरोधी actin या विरोधी GAPDH एंटीबॉडी के साथ जांच (चित्रा 5 प्रतिनिधि परिणाम दिखाता है)।
    नोट: p53 का स्तर भी एक ही झिल्ली पर मूल्यांकन किया जा सकता। हालांकि, बाद से p53 एक उच्च आणविक भार है, यह बेहतर एक कम प्रतिशत जेल पर हल हो गई है (जैसे,

7. बुढ़ापा मार्करों के mRNA स्तर का विश्लेषण

नोट: शाही सेना को अलग करते हैं, तो यह सुनिश्चित करें कि काम सतहों RNase हटाने समाधान या एक बराबर के साथ साफ किया जाता है और उस सामग्री सभी RNase मुक्त हैं।

  1. चरण 4.2 से सेल / पीबीएस मिश्रण का उपयोग करना, शाही सेना निष्कर्षण समाधान 30 s के लिए भंवर के 1 एमएल जोड़ने (वहाँ कोई दिखाई गुच्छों या सेलुलर मलबे होना चाहिए)।
  2. क्लोरोफॉर्म के 200 μL जोड़ें और 15 रों के लिए सख्ती से हिला।
  3. 4 डिग्री सेल्सियस पर 15 मिनट के लिए अधिकतम गति (> 15,000 XG) पर अपकेंद्रित्र।
  4. निकालें शीर्ष शाही सेना जलीय परत की ~ 400 μL और एक नया microfuge ट्यूब में पिपेट।
  5. और जनसंपर्क के 4 μL: (1 पिछले चरण में pipetted कुल जलीय परत की मात्रा के साथ 1) isopropanol के 400 μL जोड़ेंशाही सेना परत को ecipitant।
  6. शाही सेना गोली अधिकतम गति (> 15,000 XG) पर 15-30 मिनट और 4 डिग्री सेल्सियस के लिए अपकेंद्रित्र।
  7. सतह पर तैरनेवाला निकालें और 75% ठंडा इथेनॉल के 1 एमएल जोड़ें।
  8. अधिकतम गति (> 15,000 XG) और 4 डिग्री सेल्सियस पर 1 मिनट के लिए अपकेंद्रित्र।
  9. अधिकतम गति (> 15,000 XG) और 4 डिग्री सेल्सियस पर 1 मिनट के लिए सतह पर तैरनेवाला और अपकेंद्रित्र निकालें।
  10. 2 मिनट के लिए संभव और हवा शुष्क जितना तरल बाहर पिपेट।
  11. 10x DNase बफर के 10 μL, एच 2 ओ के 85 μL में फिर से स्थगित करता है, और DNase 1 के 5 μL।
  12. 30 मिनट के लिए 37 डिग्री सेल्सियस पर सेते हैं।
  13. 200 μL NT2 बफर (50 मिमी Tris-एचसीएल पीएच 7.4, 150 मिमी NaCl, 1 मिमी 2 MgCl, और 0.05% Nonidet पी -40) जोड़ें और एसिड फिनोल-CHCl 2 की निचली परत के 300 μL जोड़ें।
  14. 1 अधिकतम गति से 5 मिनट के लिए न्यूनतम और कमरे के तापमान पर अपकेंद्रित्र के लिए भंवर (> 15,000 XG)।
  15. ऊपरी आरएनए परत (2 x 125 μL) के 250 μL एकत्र, 25 को जोड़ने3 एम सोडियम एसीटेट पीएच 5.2, 100% ठंडा इथेनॉल के 625 μL, और तेज़ की 5 μL की μL। अच्छी तरह से मिलाएं और -20 डिग्री सेल्सियस पर तलछट हे / एन।
  16. अगले दिन, मिश्रण और अधिकतम गति (> 15,000 XG) और 30 मिनट के लिए 4 डिग्री सेल्सियस पर स्पिन और सतह पर तैरनेवाला त्यागने।
  17. दोहराएँ 6.8-6.11 कदम दूर है।
  18. -80 डिग्री सेल्सियस प्रयोग से पहले तक पर nuclease मुक्त पानी और दुकान के 12 μL में गोली फिर से रोक देते हैं।
    नोट: अन्य शाही सेना अलगाव प्रक्रियाओं और किट के रूप में अच्छी तरह से इस्तेमाल किया जा सकता।
  19. यादृच्छिक hexamers साथ रिवर्स प्रतिलेखन प्रदर्शन करना और SSII निर्माता के प्रोटोकॉल के अनुसार रिवर्स ट्रांसक्रिपटेस।
    नोट: वृद्ध होनेवाला कोशिकाओं से अलग शाही सेना की कम मात्रा को देखते हुए यह रिवर्स प्रतिलेखन संश्लेषण के लिए आरएनए (12 μL) के सभी उपयोग करने के लिए सबसे अच्छा है। वैकल्पिक रूप से, शाही सेना एक स्पेक्ट्रोफोटोमीटर का उपयोग कर मात्रा निर्धारित किया जा सकता है, और शाही सेना के बराबर मात्रा रिवर्स प्रतिलेखन के लिए इस्तेमाल किया जा सकता है।
  20. वास्तविक समय का उपयोग कर मात्रात्मक qPCR (RT-qPCR) amplific mRNA के स्तर का विश्लेषण करेंव्यावहारिक और जीन विशिष्ट प्राइमरों के साथ SYBR हरे रंग पीसीआर मास्टर मिश्रण।
    1. एक ठेठ RT-qPCR प्रतिक्रिया के रूप में, सीडीएनए 01:30 (RNase / DNase मुक्त पानी में) पतला और बेहतर pipetting सटीकता के लिए वास्तविक समय 96-अच्छी तरह थाली करने के लिए 3 μL जोड़ें। जीन-विशिष्ट आगे की प्रतिक्रिया मास्टर मिश्रण (2.5 माइक्रोन एकाग्रता 5 μL / प्रतिक्रिया जोड़ने) SYBR हरे रंग पीसीआर मिश्रण तैयार करें और रिवर्स प्राइमरों, (6.25 μL / प्रतिक्रिया; निर्माता की सिफारिश की तुलना में कम उपयोग करें), और RNase के 5.75 μL / 20 μL (प्राइमरों / SYBR-हरा / पानी के 17 μL और सीडीएनए के 3 μL) की एक अंतिम प्रतिक्रिया मात्रा के लिए DNase मुक्त पानी।
    2. एक वास्तविक समय पीसीआर मशीन का उपयोग कर RT-qPCR प्रवर्धन प्रदर्शन करना; निर्माता के प्रोटोकॉल का पालन करें।
      नोट: आगे मान्य मानव की एक सूची और वास्तविक समय प्राइमरों रिवर्स तालिका 1 में पाया जा सकता। ये जीन SASP प्रोटीन और अन्य बुढ़ापा जुड़े मार्करों और / या जीन शामिल हैं। आईआर प्रेरित बुढ़ापा से प्रतिनिधि परिणामों में दिखाया जाता है

8. बढ़ाता SASP प्रोटीन के स्तर

  1. धारा 1 या 2 या किसी अन्य विधि का उपयोग कर का उपयोग कर बुढ़ापा प्रेरित। या तो 6 या 10 सेमी प्लेटों पर कोशिकाओं प्लेट, के रूप में (~ 250,000 कोशिकाओं / 6 सेमी थाली या ~ 650,000 / 10 सेमी प्लेट) ऊपर वर्णित है।
  2. या तो या replicative वृद्ध होनेवाला कोशिकाओं (और उचित नियंत्रण सेल) के साथ कोशिकाओं 10 घ के बाद आईआर उपचार के साथ, कोशिकाओं तीन बार 1x पीबीएस के साथ (2.5 एमएल 6 सेमी या 5 एमएल के लिए धोने और एक छोटी मात्रा में एंटीबायोटिक दवाओं के साथ सीरम मुक्त मध्यम जोड़ने 10 सेमी के लिए)।
  3. एक टिशू कल्चर इनक्यूबेटर में 37 डिग्री सेल्सियस पर रातोंरात सेते हैं और 5% सीओ 2। अगले दिन, मध्यम इकट्ठा करने और एक शंक्वाकार ट्यूब में बर्फ पर डाल दिया।
  4. कोशिकाओं पीबीएस के साथ 2 बार धो लें और फिर (एक 6 सेमी पकवान के लिए) ट्रिप्सिन के 1 एमएल जोड़ें। एक hemocytometer का उपयोग बाद में सेल नंबर के अनुसार सांद्रता समायोजित करने के लिए कोशिकाओं की गणना करें।
  5. अपकेंद्रित्र पर 300 x छ 5 मिनट के लिए मध्यम।
  6. Filtएर मध्यम एक 0.45-सुक्ष्ममापी सिरिंज फिल्टर का उपयोग कर।
  7. उपयोग या परख सीधे एलिसा या समकक्ष assays का उपयोग कर जब तक -80 डिग्री सेल्सियस पर मध्यम और फ्रीज विभाज्य।
  8. कुल सेल नंबर / माध्यम के एकत्र मात्रा लेने से कोशिकाओं / एमएल एकाग्रता की संख्या की गणना।
  9. एक उचित एंजाइम से जुड़ी immunosorbent परख (एलिसा) निर्माता के निर्देशों के अनुसार निष्पादित करें। आईएल -6, आईएल -8, GROα, और अन्य साइटोकिन्स / chemokines (चित्रा 6B) के लिए क्रिया के लिए सिफारिश की एलिसा किट सामग्री तालिका देखें।
  10. यह सुनिश्चित करने के कारक है कि मापी जाती हैं एलिसा किट के रैखिक सीमा के भीतर हैं, proliferating सेल मध्यम की तुलना में वृद्ध होनेवाला सेल माध्यम की dilutions बनाते हैं। इन dilutions और मात्रा जब आईएल -6 की राशि की गणना के लिए खाते। प्रतिदिन सेल प्रति स्रावित आईएल -6 की राशि प्राप्त करने के लिए, प्रति मिली पतला सेल एकाग्रता प्रति किट (पृ) से प्राप्त आईएल -6 मूल्य की गणना (frओम कदम 7.8)।
    नोट: इस तरह के साइटोकाइन सरणियों के रूप में अन्य विधियों,, SASP प्रोटीन के स्तर का पता लगाने के लिए इस्तेमाल किया जा सकता है और SASP कारकों में से एक बड़ी संख्या में स्क्रीनिंग के लिए उपयुक्त हो सकता है। SASP कारकों में से प्रोटीन के स्तर बुढ़ापा प्रेरण, सेल प्रकार, या बुढ़ापा के प्रकार के प्रेरित होने के बाद समय के आधार पर भिन्न हो सकती है।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

आंकड़े 2 - 6 SA-β-गल धुंधला से प्रतिनिधि परिणाम बताते हैं; γ-H2AX और SAHF के लिए धुंधला हो जाना; p16 INK4A, p21, और p53 के प्रोटीन के स्तर का आकलन; और mRNA और वृद्ध होनेवाला जुड़े अणुओं के प्रोटीन के स्तर। बढ़ी हुई SA-β-गल धुंधला replicative और डीएनए की क्षति प्रेरित बुढ़ापा साथ होता है। इसके अलावा, रूपात्मक परिवर्तन है कि बुढ़ापा के साथ हो निरीक्षण। कोशिकाओं proliferating fibroblasts की धुरी उपस्थिति की तुलना में बढ़े और फ्लैट हो जाते हैं। इस प्रयोगात्मक प्रतिमान के लिए, कोशिकाओं दाग रहे थे और आरएनए / प्रोटीन आईआर जोखिम के बाद 7 घ पृथक किया गया। और अधिक मजबूत परिणाम आईआर जोखिम (यानी 10 घ) के बाद लंबे समय तक इंतजार कर से हो सकती है। स्थितियां प्रत्येक शर्त और प्रयोगात्मक सेटअप के लिए निर्धारित किया जा करने की जरूरत है। इन परिणामों प्रतिनिधि हैं और जब बुढ़ापा अन्य विधियों का उपयोग प्रेरित है इन मार्कर भी पता लगाया जा सकता।

चित्रा 6 के लिए, जीन नाम सूचीबद्ध और CXCL1 (GROα), CXCL2 (GROβ), और CSF2 (जीएम-सीएसएफ) के अनुरूप कर रहे हैं। कुछ के mRNA स्तर के अपरेगुलेशन, लेकिन सभी नहीं, SASP कारकों में से WI-38 कोशिकाओं में आईआर प्रेरित बुढ़ापा के बाद देखा गया। अन्य बुढ़ापा जुड़े CDKN1A (p21 encodes) और CDKN2A (p16 INK4A encodes) सहित mRNAs,, upregulated रहे थे। अन्य mRNAs (EDN1 और ANKRD1) भी शामिल किया गया है और पहले से वृद्ध होनेवाला कोशिकाओं 15 में उच्च के रूप में दिखाया गया है। प्राइमर तालिका 1 में सूचीबद्ध हैं।

आकृति 1
चित्र 1: proliferating और वृद्ध होनेवाला तंतुकोशिकाएं। proliferating (बाएं) और वृद्ध होनेवाला (दाएं) fibroblasts की एक योजनाबद्ध प्रतिनिधित्व। बुढ़ापा inducers के उदाहरण तु में दिखाया जाता हैllow बॉक्स। बुढ़ापा संकेत दिया मार्करों के उच्च स्तर के साथ जुड़ा हुआ है। SA-β-गल, बुढ़ापा जुड़े β-galactosidase गतिविधि; SASP, बुढ़ापा जुड़े स्रावी फेनोटाइप; SAHF, बुढ़ापा जुड़े हेट्रोक्रोमैटिन फोकी; डीडीआर, डीएनए क्षति प्रतिक्रिया। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें

चित्र 2
चित्रा 2. morphological विशेषताओं और वृद्ध होनेवाला कोशिकाओं की वृद्धि SA-β-गल गतिविधि। WI-38 कोशिकाओं, proliferating "युवा" (पीडीएल 27), replicative वृद्ध होनेवाला (पीडीएल 40), या आयनीकरण करने वाले विकिरण (आईआर) के संपर्क में उन, SA-β-गल गतिविधि के लिए दाग रहे थे या तो। शिशु मृत्यु दर-90 कोशिकाओं, या तो proliferating "युवा" (पीडीएल 30), replicative वृद्ध होनेवाला (पीडीएल 52), या विकिरण (आईआर) आयनीकरण के संपर्क में उन, स्टेशन थेSA-β-गल गतिविधि के लिए ined। धारा 1 - 2 replicative और डीएनए की क्षति प्रेरित बुढ़ापा उत्प्रेरण का वर्णन है, और धारा 3 SA-β-गल के लिए धुंधला बताते हैं। प्रकोष्ठों आईआर के बाद 7 घ दाग रहे थे। कोन, नियंत्रण। स्केल बार 50 सुक्ष्ममापी =। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्र तीन
चित्रा 3. वृद्ध होनेवाला कोशिकाओं में वृद्धि γ-H2AX Foci। WI-38 कोशिकाओं, या तो proliferating "युवा" (पीडीएल 30) या replicative वृद्ध होनेवाला (पीडीएल 53), फिक्स्ड और विरोधी γ-H2AX एंटीबॉडी और DAPI साथ दाग रहे थे। वृद्ध होनेवाला कोशिकाओं में γ-H2AX फोकी की संख्या में वृद्धि पर ध्यान दें। छवियाँ एक confocal खुर्दबीन पर प्राप्त किया गया। जेड वर्गों ले जाया गया है, और अधिकतम तीव्रता प्रक्षेपण एक भी विमान छवि प्राप्त करने के सभी detec कल्पना करने के लिए इस्तेमाल किया गया थातालिका फोकी। स्केल बार = 20 सुक्ष्ममापी। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्रा 4
चित्रा वृद्ध होनेवाला कोशिकाओं में SAHF की 4. फ्लोरोसेंट धुंधला। (ए) proliferating WI-38 कोशिकाओं (पीडीएल 27) अनुपचारित या आयनीकरण करने वाले विकिरण (आईआर) के संपर्क में थे। 10 दिनों के बाद, कोशिकाओं SAHF (ध्यान दें आईआर इलाज कोशिकाओं में घने / कबरा DAPI धुंधला) (बी) IDH4 डेक्सामेथासोन की उपस्थिति में विकसित किया गया (proliferating) या लकड़ी का कोयला-छीन एफबीएस में बुढ़ापा प्रेरित करने के लिए (कल्पना करने के लिए DAPI साथ दाग रहे थे वृद्ध होनेवाला)। बाद 10 घ, कोशिकाओं H3K9Me2 और DAPI के खिलाफ एंटीबॉडी के साथ दाग रहे थे। छवियाँ एक confocal खुर्दबीन पर प्राप्त किया गया। जेड वर्गों ले जाया गया है, और अधिकतम तीव्रता प्रक्षेपण एक एकल विमान प्राप्त करने के लिए इस्तेमाल किया गया थाछवि। (ए) और (बी) में proliferating कोशिकाओं, विसरित DAPI धुंधला है, जबकि वृद्ध होनेवाला कोशिकाओं कबरा DAPI धुंधला है। (बी) में, नियंत्रण कोशिकाओं जबकि H3K9Me2 धुंधला और अधिक मजबूत है और वृद्ध होनेवाला कोशिकाओं में DAPI से सना हुआ फोकी साथ colocalizes, फैलाना, H3K9Me2 के लिए बहुत हल्का धुंधला है। स्केल बार = 20 सुक्ष्ममापी। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्रा 5
चित्रा 5. बुढ़ापा जुड़े प्रोटीन की मात्रा। (-) या शिशु मृत्यु दर-90 कोशिकाओं है कि विकिरण के 10 Gy (आईआर) के संपर्क में आए प्रोटीन या तो proliferating "युवा" (पीडीएल 30) शिशु मृत्यु दर-90 कोशिकाओं से अलग किया गया था। मध्यम हर 48 घंटे में बदल गया था और कोशिकाओं आईआर के बाद 7 घ lysed थे। नमूने एसडीएस पृष्ठ से विश्लेषण किया गया, विरोधी p16 INK4A antibo साथ immunoblottedमर जाता है, और विरोधी p21 और फिर विरोधी p53 एंटीबॉडी के साथ फिर से जांच की। GAPDH एक प्रोटीन लोड हो रहा है नियंत्रण के रूप में इस्तेमाल किया गया था। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्रा 6
चित्रा 6. बुढ़ापा जुड़े mRNAs और SASP प्रोटीन की मात्रा। (-) कि आयनीकरण करने वाले विकिरण (आईआर) के 10 Gy के संपर्क में आए या वाई-38 कोशिकाओं (ए) आरएनए या तो proliferating "युवा" (पीडीएल 27 या 34) WI-38 कोशिकाओं से अलग किया गया था। मध्यम हर 48 घंटे में बदल गया था और आरएनए अलगाव आईआर के बाद 7 घ प्रदर्शन किया था। RT-qPCR संकेत दिया बुढ़ापा जुड़े तालिका 1 में सूचीबद्ध जीन विशिष्ट प्राइमरों का उपयोग कर mRNAs का स्तर यों के लिए इस्तेमाल किया गया था। 18S स्तरों सामान्य के लिए इस्तेमाल किया गया। हिस्टोग्राम मतलब सामान्यीकृत टी का प्रतिनिधित्वओ अनुपचारित ± SEM 5 स्वतंत्र प्रयोगों से। (बी) WI-38 कोशिकाओं (पीडीएल 26) आईआर के 10 Gy के संपर्क में आए; 10 घ बाद में, मध्यम सीरम मुक्त मध्यम में बदल गया था (धारा 7 देखें)। 24 घंटे के बाद, वातानुकूलित मध्यम एकत्र किया गया था और आईएल -6, आईएल -8, और GROα स्तरों एलिसा assays का उपयोग कर मात्रा निर्धारित किया गया था। हिस्टोग्राम 3 प्रयोगों से SEM ± मतलब प्रतिनिधित्व करता है। * पी <0.05 और *** पी <0.001 विद्यार्थी t- परीक्षण के द्वारा। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

मानव प्राइमर आगे रिवर्स
18S CCCTATCAACTTTCGATGGTAGTCG CCAATGGATCCTCGTTAAAGGATTT
ANKRडी 1 AGT केशाभाव GGA अधिनियम GGT CACTGG TGG GCT केशाभाव AGT GTCTTC केशाभाव टी
CDKN1A (P21) GAC ACCACT GGA GGG TGA सीटी CAGGTC सीएसी ATG जीटीसी टीटीसी सीटी
CDKN2A (p16) CCAACGCACCGAATAGTTACG GCGCTGCCCATCATCATG
CSF2 (जीएम-सीएसएफ) GGCCCCTTGACCATGATG TCTGGGTTGCACAGGAAGTTT
CXCL1 GAAAGCTTGCCTCAATCCTG CACCAGTGAGCTTCCTCCTC
CXCL2 AACTGCGCTGCCAGTGCT CCCATTCTTGAGTGTGGCTA
EDN1 सीएजी CAGTCT टैग GCG CTG एजी ACTCTT TAT सीसीए टीसीए GGG ACG एजी
IL6 CCGGGAACGAAAGAGAAGCT GCGCTTGTGGAGAAGGAGTT
IL7 CTCCAGTTGCGGTCATCATG GAGGAAGTCCAAAGATATACCTAAAAGAA
IL8 CTTTCCACCCCAAATTTATCAAAG CAGACAGAGCTCTCTTCCATCAGA

तालिका 1: बुढ़ापा जुड़े mRNAs के लिए RT-qPCR प्राइमर। RT-qPCR SYBR हरे रंग प्रौद्योगिकी का उपयोग कर के लिए आगे और रिवर्स प्राइमरों दर्शाया गया है।

Subscription Required. Please recommend JoVE to your librarian.

Discussion

यहाँ, हम मानव द्विगुणित fibroblasts का उपयोग कर replicative और डीएनए क्षति प्रेरित बुढ़ापा के लिए तरीके का वर्णन किया है। इसके अलावा, प्रोटीन और विभिन्न बुढ़ापा जुड़े प्रोटीन की mRNA का स्तर मात्र निर्धारण के लिए तकनीक शामिल किए गए हैं, साथ ही साथ SA-β-गल के लिए और डीएनए क्षति मार्कर γ-H2AX के लिए धुंधला। इन प्रोटोकॉल व्यापक रूप से हालांकि कई चेतावनियां विवो 20 में बुढ़ापा विशेषता बताने के लिए मौजूद हैं, दोनों इन विट्रो में और vivo में वृद्ध होनेवाला समलक्षणियों का आकलन किया जा सकता है। अन्य कोशिकाओं वृद्ध होनेवाला मार्करों व्यक्त कर सकते हैं, भले ही वे वृद्ध होनेवाला कोशिकाओं नहीं हैं। उदाहरण के लिए, इस तरह के अस्थिशोषकों और मैक्रोफेज के रूप में कोशिकाओं β-गल गतिविधि 32, 33 का उच्च स्तर है। इसके अलावा, कई कैंसर की कोशिकाओं को p16 INK4A 34 upregulated है। प्रकोष्ठों भी डीएनए की क्षति (जैसे, γ-H2AX फोकी) और वृद्ध होनेवाला नहीं हो जमा कर सकते हैं। SASP कारकों को भी द्वारा upregulated किया जा सकता हैविभिन्न सामान्य शारीरिक या रोग की स्थिति है कि हो सकता है या वृद्ध होनेवाला कोशिकाओं को शामिल नहीं कर सकते हैं। इसलिए, कई बुढ़ापा मार्करों, का उपयोग किया जाना चाहिए, खासकर जब विवो में बुढ़ापा का आकलन।

हालांकि वृद्ध होनेवाला कोशिकाओं 20 से अधिक साल पहले 4 सामान्य उम्र बढ़ने के ऊतकों में वृद्धि की जानी पाए गए, तो वह केवल अब है कि हम पूरी तरह से भूमिकाओं की अधिकता है कि वृद्ध होनेवाला कोशिकाओं दोनों सामान्य ऊतकों homeostasis में और रोग की स्थिति में खेलने की प्रशंसा कर रहे हैं। माउस मॉडल की हाल ही में रोजगार p16 INK4A पॉजिटिव वृद्ध होनेवाला कोशिकाओं को खत्म करने के शोधकर्ताओं ने अधिक स्पष्ट रूप से करने के लिए अनुमति दी गई है और ठीक ऊतकों और अंगों 35, 36, 37 में वृद्ध होनेवाला कोशिकाओं की भूमिका की सराहना करते हैं। इन मॉडलों को खुलासा किया है कि वृद्ध होनेवाला कोशिकाओं उम्र से संबंधित विकृतियों, tumorigenesis की एक भीड़ के लिए योगदान, और माउस उम्र 35 </ sup>, 36, 37। इन हाल की खोजों और शरीर विज्ञान में वृद्ध होनेवाला कोशिकाओं के महत्व के सत्यापन को देखते हुए समय इन विशिष्ट कोशिकाओं पर और अधिक शोध के लिए परिपक्व है। उदाहरण के लिए, पढ़ाई रणनीतियों को रोजगार चिकित्सा वृद्ध होनेवाला कोशिकाओं को दूर करने या देरी करने के लिए बुढ़ापा दोनों healthspan और उम्र के अध्ययन के लिए फायदेमंद हो सकता है।

हाल ही में, हमारे प्रयोगशाला कि मेटफार्मिन, आमतौर पर टाइप 2 मधुमेह का इलाज किया जाता एक दवा, सेलुलर बुढ़ापा 38 कम हो जाती है पाया। के रूप में मेटफार्मिन वर्तमान में एक एंटी-एजिंग चिकित्सा के रूप में प्रस्तावित किया जा रहा है और विरोधी कैंसर गुण 39, 40 है, यह इस दवा या अन्य उम्र बढ़ने हस्तक्षेप, सेलुलर बुढ़ापा modulating द्वारा स्वास्थ्य परिणामों को प्रभावित है कि क्या पता लगाने के लिए भविष्य में दिलचस्प होगा।

प्रोटोकॉल हम यहाँ पर चर्चा आम है और व्यापक रूप से एक हैंccepted तकनीक वृद्ध होनेवाला फेनोटाइप आकलन करने के लिए। इन विट्रो में उगाई जाने वाली कोशिकाओं के लिए, यह क्रम में एक चपटी आकृति विज्ञान के लिए एक धुरी की तरह से सेल परिवर्तन पर नजर रखने के लिए सुनिश्चित करें कि कोशिकाओं वृद्ध होनेवाला हैं (आंकड़े 1 और 2 देखें) महत्वपूर्ण है। कोशिकाओं SA-β-गल या यहाँ वर्णित अन्य मार्करों के लिए सकारात्मक नहीं हैं, तो उच्च सेल PDLS (replicative बुढ़ापा के लिए) या डीएनए की क्षति प्रेरित बुढ़ापा के बाद एक वृद्धि की समय पर बुढ़ापा का आकलन। इसके अलावा, इन प्रोटोकॉल विभिन्न प्रकार की कोशिकाओं के लिए अनुकूलित किया जाना पड़ सकता है। SASP प्रोटीन के स्तर का आकलन करने के लिए, यह सेल मध्यम से सीरम दूर करने के लिए महत्वपूर्ण है, के रूप में इस एलिसा या प्रोटीन सरणियों में उच्च पृष्ठभूमि के स्तर का कारण होगा। इसलिए, जब प्रयोगों को डिजाइन इसे ध्यान में रखें, क्योंकि इसमें एक साथ कई मार्कर का आकलन करने के लिए आदर्श नहीं हो सकता है।

SA-β-गल के लिए धुंधला को यहां बताए गए, तथ्य यह है कि यह कोशिकाओं के निर्धारण की आवश्यकता है द्वारा सीमित है।इसके अलावा, सेल संगम SA-β-गल गतिविधि को प्रभावित करने के दिखाया गया है। प्रोटोकॉल β-गल गतिविधि के लिए एक fluorogenic सब्सट्रेट, जो cytometry 41, 42, 43 प्रवाह का उपयोग जीवित कोशिकाओं में इस मार्कर की मात्रा के लिए अनुमति देता है का उपयोग करते हुए SA-β-Gal गतिविधि का आकलन करने के लिए विकसित किया गया है। SA-β-गल गतिविधि भी एक chemiluminescent विधि 44 का उपयोग करते हुए सेल lysates में मापा जा सकता है। इसके अलावा, γ-H2AX भी फ्लो या सेल lysates 45 की immunoblotting सहित विभिन्न अन्य तरीकों, मापा जा सकता है।

यह ध्यान देने योग्य है कि SAHF गठन सेल लाइन निर्भर है और ज्यादातर साथ जुड़ा हुआ है ओंकोजीन प्रेरित बुढ़ापा 20, 30, 46। इसलिए, SAHF सभी बुढ़ापा मॉडल में मौजूद नहीं हो सकता है। की उपयोगितामाउस मॉडल में एक वृद्ध होनेवाला मार्कर के रूप में SAHF भी सच है कि आम तौर पर SAHF माउस वृद्ध होनेवाला कोशिकाओं 30, 46, 47 में नहीं मनाया जाता है द्वारा सीमित किया जा सकता है। इधर, H3K9Me2 के विरुद्ध रोग में इस्तेमाल किया गया, लेकिन SAHF के अन्य आणविक मार्कर macroH2A, उच्च गतिशीलता समूह ए (HMGA) प्रोटीन, और त्रि methylated लाइसिन 9 हिस्टोन एच 3 (H3K9Me3) और बाध्य HP1 प्रोटीन सहित, इस्तेमाल किया जा सकता। इसके अलावा, क्रोमेटिन प्रतिरक्षक अवक्षेपण assays हिस्टोन अंक या E2F लक्ष्य जीन के लिए प्रोटीन बाध्यकारी क्रोमेटिन के सहयोग का आकलन किया जा सकता है।

एक जागरूक बुढ़ापा की विशेषताओं, मार्करों के लिए विविधता और तथ्य यह है कि इन मार्कर वृद्ध होनेवाला कोशिकाओं में विशेष रूप से व्यक्त नहीं कर रहे हैं करने के लिए विभिन्न सीमाओं देखते हैं कि होना चाहिए। एकाधिक (सामान्य रूप में, 2 - 3) मार्करों बुढ़ापा आकलन करने के लिए, यहाँ वर्णित नहीं मार्करों सहित नियोजित किया जाना चाहिए। उदाहरण के लिए, डीएनए निशान, टेलोमेरक्षति, और / या डीएनए की क्षति संकेत भी मात्रा निर्धारित किया जा सकता है। इसके अलावा, बुढ़ापा और विशेष रूप से, SASP phenotype के रूप में, हाल ही में विशिष्ट तनाव या नुकसान है कि बुढ़ापा 11, 12, 13 को प्रेरित करता है से प्रभावित हो दिखाया गया है, यह प्रत्येक प्रयोगात्मक प्रतिमान में कई मार्कर का आकलन करने के लिए महत्वपूर्ण है।

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखकों के पास खुलासे के लिए कुछ भी नहीं है।

Acknowledgments

इस अध्ययन राष्ट्रीय स्वास्थ्य संस्थान के अंदर का रिसर्च प्रोग्राम, उम्र बढ़ने पर राष्ट्रीय संस्थान द्वारा समर्थित किया गया। लेखकों बुढ़ापा और भी गंभीर रूप से पांडुलिपि पढ़ने के लिए Kotb Abdelmohsen के बारे में कई उपयोगी विचार विमर्श के लिए मिरियम गोरोस्प और Kotb Abdelmohsen का शुक्रिया अदा करना चाहते हैं। हम यह भी गंभीर रूप से पांडुलिपि पढ़ने के लिए विशेष रूप से डगलस डलूज़ेन, हमारे प्रयोगशाला के सदस्यों को धन्यवाद।

Materials

Name Company Catalog Number Comments
16% Tris-glycine gels Invitrogen XP00160BOX
Acid-Phenol ChCl3 Ambion AM9720
Alexa-Fluor 568 goat anti-mouse antibody Invitrogen A11031 1:300 dilution
Cell lifters Corning Inc. 3008 Cell scraper
ECL anti-mouse HRP linked antibody Amersham NA931V
ECL Plus Western Blotting Substrate Pierce 32132 ECL
DAPI Molecular Probes MP01306 stock 5 mg/mL in dH2O
GAPDH antibody Santa Cruz sc-32233 1:1,000 - 5,000 dilution
GlycoBlue Ambion AM9515
Histone H3 dimethyl K9 monoclonal antibody Abcam 1220 1:500 dilution
Human IL-6 Quantikine ELISA assay R&D systems D6050
Human IL-8 Quantikine ELISA assay R&D systems D8000C
Human GROa Quantikine ELISA assay R&D systems DRG00
N-N-dimethylformamide  Sigma D4551 DMF
p16 monoclonal antibody BD Biosciences 51-1325gr 1:500 dilution
p21 monoclonal antibody Millipore 05-345 1:750 dilution
p53 monoclonal antibody Santa Cruz sc-126 1:500 dilution clone DO-1
phospho-H2AX (Ser139) FITC conjugate antibody Cell Signaling 9719 1:2,000 dilution
POWER SYBR-green PCR master mix  Applied Biosystems 4367659
Pre-stained molecular weight markers Biorad 161-0374
ProLong Gold Antifade  Invitrogen P36930
PVDF membrane  Thermo Scientific 88518
Senescence β-Galactosidase Staining Kit Cell Signaling 9860
TRIzol Ambion/Life Tech 10296028

DOWNLOAD MATERIALS LIST

References

  1. Hayflick, L. The Limited in Vitro Lifetime of Human Diploid Cell Strains. Exp Cell Res. 37, 614-636 (1965).
  2. van Deursen, J. M. The role of senescent cells in ageing. Nature. 509, (7501), 439-446 (2014).
  3. Campisi, J., d'Adda di Fagagna, F. Cellular senescence: when bad things happen to good cells. Nat Rev Mol Cell Biol. 8, (9), 729-740 (2007).
  4. Dimri, G., et al. A biomarker that identifies senescent human cells in culture and in aging skin in vivo. Proc Natl Acad Sci U S A. 92, 9363-9367 (1995).
  5. Kuilman, T., Michaloglou, C., Mooi, W. J., Peeper, D. S. The essence of senescence. Genes Dev. 24, (22), 2463-2479 (2010).
  6. Pospelova, T. V., et al. Pseudo-DNA damage response in senescent cells. Cell Cycle. 8, (24), 4112-4118 (2009).
  7. Narita, M., et al. Rb-mediated heterochromatin formation and silencing of E2F target genes during cellular senescence. Cell. 113, (6), 703-716 (2003).
  8. Ben-Porath, I., Weinberg, R. A. The signals and pathways activating cellular senescence. Int J Biochem Cell Biol. 37, (5), 961-976 (2005).
  9. Campisi, J. Senescent cells, tumor suppression, and organismal aging: good citizens, bad neighbors. Cell. 120, (4), 513-522 (2005).
  10. Coppe, J. P., et al. Senescence-associated secretory phenotypes reveal cell-nonautonomous functions of oncogenic RAS and the p53 tumor suppressor. PLoS Biol. 6, (12), 2853-2868 (2008).
  11. Tominaga-Yamanaka, K., et al. NF90 coordinately represses the senescence-associated secretory phenotype. Aging (Albany NY). 4, (10), 695-708 (2012).
  12. Wiley, C. D., et al. Mitochondrial Dysfunction Induces Senescence with a Distinct Secretory Phenotype. Cell Metab. 23, (2), 303-314 (2016).
  13. Hoare, M., et al. NOTCH1 mediates a switch between two distinct secretomes during senescence. Nat Cell Biol. 18, (9), 979-992 (2016).
  14. Rodier, F. Detection of the senescence-associated secretory phenotype (SASP). Methods Mol Biol. 965, 165-173 (2013).
  15. Srikantan, S., Marasa, B. S., Becker, K. G., Gorospe, M., Abdelmohsen, K. Paradoxical microRNAs: individual gene repressors, global translation enhancers. Cell Cycle. 10, (5), 751-759 (2011).
  16. Abdelmohsen, K., Gorospe, M. Noncoding RNA control of cellular senescence. Wiley Interdisciplinary Reviews: RNA. (2015).
  17. Bhaumik, D., et al. MicroRNAs miR-146a/b negatively modulate the senescence-associated inflammatory mediators IL-6 and IL-8. Aging. 1, (4), 402-411 (2009).
  18. Rodier, F., et al. DNA-SCARS: distinct nuclear structures that sustain damage-induced senescence growth arrest and inflammatory cytokine secretion. J Cell Sci. 124, (PT 1), 68-81 (2011).
  19. Bernardes de Jesus, B., Blasco, M. A. Assessing cell and organ senescence biomarkers. Circ Res. 111, (1), 97-109 (2012).
  20. Sharpless, N. E., Sherr, C. J. Forging a signature of in vivo senescence. Nat Rev Cancer. 15, (7), 397-408 (2015).
  21. Rubio, M. A., Kim, S. -H., Campisi, J. Reversible Manipulation of Telomerase Expression and Telomere Length: implications for the ionizing radiation response and replicative senescence of human cells. J Biol Chem. 277, (32), 28609-28617 (2002).
  22. Chen, Q. M., Prowse, K. R., Tu, V. C., Purdom, S., Linskens, M. H. K. Uncoupling the Senescent Phenotype from Telomere Shortening in Hydrogen Peroxide-Treated Fibroblasts. Experimental Cell Research. 265, (2), 294-303 (2001).
  23. Dumont, P., et al. Induction of replicative senescence biomarkers by sublethal oxidative stresses in normal human fibroblast. Free Radic Biol Med. 28, (3), 361-373 (2000).
  24. Roninson, I. B. Tumor Cell Senescence in Cancer Treatment. Cancer Research. 63, (11), 2705-2715 (2003).
  25. Nyunoya, T., et al. Cigarette Smoke Induces Cellular Senescence. J Respir Cell Mol Biol. 35, (6), 681-688 (2006).
  26. Bai, H., Gao, Y., Hoyle, D. L., Cheng, T., Wang, Z. Z. Suppression of Transforming Growth Factor-β Signaling Delays Cellular Senescence and Preserves the Function of Endothelial Cells Derived From Human Pluripotent Stem Cells. Stem Cells Transl Med. (2016).
  27. Senturk, S., et al. Transforming growth factor-beta induces senescence in hepatocellular carcinoma cells and inhibits tumor growth. Hepatology. 52, (3), 966-974 (2010).
  28. Aird, K. M., Zhang, R. Detection of senescence-associated heterochromatin foci (SAHF). Methods Mol Biol. 965, 185-196 (2013).
  29. Pospelova, T. V., Chitikova, Z. V., Pospelov, V. A. An integrated approach for monitoring cell senescence. Methods Mol Biol. 965, 383-408 (2013).
  30. Di Micco, R., et al. Interplay between oncogene-induced DNA damage response and heterochromatin in senescence and cancer. Nat Cell Biol. 13, (3), 292-302 (2011).
  31. Wright, W. E., Pereira-Smith, O. M., Shay, J. W. Reversible cellular senescence: implications for immortalization of normal human diploid fibroblasts. Mol Cell Biol. 9, (7), 3088-3092 (1989).
  32. Bursuker, I., Rhodes, J. M., Goldman, R. Beta-galactosidase--an indicator of the maturational stage of mouse and human mononuclear phagocytes. J Cell Physiol. 112, (3), 385-390 (1982).
  33. Kopp, H. G., Hooper, A. T., Shmelkov, S. V., Rafii, S. Beta-galactosidase staining on bone marrow. The osteoclast pitfall. Histol Histopathol. 22, (9), 971-976 (2007).
  34. Witkiewicz, A. K., Knudsen, K. E., Dicker, A. P., Knudsen, E. S. The meaning of p16(ink4a) expression in tumors: functional significance, clinical associations and future developments. Cell Cycle. 10, (15), 2497-2503 (2011).
  35. Baker, D. J., et al. Naturally occurring p16(Ink4a)-positive cells shorten healthy lifespan. Nature. 530, (7589), 184-189 (2016).
  36. Baker, D. J., et al. Clearance of p16Ink4a-positive senescent cells delays ageing-associated disorders. Nature. 479, (7372), 232-236 (2011).
  37. Demaria, M., et al. An Essential Role for Senescent Cells in Optimal Wound Healing through Secretion of PDGF-AA. Dev Cell. 31, (6), 722-733 (2014).
  38. Noren Hooten, N., et al. Metformin-mediated increase in DICER1 regulates microRNA expression and cellular senescence. Aging Cell. 15, (3), 572-581 (2016).
  39. Barzilai, N., Crandall, J. P., Kritchevsky, S. B., Espeland, M. A. Metformin as a Tool to Target Aging. Cell Metab. 23, (6), 1060-1065 (2016).
  40. Foretz, M., Guigas, B., Bertrand, L., Pollak, M., Viollet, B. Metformin: from mechanisms of action to therapies. Cell Metab. 20, (6), 953-966 (2014).
  41. Cahu, J., Sola, B. A sensitive method to quantify senescent cancer cells. J Vis Exp. (78), (2013).
  42. Debacq-Chainiaux, F., Erusalimsky, J. D., Campisi, J., Toussaint, O. Protocols to detect senescence-associated beta-galactosidase (SA-betagal) activity, a biomarker of senescent cells in culture and in vivo. Nat Protoc. 4, (12), 1798-1806 (2009).
  43. Noppe, G., et al. Rapid flow cytometric method for measuring senescence associated beta-galactosidase activity in human fibroblasts. Cytometry A. 75, (11), 910-916 (2009).
  44. Bassaneze, V., Miyakawa, A. A., Krieger, J. E. Chemiluminescent detection of senescence-associated beta galactosidase. Methods Mol Biol. 965, 157-163 (2013).
  45. Redon, C. E., et al. gamma-H2AX detection in peripheral blood lymphocytes, splenocytes, bone marrow, xenografts, and skin. Methods Mol Biol. 682, 249-270 (2011).
  46. Kosar, M., et al. Senescence-associated heterochromatin foci are dispensable for cellular senescence, occur in a cell type- and insult-dependent manner and follow expression of p16(ink4a). Cell Cycle. 10, (3), 457-468 (2011).
  47. Kennedy, A. L., et al. Senescent mouse cells fail to overtly regulate the HIRA histone chaperone and do not form robust Senescence Associated Heterochromatin Foci. Cell Div. 5, 16 (2010).
तकनीक प्रेरित और यों सेलुलर बुढ़ापा को
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Noren Hooten, N., Evans, M. K. Techniques to Induce and Quantify Cellular Senescence. J. Vis. Exp. (123), e55533, doi:10.3791/55533 (2017).More

Noren Hooten, N., Evans, M. K. Techniques to Induce and Quantify Cellular Senescence. J. Vis. Exp. (123), e55533, doi:10.3791/55533 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter