Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biology

Le tecniche per indurre e Quantificare cellulare senescenza

doi: 10.3791/55533 Published: May 1, 2017

Summary

senescenza cellulare, lo stato irreversibile di arresto del ciclo cellulare, può essere indotta da vari stress cellulari. Qui, descriviamo i protocolli per indurre la senescenza e metodi per valutare cellulare marcatori di senescenza.

Abstract

In risposta allo stress cellulare o danno, le cellule proliferanti possono indurre un programma specifico che avvia uno stato di arresto del ciclo cellulare a lungo termine, chiamato senescenza cellulare. Accumulo di cellule senescenti verifica con l'invecchiamento organismal e mediante coltura continua in vitro. cellule senescenti influenzano molti processi biologici, compreso lo sviluppo embrionale, la riparazione dei tessuti e la rigenerazione, soppressione del tumore, e l'invecchiamento. Caratteristiche di cellule senescenti includono, ma non sono limitati a, maggiore attività β-galattosidasi senescenza-associato (SA-β-gal); p16 INK4a, p53, p21 e livelli; Livelli più elevati di danno al DNA, tra γ-H2AX; la formazione di senescenza associata Eterocromatina Foci (SAHF); e l'acquisizione di un senescenza associata secretoria fenotipo (SASP), un fenomeno caratterizzato dalla secrezione di alcune citochine pro-infiammatorie e molecole di segnalazione. Qui, descriviamo i protocolli sia per replicativo esenescenza DNA danno-indotta in cellule coltivate. Inoltre, si segnalano tecniche per monitorare il fenotipo senescente utilizzando diversi marcatori senescenza-associata, tra SA-β-gal, γ-H2AX e SAHF colorazione, e per quantificare i livelli di proteine ​​e mRNA di regolatori del ciclo cellulare e fattori SASP. Questi metodi possono essere applicati alla valutazione della senescenza in vari modelli e tessuti.

Introduction

Più di mezzo secolo fa, Hayflick e colleghi hanno descritto come le cellule proliferano non trasformata in cultura, ma solo per un periodo limitato di tempo 1. coltura a lungo termine di fibroblasti umani ha causato le cellule per fermare la proliferazione; tuttavia, erano metabolicamente attiva, e questo è stato chiamato senescenza cellulare. Senescenza può essere utile per inibire la tumorigenesi, ma può anche essere dannoso, in quanto si ritiene contribuiscano alla perdita di capacità rigenerativa che si verifica con l'invecchiamento 2, 3. Cellule senescenti hanno dimostrato di accumularsi nei tessuti come esseri umani 4 anni e sono stati implicati in una serie di processi biologici, tra cui lo sviluppo embrionale, la guarigione delle ferite, la riparazione dei tessuti e l'infiammazione legata all'età 2.

passaging continuo di cellule in coltura induce senescenza replicativa, che è stato collegatodi telomero attrito e instabilità genomica. Varie sollecitazioni cellulari, comprese danno al DNA e oncogeni, possono anche causare senescenza 3. Senescenza causata da fattori diversi telomere attrito è spesso chiamato da stress o senescenza prematura e dipende generalmente dalla p16 INK4A / Rb pathway 5. Sebbene proliferanti, cellule non trasformate compaiono tipicamente mandrino in forma, cellule senescenti possono essere identificati come aventi determinate caratteristiche, tra cui una TV, ampio morfologia e una maggiore attività β-galattosidasi senescenza-associato (SA-β-gal) (Figure 1 e 2). Cellule senescenti accumulano anche marcatori di danno del DNA, tra cui γ-H2AX (figura 3) 6, e, potenzialmente, senescenza associata eterocromatina foci (SAHF) (Figura 4) 7. cellule senescenti hanno livelli elevati di regolatori del ciclo cellulare, tra cui p 16 (INK4A p16) e / o p21 e p53 (Figura 5) 8, 9. Inoltre, i dati recenti hanno dimostrato che le cellule senescenti possono avere effetti non autonomi secernendo un numero di citochine pro-infiammatorie e chemochine chiamato senescenza associata secretoria fenotipo (PSAS) 10. Sebbene questo fenomeno SASP può variare da tipo cellulare a tipo cellulare, in generale, è dimostrato da un aumento di interleuchina-6 (IL-6), IL-8, fattore stimolante le colonie di granulociti-macrofagi (GM-CSF), alla crescita α regolata oncogene (GRO-α) e GRO-β, tra gli altri (Figura 6). Lo stress particolare o danni che induce senescenza possono anche influenzare il fenotipo secretorio 11, 12, 13. SASP può essere rilevata misurando i livelli di proteine ​​secrete mediante ELISA o array citochine / proteinas = "xref"> 10, 14. Sebbene i meccanismi post-trascrizionali possono regolare i livelli proteici SASP 11, 15, 16, 17, cambiamenti nei livelli di mRNA possono essere rilevati anche in molti casi. Questi cambiamenti sono generalmente più sensibili e più facile da quantificare rispetto misurazioni del livello di proteine. Altri marcatori senescenti possono anche essere valutati, compresi persistente danno al DNA foci nucleari, detti segmenti di DNA con alterazioni della cromatina rinforzo senescenza (DNA-SCARS) 18, e vari altri marcatori 3, 19, 20.

Qui, descriviamo comuni tecniche per indurre senescenza in cellule in coltura e per la misura diversi marcatori di senescenza, tra SA-β-Gal, γ-H2AX, SAHF, e la proteina e mRNA di senescemolecole SNO-associata.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Induzione replicativo senescenza

  1. Disgelo basso passaggio fibroblasti diploidi umane (ad esempio, WI-38 e IMR-90) o altre linee cellulari.
    NOTA: Qui, fibroblasti diploidi umane sono stati usati, ma questi protocolli può essere utilizzato per valutare la senescenza in altri tipi di cellule, come cellule endoteliali, epiteliali, o cellule staminali mesenchimali. condizioni di coltura possono essere ottimizzate per i diversi tipi cellulari utilizzati a causa dei diversi tassi di crescita o condizioni di crescita.
    NOTA: Le cellule devono essere proliferare e hanno una morfologia mandrino (vedere Figura 1 per una schematica e la figura 2 per gli esempi). Idealmente, le cellule devono avere un raddoppio della popolazione Livello (PDL) di <30 all'inizio degli esperimenti per evitare di avere eventuali cellule senescenti replicative.
    1. Calcolare la PDL delle cellule utilizzando la seguente equazione PDL = log (N f / N 0) / log2, dove N è il numero f cellulare finale e <em> N 0 è il numero iniziale di cellule seminate 21.
  2. Cultura WI-38 cellule in coltura di Dulbecco modificato (DMEM) integrato con il 10% di siero fetale bovino (FBS), aminoacidi non essenziali 1% e l'1% di penicillina / streptomicina.
  3. Grow IMR-90 cellule in DMEM supplementato con 10% FBS e 1% di penicillina / streptomicina.
  4. Crescere tutte le cellule a 37 ° C e 5% CO 2. continuo crescere le cellule e dividere ogni di 2 - 4 d quando le cellule raggiungono ~ 70 - 80% di confluenza. Monitorare confluenza cella utilizzando un microscopio ottico. Evitare le cellule con una maggiore convergenza, in quanto questo può influenzare la crescita delle cellule a causa del contatto inibizione.
  5. Monitorare le cellule con un microscopio ottico per l'aspetto morfologico delle cellule senescenti (vedi figure 1 e 2) e per cui non v'è alcun cambiamento nella PDL da una subcultura all'altro.

2. DNA senescenza danni indotti

    (ad esempio, WI-38, IMR-90, o un altro tipo di cellula) ad una densità sparse (cioè ~ 300.000 cellule / 6 cm piatto) in un piatto appropriato per il tipo di analisi (cioè un piatto 6 centimetri per le proteine / marcatori RNA o un piatto 6 pozzetti per SA-β-gal colorazione). Usare le cellule early-passaggio che sono giovani e proliferanti (<30 PDL) e la piastra in modo che le cellule sono più o meno 50 - 60% confluenti il ​​giorno successivo.
  1. Rimuovere il terreno di coltura utilizzando una pipetta di vetro collegato ad un vuoto e lavare le cellule aggiungendo 1x salina tamponata con fosfato (PBS). Ripetere questo passaggio per un totale di due lavaggi. Aggiungere un sottile strato di PBS (~ 750 microlitri per un piatto 6 cm) sia una condizione trattata e per un radiazione ionizzante (IR) trattato "finto".
  2. Utilizzare un irradiatore gamma per esporre le cellule ad una dose singola di 10 Gray (Gy) di IR; questa è un'esposizione tipica per la maggior parte linee cellulari. In una cappa, togliere il PBS e sostituirlo con terreno di crescita. In alternativa, trattare le cellule con bleomycin a 20 ug / ml per 2 h.
  3. Cambiare il medio sulle cellule ogni 48 -7 2 ​​ore e, se necessario dividere le celle.
  4. Monitorare le cellule con un microscopio ottico per modifiche morfologiche (vedi Figura 1 per una schematica e la figura 2 per le immagini rappresentative cellulari) e saggio per marcatori senescenti 7 - 10 d dopo il trattamento IR.
    NOTA: Questo protocollo descrive senescenza indotta da IR. Senescenza può anche essere indotta da altre sollecitazioni, comprese bleomicina (vedere sopra per condizioni), H 2 O 2 22, 23, 24, chemioterapici fumo di sigaretta 25, fattore di crescita trasformante (TGF) -β1 26, 27, e altri metodi 21 , 28, 29.

3. colorazione Cells per senescenza associata β-galattosidasi

  1. Prima della colorazione, esaminare le cellule al microscopio ottico di monitorare i cambiamenti morfologici.
    NOTA: senescente cellule sono tipicamente ingrandite e piatta, a differenza delle cellule proliferanti, che hanno una morfologia mandrino (vedere Figura 1 per una schematica e la figura 2 per i risultati rappresentativi). cellule proliferanti possono essere usate come controllo negativo, e cellule trattate con IR o altro agente danneggiano il DNA (vedi sezione 2) possono essere usati come controlli positivi.
  2. Quantificare l'attività SA-β-gal utilizzando reagenti da un kit commerciale (si veda la Tabella Materiali). Scongelare tutti i reagenti e portarli a temperatura ambiente riscaldandoli fino a 37 ° C.
    1. Calcolare la quantità di soluzione colorante e soluzione fissativa necessario.
      NOTA: Tipicamente, un volume di 1 ml è sufficiente per un pozzetto in una piastra da 6 pozzetti. Piatti di diverse dimensioni possono essere usate, ma di dimensioni 6-pozzetti è WELl-adatto ad eseguire un test in triplicato per ogni condizione. Questa densità di solito fornisce un numero sufficiente di cellule per campo di contare senza utilizzare un numero eccessivo di cellule.
    2. Diluire la soluzione 1:10 colorazione con acqua distillata.
    3. Diluire la soluzione fissativo 1:10 con acqua distillata.
    4. Ottenere una soluzione 20x archivio di X-gal (5-bromo-4-cloro-3-indolile-β-D-galattopiranoside) in N, N-dimetilformammide (DMF, ad esempio, 20 mg di X-gal in 1 mL di DMF). Per massimizzare l'utilizzo del kit, dosare X-gal per l'importo necessario per ogni test e quindi aggiungere la quantità calcolata di DMF a dissolversi. In alternativa, conservare la soluzione madre a -20 ° C in un tubo luminoso protetto per un mese. Utilizzare i tubi solo polipropilene (opachi) per diluire e memorizzare soluzioni X-gal.
    5. Preparare β-gal soluzione colorante: 930 ml di soluzione colorante 1x, 10 ml di colorazione supplemento A, 10 ml di colorazione integratore B, e 50 ml di 20 mg / mL X-Gal in DMF. Fare un master mix a seconda di quanti pozzi devono essere macchiato.
  3. Rimuovere con attenzione il supporto dalle cellule utilizzando una pipetta di trasferimento o equivalente.
  4. lavare delicatamente le cellule una volta con temperatura ambiente PBS 1x.
  5. Aggiungere 1 ml di 1x soluzione fissativa ad ogni pozzetto e incubare per 10-15 minuti a temperatura ambiente.
  6. Rimuovere la soluzione fissativo con una pipetta di trasferimento.
    NOTA: La soluzione fissativo (1x) contiene 2% formaldeide e 0,2% di glutaraldeide e devono essere smaltiti come rifiuti pericolosi secondo le raccomandazioni dell'ufficio sicurezza in laboratorio.
  7. lavare delicatamente le cellule due volte con PBS 1x.
  8. Rimuovere il PBS completamente e aggiungere la soluzione di colorazione 1x β-gal ai pozzetti (1 ml / pozzetto di una piastra a 6 pozzetti). Coprire la piastra completamente con foglio di alluminio e incubare per 24 - 48 h in un incubatore a 37 ° (preferibilmente in assenza di CO 2, in quanto questo può abbassare il pH del tampone e incidere colorazione).
    1. Controllare le cellule a 24 ore per la colorazione, e se la macchia è troppo leggero, incubare per altre 24 ore.
  9. Dopo il tempo di incubazione, rimuovere la soluzione β-gal e sostituirlo con PBS 1x.
    NOTA: Questo passaggio rimuove alcuni dei colore di sfondo quando l'imaging e impedisce anche fuoriuscita pericolosa della soluzione di X-gal.
    NOTA: Eliminare la soluzione di β-gal correttamente, secondo le raccomandazioni dell'ufficio sicurezza in laboratorio.
  10. Esaminare le cellule su un microscopio ottico con una telecamera collegata utilizzando un obiettivo 10x o superiore; cellule SA-β-gal-positivi saranno blu. Acquisire il numero desiderato di immagini per l'esperimento. Se contando la percentuale di cellule SA-β-gal positive, acquisire il numero appropriato di immagini (> 5) per la quantificazione per pozzetto. Assicurarsi che le immagini non si sovrappongono da vari campi di vista all'interno di ciascun pozzetto.
  11. Contare il numero di SA-β-gal-positivi (blu), le cellule rispetto al numero di cellule totaliper calcolare la percentuale di cellule SA-β-gal-positivi. Contare> 100 cellule per condizione.
    NOTA: Rappresentante immagini possono essere utilizzati anche per le figure. Si noti che confluenza delle cellule è fondamentale se le cellule che contano, come troppe cellule rendono difficile distinguere ogni cella e troppo pochi non può dare un numero sufficiente di cellule per la quantificazione e le statistiche. Immagini di cifre per la pubblicazione sono alla migliore risoluzione se salvato come file TIFF, anche se i file .jpeg sono adatti anche. Le immagini a colori devono essere di 300 dpi.

4. Cellule colorazione per γ-H2AX

  1. Piastra le cellule da sezioni 1 o 2 su vetrini in una piastra a 24 pozzetti.
  2. Il giorno dopo, lavare le cellule con PBS 1x. Sciacquare con cura, come le cellule senescenti non aderiscono bene al coprioggetto e possono essere facilmente rimossi durante i lavaggi. In alternativa, fissare direttamente le cellule senza lavaggio.
  3. Rimuovere il PBS e fissare le cellule con appena preparato formaldeide 3,7% in PBS per10 minuti a temperatura ambiente.
  4. Rimuovere la soluzione e permeabilize le cellule con 0,2% Triton X-100 in PBS per 10 min.
  5. Rimuovere la soluzione e blocco 5% FBS in PBS per 2 ore a RT.
  6. Incubare con anticorpi anti-fosfo-γ H2AX (Ser139) e FITC coniugato in 5% FBS / PBS per 2 ore a 37 ° C o O / N a 4 ° C. Proteggere dalla luce.
  7. Lavare 3 - 6x con PBS a 37 ° C per un totale del 30 - 60 min.
  8. Macchia con DAPI (diluito 1: 15.000 in PBS) per 10 minuti a RT.
  9. Lavare 3x con PBS.
  10. Lavare rapidamente con acqua per rimuovere i sali e montare il vetrino su un vetrino utilizzando 3 - 5 ml di reagente antifade. In alternativa, utilizzare una soluzione di montaggio contenente DAPI.
  11. Lasciare asciugare O / N e visualizzare le cellule colorate su un microscopio a fluorescenza o confocale utilizzando un obiettivo 63X o superiore.
  12. Quantificare fuochi γ-H2AX utilizzando uno dei due metodi descritti di seguito. Punteggio per entrambi i protocolli ad occhio utilizzando un microscopio a fluorescenza. Idealmente, ciEA microscopio confocale. Prendere Z-sezioni e condensare in un unico piano per visualizzare tutti foci rilevabile (immagini rappresentative per γ-H2AX colorazione nelle cellule proliferanti e senescenti sono mostrati in figura 3). Contare il foci ad occhio utilizzando software di imaging; in generale, ~ 100 - 200 nuclei sono sufficienti per il conteggio.
    1. Per quantificare la percentuale di cellule che hanno foci γ-H2AX-positivi, contare ogni cella che abbia almeno un fuoco visibile e dividere per il numero totale di nuclei DAPI-macchiati.
    2. Per quantificare il numero di γ-H2AX focolai, contare il γ-H2AX focolai per cella.
      NOTA: I livelli di γ-H2AX possono variare a seconda delle condizioni di stress o danno specifico che ha indotto la senescenza.

5. Le cellule colorazione per SAHF Marcatori

NOTA: cellule senescenti umane hanno spesso regioni nucleari di condensato DNA / cromatina. In cellule senescenti, queste regioni heterochromaticsi pensa di inibire l'espressione di geni di proliferazione di promozione, come i membri della famiglia E2F. SAHF può essere visualizzata dalla riorganizzazione di DAPI; dalla presenza di segni istone eterocromatina associati, compreso il di- e tri-metilazione di Lys9 su istone H3 (H3K9Me2 e H3K9Me3); e da proteine cromatina riorganizzazione, tra HP1 eterocromatina proteina 1 (HP1), HIRA (istone repressore A), e ASF1a (anti-silenziamento funzione-1a) per cromatina 30. Abbiamo scelto di utilizzare un modello di senescenza oncogene-indotta (OIS), come SAHF è più evidente nei modelli OIS 30. Cellule IDH4 proliferano in presenza di desametasone per la presenza di grandi antigene T di SV40 ma diventano senescente dopo la rimozione del desametasone dal mezzo 31. SAHF può essere rilevato da colorazione DAPI e dalla colorazione con anticorpi contro marcatori specifici elencati sopra. Qui, descriviamo DAPI e H3K9Me2 colorazione per la visualizatione di SAHF in cellule 28.

  1. Crescere le cellule IDH4 in DMEM supplementato con 10% FBS, 1% di penicillina / streptomicina, e 1 ug / mL di desametasone. Per indurre senescenza, rimuovere il desametasone e cambiare il supporto in modo che contenga carbonella-spogliato FBS; dopo la crescita di ~ 10 giorni in questo nuovo mezzo, le cellule diventano senescenti IDH4 31.
  2. cellule IDH4 piastra o cellule da sezioni 1 o 2, sopra descritte, su vetrini in una piastra a 24 pozzetti.
  3. Il giorno dopo, lavare le cellule con PBS 1x. Sciacquare con cura, come le cellule senescenti non aderiscono bene al coprioggetto e possono essere facilmente rimossi durante i lavaggi. In alternativa, fissare direttamente le cellule senza lavaggio.
  4. Rimuovere il PBS e fissare le cellule con appena preparato formaldeide 3,7% in PBS per 10 minuti a RT.
  5. Lavare le cellule 3 volte con PBS 1x.
  6. Rimuovere la soluzione e permeabilize le cellule con 0,2% Triton X-100 in PBS per 5 min.
  7. Lavare le cellule con 1xPBS. Rimuovere il PBS e bloccare i coprioggetti aggiungendo tampone bloccante contenente 3% BSA (w / v) in PBS per 5 minuti a temperatura ambiente. filtrata sempre soluzioni contenente BSA prima dell'uso per rimuovere il particolato.
  8. Rimuovere il tampone di bloccaggio e incubare le cellule con anticorpi primari contro marcatori SAHF come anticorpi anti-H3KMe2 (Figura 4; vedere la Tabella Materiali per i dettagli). Diluire gli anticorpi in tampone bloccante e incubare per 1 - 2 ore a RT.
  9. Rimuovere la soluzione di anticorpo primario e lavare i coprioggetti 3 volte con 1% (v / v) Triton X-100 in PBS.
  10. Diluire gli anticorpi secondari in tampone bloccante (materiali Tabella) e incubare per 1 ora a RT. Proteggere dalla luce.
  11. Lavare le cellule due volte con PBS 1x. Macchia con DAPI (diluito 1: 15.000 in PBS, vedi la Tabella Materiali) per 10 min a RT.
  12. Lavare i coprioggetti 3x con PBS 1x.
    1. Lavare rapidamente con acqua per rimuovere i sali unnd montare ogni vetrino su un vetrino utilizzando 3 - 5 ml di reagente antifade. In alternativa, utilizzare una soluzione di montaggio contenente DAPI.
    2. Lasciare asciugare O / N e visualizzare le cellule colorate su un microscopio a fluorescenza o confocale utilizzando un obiettivo 63X o superiore (vedere i Risultati rappresentativi in Figura 4). Quantificare il SAHF come descritto nella Sezione 4.
      NOTA: isotipo anticorpi primari controllo o nessun anticorpo primario (cioè secondario solo) dovrebbero essere utilizzati come controllo negativo per immunofluorescenza.

6. Analisi Proteine ​​senescenza associate mediante immunoblotting

NOTA: Il fenotipo senescente è caratterizzata dalla sovraregolazione di regolatori del ciclo cellulare, tra cui p16 INK4A, p21, e p53. Questo protocollo descrive la quantificazione dei livelli di queste proteine ​​in lisati cellulari. Queste tecniche possono essere utilizzate per valutare senescenza indotta utilizzando una varietà diMetodi 21, 28, 29.

  1. Indurre senescenza cellulare come descritto nelle sezioni 1 e 2 o utilizzando un altro metodo 21, 28, 29. Per analizzare i marcatori senescenza cellulare, le cellule piastra in 6 piatti cm e analizzare sia le proteine ​​e l'RNA contemporaneamente (si veda la Sezione 7 per le istruzioni di isolamento RNA).
  2. Rimuovere il terreno di coltura cellulare. Mettere le cellule su un vassoio di ghiaccio.
    1. Lavare le cellule 2 volte con PBS freddo 1x. Inclinare il piatto per assicurare che tutto il PBS viene aspirato in modo da essere il più preciso in termini di volumi utilizzati nella procedura.
    2. Dopo aver aspirato l'ultimo lavaggio di PBS, aggiungere 200 ml di PBS freddo 1x (a 6 centimetri piatto) al piatto. Raschiare le cellule utilizzando un raschietto cellulare.
    3. Pipettare la miscela / PBS cellule in una provetta RNasi-free per l'isolamento dell'RNA. Prendere circa 150 &# 181; L di questa miscela e pipetta in un nuovo tubo. Tale aliquota viene utilizzata per l'analisi di proteine, in modo da essere sicuri di pipetta la stessa quantità da ogni provetta.
  3. Lisare cellule mediante aggiungendo 75 - 100 pl di tampone campione di 2x Laemmli modificato (60 mM Tris-HCl pH 6,8, 12,5% glicerolo, 2% SDS, 5% β-mercaptoetanolo (BME), e blu di bromofenolo, può essere costituita come un grande rotolo, aliquotati e conservati a -20 ° C fino al momento dell'uso) o un tampone campione equivalente.
    1. In alternativa, lisare le cellule nel 75 - 100 pl di tampone di lisi e centrifugare a 15.000 xg per 10 min a 4 ° C per rimuovere i detriti cellulari. Rimuovere il surnatante e pipetta in una provetta pulita. Un Metodo di Bradford o un saggio proteico equivalente possono essere utilizzati su lisati per assicurare il carico uguale di proteina.
      NOTA: saggi di proteine ​​non possono essere eseguite su campioni lisati in tampone campione.
    2. Estrarre ~ 25 microlitri di lisato e aggiungerlo a 15 ml di tampone campione 2x. Pipetta e farewn nel tampone campione per lisare le cellule.
      NOTA: I volumi di tampone di lisi o tampone campione possono essere regolati a seconda confluenza cellulare. Se il campione è "appiccicosa" per lisi nucleare, aggiungere più tampone campione o PBS per diluire. I campioni possono essere conservati a -20 ° C fino al momento dell'uso.
  4. Bollire i campioni per 5 min a 95 ° C su un blocco di calore (o dispositivo equivalente) e carico ~ 40 microlitri di campione lisato in tampone campione su un gel Tris-Glicina 18%.
    NOTA: Un gel gradiente (4-15%) o un gel Tris-Glicina 14% sono sufficienti anche per rilevare proteine ​​a basso peso molecolare. Diversi tipi di gel di acrilammide possono anche essere usati, ma garantiscono che i gel e sistema sono adeguate per rilevare proteine ​​a basso peso molecolare.
    1. Eseguito utilizzando 1x tampone di corsa ad una costante 100 V per 20 minuti (attraverso il gel di impilamento) e ~ 60 minuti a 180 V. Monitorare il gel in modo che il fronte del colorante scorre appena fuori o è al fondo del gel in modo che la bassa molecolare proteine ​​peso no run off del gel.
  5. Trasferire il gel di acrilammide a una membrana PVDF (pre-impregnato con 100% metanolo per attivare). Se facendo un trasferimento bagnato, solo 1 h è necessaria per il trasferimento (rispetto al normale ~ 1,75 h). Regolare di conseguenza per il sistema di trasferimento adeguato; utilizzando marcatori di peso molecolare pre-tinto può aiutare a valutare l'efficienza di trasferimento.
  6. Lavare la membrana in acqua. Utilizzare una macchia Ponceau per controllare il carico uguale di campioni. Lavare il Ponceau con acqua.
    1. Bloccare la membrana nel latte secco 5% non grasso in TBST (50 mM Tris-HCl pH 7,5, 150 mM NaCl, e 0,1% Tween-20) per 1 ora a RT o O / N a 4 ° C con agitazione.
  7. Lavaggio tamponare una volta con TBST e incubare con l'anticorpo primario diluito in TBST 5% latte (vedere la Tabella Materiali per diluizioni e raccomandazioni anticorpo) per 1 ora a RT.
  8. Eseguire due lavaggi rapidi con TBST e poi lavare due volte su un agitatore per un totale di circa 30 min (~ 15 min ognuno erah).
  9. Incubare con un anticorpo secondario per 40 minuti a temperatura ambiente. Ripetere il punto 6.10.
  10. Incubare con fresco substrato Western blot e sviluppare la pellicola o leggere su un lettore di chemiluminescenza.
  11. Immunoblot sonda con p16 anticorpi INK4A primi (Figura 5). Striscia la membrana incubando per 15 minuti con acqua, 15 minuti con 0,2 N NaOH, e 15 minuti con acqua. Continuare con il punto 6.9 utilizzando anticorpi anti-p21.
  12. Striscia la membrana utilizzando 62,5 mM Tris-HCl pH 6,8 e 2% SDS con 300 ml di appena aggiunto BME per 50 ml di soluzione di strippaggio.
  13. Incubare a 50 ° C per 30 minuti e lavare a lungo con TBS e poi TBST. Sonda con anticorpi anti-actina o anti-GAPDH per i controlli proteina-carico (Figura 5 mostra risultati rappresentativi).
    NOTA: i livelli di p53 possono anche essere valutati sulle stesse membrane. Tuttavia, dal momento che p53 è un peso molecolare più elevato, è meglio risolto su un gel inferiore percentuale (ad esempio,

7. Analizzando i livelli di mRNA di senescenza Marcatori

NOTA: Quando si isola RNA, garantire che le superfici di lavoro vengono puliti con soluzioni di rimozione RNasi o un equivalente e che i materiali sono tutti RNase-free.

  1. Mediante la miscela / PBS cella dal punto 4.2, aggiungere 1 ml di soluzione di estrazione dell'RNA e vortex per 30 s (ci dovrebbero essere grumi visibili o detriti cellulari).
  2. Aggiungere 200 ml di cloroformio e agitare vigorosamente per 15 s.
  3. Centrifugare a velocità massima (> 15.000 xg) per 15 min a 4 ° C.
  4. Rimuovere ~ 400 microlitri dello strato acquoso superiore RNA e pipettare in una nuova provetta per microcentrifuga.
  5. Aggiungere 400 ml di isopropanolo (1: 1 con il volume totale dello strato acquoso pipettati nel passaggio precedente) e 4 ml di precipitant allo strato RNA.
  6. Centrifugare per 15-30 min a velocità massima (> 15.000 xg) e 4 ° C per sedimentare il RNA.
  7. Rimuovere il surnatante e aggiungere 1 ml di etanolo al 75% ghiacciata.
  8. Centrifugare per 1 min a velocità massima (> 15.000 xg) e 4 ° C.
  9. Rimuovere il surnatante e centrifugare per 1 min a velocità massima (> 15.000 xg) e 4 ° C.
  10. Pipetta come più liquido possibile e asciugare all'aria per 2 min.
  11. Risospendere in 10 ml di 10x tampone DNasi, 85 ml di H 2 O, e 5 ml di DNasi 1.
  12. Incubare a 37 ° C per 30 min.
  13. Aggiungere 200 microlitri NT2 tampone (50 mM Tris-HCl pH 7,4, 150 mM NaCl, 1 mM MgCl 2, e 0,05% Nonidet P-40) e aggiungere 300 microlitri dello strato inferiore di acido fenolo-CHCl 2.
  14. Vortex per 1 min e centrifugare a temperatura ambiente per 5 min a velocità massima (> 15.000 xg).
  15. Raccogliere 250 microlitri dello strato RNA superiore (2 x 125 mL), aggiungere 25ml di 3 M acetato di sodio pH 5,2, 625 ml di etanolo al 100% ghiacciato, e 5 ml di precipitante. Mescolare bene e precipitare O / N a -20 ° C.
  16. Il giorno successivo, mescolare e far girare a velocità massima (> 15.000 xg) e 4 ° C per 30 minuti e scartare il surnatante.
  17. Ripetere i passaggi 6,8-6,11.
  18. Risospendere il pellet in 12 ml di acqua priva di nucleasi e conservare a -80 ° C fino al momento dell'uso.
    NOTA: Altre procedure di isolamento di RNA e kit può essere utilizzato come bene.
  19. Eseguire la trascrizione inversa con esameri casuali e SSII trascrittasi inversa secondo il protocollo del produttore.
    NOTA: Data la bassa quantità di RNA isolato da cellule senescenti, è meglio usare tutto il RNA (12 mL) per la sintesi di trascrizione inversa. In alternativa, l'RNA può essere quantificato utilizzando uno spettrofotometro, e la stessa quantità di RNA può essere utilizzato per la trascrizione inversa.
  20. Analizzare i livelli di mRNA utilizzando real-time qPCR (RT-qPCR) amplific quantitativazione e master mix PCR SYBR-verde con primer gene-specifici.
    1. Come in una tipica reazione di RT-qPCR, diluire il cDNA 01:30 (in RNasi / acqua priva di DNasi) e aggiungere 3 microlitri al tempo reale piastra da 96 pozzetti per una migliore precisione di pipettamento. Preparare una master mix reazione in avanti gene-specifica e reverse primer (concentrazione 2,5 micron, aggiungere 5 ml / reazione), miscela PCR SYBR-verde (6,25 ml / reazione; utilizzare meno raccomandazioni del costruttore), e 5,75 ml di RNasi / acqua priva di DNasi per un volume finale di reazione di 20 microlitri (17 ml di primer / SYBR-verde / acqua e 3 ml di cDNA).
    2. Eseguire RT-qPCR amplificazione utilizzando una macchina di PCR in tempo reale; seguire il protocollo del produttore.
      NOTA: un elenco di umana convalidato in avanti e retromarcia primer in tempo reale si possono trovare nella tabella 1. Questi geni includono proteine ​​SASP e altri marcatori di senescenza associati e / o geni. Risultati rappresentativi di senescenza IR-indotta sono mostrati in

8. livelli di proteina Quantificare SASP

  1. Indurre senescenza utilizzando sezioni 1 o 2 o utilizzando un altro metodo. Piastra le celle 6 o 10 piatti cm, come descritto in precedenza (~ 250.000 cellule / 6 cm piastra o ~ 650.000 / 10 cm piastra).
  2. Sia con celle 10 d trattamento post-IR o con cellule senescenti replicative (e cellule di controllo appropriati), lavare le cellule tre volte con PBS 1x e aggiungere terreno privo di siero con antibiotici in un piccolo volume (2,5 mL per 6 cm o 5 mL per 10 cm).
  3. Incubare per una notte a 37 ° C e 5% di CO 2 in un incubatore di coltura tissutale. Il giorno dopo, raccogliere le medie e metterlo in un tubo conico sul ghiaccio.
  4. Lavare le cellule 2 volte con PBS e poi aggiungere 1 ml di tripsina (per un piatto 6 cm). Contare le cellule utilizzando un emocitometro per regolare successivamente le concentrazioni in base al numero di cellule.
  5. Centrifugare il mezzo per 5 minuti a 300 x g.
  6. Filter mezzo utilizzando un filtro siringa da 0,45 micron.
  7. Aliquotare e congelare il mezzo a -80 ° C fino al momento dell'uso o dosaggio direttamente tramite ELISA o saggi equivalenti.
  8. Calcolare il numero di cellule / ml di concentrazione prendendo cella numero / volume totale del mezzo di raccolta.
  9. Eseguire un adeguato saggio di immunoassorbimento enzimatico (ELISA) in base alle istruzioni del produttore. Vedere la Tabella Materiali di kit ELISA consigliati per il saggio per IL-6, IL-8, GROα, e altre citochine / chemochine (Figura 6B).
  10. Per garantire che i fattori che vengono misurate sono all'interno della gamma lineare del kit ELISA, fare diluizioni del mezzo cellula senescente rispetto al mezzo cellule proliferanti. Conto di queste diluizioni e il volume quando si calcola la quantità di IL-6. Per acquisire la quantità di IL-6 secreta per cellula al giorno, calcolare il valore di IL-6 ottenuto dal kit (in pg) per concentrazione cellulare diluita per mL (frpasso om 7.8).
    NOTA: Altri metodi, ad esempio matrici citochine, può essere utilizzato per rilevare i livelli di proteine ​​SASP e può essere idoneo per lo screening di un gran numero di fattori SASP. I livelli proteici di fattori SASP possono variare in base al tempo dopo induzione senescenza, il tipo di cellula, o il tipo di senescenza indotta.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Le figure 2 - 6 mostrano risultati rappresentativi SA-β-gal colorazione; colorazione per γ-H2AX e SAHF; valutazione dei livelli di proteina di p16 INK4A, p21, e p53; e mRNA e di proteina di molecole senescenti-associata. Aumento della colorazione SA-β-gal verifica con replicativa e danni al DNA indotto senescenza. Inoltre, osservare i cambiamenti morfologici che si verificano con senescenza. Cellule diventano allargata e piatta rispetto alla comparsa del mandrino di fibroblasti proliferanti. Per questo paradigma sperimentale, le cellule sono state colorate e RNA / proteine ​​sono state isolate 7 d dopo esposizione IR. Risultati più robusti possono verificarsi attendendo più dopo esposizione IR (cioè 10 d). Condizioni devono essere determinati per ogni condizione e setup sperimentale. Questi risultati sono rappresentativi e questi marcatori possono essere rilevati anche quando senescenza viene indotta con altri metodi.

figura 6, i nomi dei geni sono elencati e corrispondono CXCL1 (GROα), CXCL2 (GROβ), e CSF2 (GM-CSF). La sovraregolazione dei livelli di mRNA di alcuni, ma non tutti, i fattori SASP sono stati osservati dopo senescenza IR indotta in WI-38 cellule. Altri mRNA senescenza-associata, incluse CDKN1A (codifica p21) e CDKN2A (p16 codifica INK4A), sono stati upregulated. Altri mRNA (EDN1 e ANKRD1) sono stati inclusi e sono stati precedentemente dimostrato di essere maggiore nelle cellule senescenti 15. Primer sono elencati nella Tabella 1.

Figura 1
Figura 1: Proliferating e senescenti fibroblasti. Una rappresentazione schematica del proliferanti (a sinistra) e fibroblasti senescenti (a destra). Esempi di induttori senescenza sono mostrati in yescatola llow. Senescenza è associata a livelli elevati di marcatori indicati. SA-β-gal, l'attività β-galattosidasi senescenza associata; SASP, senescenza associata secretoria fenotipo; SAHF, senescenza associata eterocromatina foci; DDR, la risposta al danno del DNA. Si prega di cliccare qui per vedere una versione più grande di questa figura

figura 2
Figura 2. Caratteristiche morfologiche ed aumento dell'attività SA-β-gal delle cellule senescenti. WI-38 cellule, sia proliferando "giovane" (PDL 27), senescente replicativo (PDL 40), o di quelli esposti a radiazioni ionizzanti (IR), sono state macchiate per l'attività SA-β-gal. IMR-90 cellule, sia proliferanti "giovane" (PDL 30), senescente replicativo (PDL 52), o quelli esposti a radiazione (IR) ionizzanti, sono stained per l'attività SA-β-gal. Le sezioni 1-2 descrivono indurre replicativa e danni al DNA indotti senescenza, e la sezione 3 spiega colorazione per SA-β-gal. Le cellule sono state colorate 7 d dopo IR. Con, il controllo. bar scala = 50 pm. Si prega di cliccare qui per vedere una versione più grande di questa figura.

Figura 3
Figura 3. Aumento γ-H2AX foci in cellule senescenti. WI-38 cellule, sia proliferanti "giovane" (PDL 30) o senescente replicativo (PDL 53), sono state fissate e colorate con anticorpi anti-gamma-H2AX e DAPI. Si noti l'aumento del numero di γ-H2AX foci in cellule senescenti. Le immagini sono state ottenute su un microscopio confocale. Z-sezioni sono state prese, e la sporgenza massima intensità è stato utilizzato per ottenere un'immagine aereo singolo per visualizzare tutti detecfoci da tavolo. bar scala = 20 um. Si prega di cliccare qui per vedere una versione più grande di questa figura.

Figura 4
Figura 4. colorazione fluorescente di SAHF in cellule senescenti. (A) Proliferating WI-38 cellule (PDL 27) erano trattati o esposti a radiazioni ionizzanti (IR). Dopo 10 giorni, le cellule sono state colorate con DAPI per visualizzare SAHF (nota densa / puntata colorazione DAPI in cellule IR-trattati) (B) IDH4 sono state coltivate in presenza di desametasone (proliferazione) o carbone-spogliato FBS per indurre senescenza ( senescente). Dopo 10 d, le cellule sono state colorate con anticorpi contro H3K9Me2 e DAPI. Le immagini sono state ottenute su un microscopio confocale. Z-sezioni sono state prese, e la sporgenza massima intensità è stato utilizzato per ottenere un unico pianoImmagine. proliferativi (A) e (B) hanno diffuso colorazione DAPI, mentre le cellule senescenti hanno puntata colorazione DAPI. In (B), cellule di controllo hanno diffuso, colorazione molto leggera per H3K9Me2, considerando H3K9Me2 colorazione è più robusto e colocalizza con foci DAPI tinto in cellule senescenti. bar scala = 20 um. Si prega di cliccare qui per vedere una versione più grande di questa figura.

Figura 5
Figura 5. Quantificazione di proteine senescenza associati. La proteina è stata isolata da entrambi proliferanti "giovane" (PDL 30) IMR-90 cellule (-) o IMR-90 cellule che sono stati esposti a 10 Gy di radiazioni ionizzanti (IR). Il mezzo era cambiato ogni 48 ore e le cellule sono state lisate 7 d dopo IR. I campioni sono stati analizzati mediante SDS-PAGE, immunoblotting con anti-p16 INK4a Antibostampi, e ri-sondato con anticorpi anti-p21 e quindi gli anticorpi anti-p53. GAPDH è stato utilizzato come controllo proteina carico. Si prega di cliccare qui per vedere una versione più grande di questa figura.

Figura 6
Figura 6. Quantificazione di mRNA senescenza-associati e SASP proteine. (A) RNA è stato isolato da entrambi proliferanti "giovane" (PDL 27 o 34) le cellule WI-38 - cellule o WI-38 che sono stati esposti a 10 Gy di radiazioni ionizzanti (IR) (). Il mezzo è stato cambiato ogni 48 ore e isolamento dell'RNA è stata effettuata 7 d dopo IR. RT-qPCR stato usato per quantificare i livelli di mRNA senescenza associati indicate utilizzando i primer gene-specifici elencati nella Tabella 1. Livelli 18S sono stati utilizzati per la normalizzazione. Gli istogrammi rappresentano la media normalizzata to ± SEM greggia da 5 esperimenti indipendenti. (B) cellule WI-38 (PDL 26) sono stati esposti a 10 Gy di IR; 10 d dopo, il terreno è stato cambiato in mezzo privo di siero (vedere Sezione 7). Dopo 24 h, mezzo condizionato è stato raccolto ed i livelli di IL-6, IL-8, e GROα sono stati quantificati usando saggi ELISA. L'istogramma rappresenta la media ± SEM di 3 esperimenti. * P <0,05 e *** p <0,001 per il test t di Student. Si prega di cliccare qui per vedere una versione più grande di questa figura.

Primer umani Inoltrare Inverso
18S CCCTATCAACTTTCGATGGTAGTCG CCAATGGATCCTCGTTAAAGGATTT
ANKRD1 AGT AGA GGA ACT GGT CACTGG TGG GCT AGA AGT GTCTTC AGA T
CDKN1A (p21) GAC ACCACT GGA GGG TGA CT CAGGTC CAC ATG GTC TTC CT
CDKN2A (p16) CCAACGCACCGAATAGTTACG GCGCTGCCCATCATCATG
CSF2 (GM-CSF) GGCCCCTTGACCATGATG TCTGGGTTGCACAGGAAGTTT
CXCL1 GAAAGCTTGCCTCAATCCTG CACCAGTGAGCTTCCTCCTC
CXCL2 AACTGCGCTGCCAGTGCT CCCATTCTTGAGTGTGGCTA
EDN1 CAG CAGTCT TAG GCG CTG AG ACTCTT TAT CCA TCA GGG ACG AG
IL-6 CCGGGAACGAAAGAGAAGCT GCGCTTGTGGAGAAGGAGTT
IL7 CTCCAGTTGCGGTCATCATG GAGGAAGTCCAAAGATATACCTAAAAGAA
IL8 CTTTCCACCCCAAATTTATCAAAG CAGACAGAGCTCTCTTCCATCAGA

Tabella 1: RT-qPCR Primer per mRNA senescenza-associati. primer in avanti e indietro per la RT-qPCR utilizzando la tecnologia SYBR-verde sono indicati.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Qui, abbiamo descritto metodi per replicativo e danno del DNA senescenza indotta utilizzando fibroblasti diploidi umane. Inoltre, le tecniche di quantificazione delle proteine ​​e livelli di mRNA di varie proteine ​​senescenza associate sono inclusi, così come colorazione per SA-β-gal e per il marcatore DNA-danneggiamento γ-H2AX. Questi protocolli possono essere ampiamente utilizzati per valutare fenotipi senescenti sia in vitro che in vivo, sebbene esistano molti avvertimenti per la caratterizzazione in vivo senescenza 20. Altre cellule possono esprimere marcatori senescenti, anche se non sono cellule senescenti. Ad esempio, cellule, come osteoclasti e macrofagi hanno livelli elevati di attività β-gal 32, 33. Inoltre, molte cellule tumorali si sono upregulated p16 INK4a 34. Le cellule possono anche accumulare danni al DNA (ad esempio, γ-H2AX foci) e non essere senescenti. fattori SASP possono anche essere upregulated davarie fisiologiche normali o patologici che possono o non possono coinvolgere cellule senescenti. Pertanto, più marcatori di senescenza dovrebbero essere utilizzati, soprattutto per la valutazione in vivo senescenza.

Sebbene le cellule senescenti sono stati trovati essere aumentato in tessuti normali invecchiamento più di 20 anni fa 4, solo ora che siamo pienamente apprezzare la pletora di ruoli che le cellule senescenti svolgono sia normale omeostasi tissutale e in condizioni patologiche. Il recente impiego di modelli murini di eliminare p16 INK4a -positive cellule senescenti ha permesso ai ricercatori di meglio apprezzare e precisamente il ruolo delle cellule senescenti in tessuti ed organi 35, 36, 37. Questi modelli hanno scoperto che le cellule senescenti contribuiscono ad una moltitudine di patologie legate all'età, tumorigenesi, e la durata del mouse 35 </ sup>, 36, 37. Alla luce di queste recenti scoperte e la validazione dell'importanza delle cellule senescenti in fisiologia, i tempi sono maturi per ulteriori ricerche su queste cellule specifiche. Ad esempio, gli studi che impiegano strategie per rimuovere terapeuticamente cellule senescenti o ritardare la senescenza potrebbe essere vantaggioso per entrambi gli studi Healthspan e durata della vita.

Recentemente, il nostro laboratorio trovato che la metformina, un farmaco comunemente usato per trattare il diabete di tipo 2, diminuisce senescenza cellulare 38. Poiché la metformina è attualmente in fase di proposta come terapia anti-invecchiamento e ha proprietà anti-cancro 39, 40, sarà interessante in futuro per esplorare se questo farmaco, o di altri interventi di invecchiamento, influenzano i risultati di salute modulando la senescenza cellulare.

I protocolli di cui discutiamo qui sono comuni e ampiamente untecniche ccepted per valutare il fenotipo senescente. Per le cellule coltivate in vitro, è fondamentale per monitorare le variazioni cellulari da un mandrino simile ad una morfologia appiattita in modo da garantire che le cellule sono senescente (vedi figure 1 e 2). Se le cellule non sono positive per SA-β-gal o altri marcatori descritti qui, valutare senescenza alle più alte PDL cella (ad senescenza replicativa) o in un tempo maggiore dopo danno al DNA indotto senescenza. Inoltre, può essere necessario ottimizzati per diversi tipi di cellule questi protocolli. Per valutare i livelli di proteina SASP, è fondamentale per rimuovere il siero dal mezzo cellulare, ciò causerebbe livelli elevati di riferimento nelle ELISA o saggi proteici. Pertanto, tenere questo in mente quando si progettano gli esperimenti, in quanto non può essere ideale per valutare contemporaneamente più marcatori.

Colorazione per SA-β-gal, come descritto qui, è limitata dal fatto che essa richiede la fissazione delle cellule.Inoltre, confluenza cellulare ha dimostrato di influenzare l'attività SA-β-gal. Protocolli sono stati sviluppati per valutare l'attività SA-β-Gal utilizzando un substrato fluorogenico per l'attività β-gal, che consente la quantificazione di questo marcatore in cellule vive usando citometria di flusso 41, 42, 43. Attività SA-β-gal può anche essere misurata in lisati cellulari utilizzando un metodo chemiluminescente 44. Inoltre, γ-H2AX può anche essere misurata con vari altri metodi, tra cui citofluorimetria o l'immunoblotting di lisati cellulari 45.

Va osservato che la formazione SAHF è linea cellulare dipendente ed è principalmente associato con oncogene-induceva senescenza 20, 30, 46. Pertanto, SAHF non può essere presente in tutti i modelli di senescenza. L'utilità diSAHF come marcatore senescente in modelli murini può anche essere limitata dal fatto che SAHF non è generalmente osservata in topo cellule senescenti 30, 46, 47. Qui, anticorpi contro H3K9Me2 stati usati, ma altri marcatori molecolari di SAHF possono essere utilizzati, inclusi macroH2A, alta mobilità gruppo A (HMGA) proteine, e tri-metilata lisina 9 istone H3 (H3K9Me3) e proteine ​​HP1 legati. Inoltre, immunoprecipitazione della cromatina possono essere utilizzati per valutare segni istoni o sezione cromatina proteine ​​di legame per E2F geni bersaglio.

Uno dovrebbe essere consapevole che esistono varie limitazioni per caratterizzare senescenza, compresi eterogeneità per i marcatori e il fatto che questi marcatori non sono espresse esclusivamente in cellule senescenti. Multipla (in generale, 2 - 3) gli indicatori dovrebbero essere impiegati per valutare la senescenza, tra cui i marcatori non descritte qui. Ad esempio, DNA-SCARS, telomerosegnalazione danni e / o danno al DNA può anche essere quantificato. Inoltre, come senescenza e, in particolare, il fenotipo SASP, è stato recentemente dimostrato di essere influenzato dal fattore di stress o danno specifico che induce senescenza 11, 12, 13, è importante valutare marcatori multipli in ogni paradigma sperimentale.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Gli autori non hanno nulla da rivelare.

Acknowledgments

Questo studio è stato sostenuto dal programma di ricerca intramurale del National Institutes of Health, National Institute on Aging. Gli autori desiderano ringraziare Myriam Gorospe e Kotb Abdelmohsen per molte discussioni utili su senescenza e Kotb Abdelmohsen per anche criticamente la lettura del manoscritto. Ringraziamo anche i nostri membri di laboratorio, in particolare Douglas Dluzen per la lettura critica del manoscritto.

Materials

Name Company Catalog Number Comments
16% Tris-glycine gels Invitrogen XP00160BOX
Acid-Phenol ChCl3 Ambion AM9720
Alexa-Fluor 568 goat anti-mouse antibody Invitrogen A11031 1:300 dilution
Cell lifters Corning Inc. 3008 Cell scraper
ECL anti-mouse HRP linked antibody Amersham NA931V
ECL Plus Western Blotting Substrate Pierce 32132 ECL
DAPI Molecular Probes MP01306 stock 5 mg/mL in dH2O
GAPDH antibody Santa Cruz sc-32233 1:1,000 - 5,000 dilution
GlycoBlue Ambion AM9515
Histone H3 dimethyl K9 monoclonal antibody Abcam 1220 1:500 dilution
Human IL-6 Quantikine ELISA assay R&D systems D6050
Human IL-8 Quantikine ELISA assay R&D systems D8000C
Human GROa Quantikine ELISA assay R&D systems DRG00
N-N-dimethylformamide  Sigma D4551 DMF
p16 monoclonal antibody BD Biosciences 51-1325gr 1:500 dilution
p21 monoclonal antibody Millipore 05-345 1:750 dilution
p53 monoclonal antibody Santa Cruz sc-126 1:500 dilution clone DO-1
phospho-H2AX (Ser139) FITC conjugate antibody Cell Signaling 9719 1:2,000 dilution
POWER SYBR-green PCR master mix  Applied Biosystems 4367659
Pre-stained molecular weight markers Biorad 161-0374
ProLong Gold Antifade  Invitrogen P36930
PVDF membrane  Thermo Scientific 88518
Senescence β-Galactosidase Staining Kit Cell Signaling 9860
TRIzol Ambion/Life Tech 10296028

DOWNLOAD MATERIALS LIST

References

  1. Hayflick, L. The Limited in Vitro Lifetime of Human Diploid Cell Strains. Exp Cell Res. 37, 614-636 (1965).
  2. van Deursen, J. M. The role of senescent cells in ageing. Nature. 509, (7501), 439-446 (2014).
  3. Campisi, J., d'Adda di Fagagna, F. Cellular senescence: when bad things happen to good cells. Nat Rev Mol Cell Biol. 8, (9), 729-740 (2007).
  4. Dimri, G., et al. A biomarker that identifies senescent human cells in culture and in aging skin in vivo. Proc Natl Acad Sci U S A. 92, 9363-9367 (1995).
  5. Kuilman, T., Michaloglou, C., Mooi, W. J., Peeper, D. S. The essence of senescence. Genes Dev. 24, (22), 2463-2479 (2010).
  6. Pospelova, T. V., et al. Pseudo-DNA damage response in senescent cells. Cell Cycle. 8, (24), 4112-4118 (2009).
  7. Narita, M., et al. Rb-mediated heterochromatin formation and silencing of E2F target genes during cellular senescence. Cell. 113, (6), 703-716 (2003).
  8. Ben-Porath, I., Weinberg, R. A. The signals and pathways activating cellular senescence. Int J Biochem Cell Biol. 37, (5), 961-976 (2005).
  9. Campisi, J. Senescent cells, tumor suppression, and organismal aging: good citizens, bad neighbors. Cell. 120, (4), 513-522 (2005).
  10. Coppe, J. P., et al. Senescence-associated secretory phenotypes reveal cell-nonautonomous functions of oncogenic RAS and the p53 tumor suppressor. PLoS Biol. 6, (12), 2853-2868 (2008).
  11. Tominaga-Yamanaka, K., et al. NF90 coordinately represses the senescence-associated secretory phenotype. Aging (Albany NY). 4, (10), 695-708 (2012).
  12. Wiley, C. D., et al. Mitochondrial Dysfunction Induces Senescence with a Distinct Secretory Phenotype. Cell Metab. 23, (2), 303-314 (2016).
  13. Hoare, M., et al. NOTCH1 mediates a switch between two distinct secretomes during senescence. Nat Cell Biol. 18, (9), 979-992 (2016).
  14. Rodier, F. Detection of the senescence-associated secretory phenotype (SASP). Methods Mol Biol. 965, 165-173 (2013).
  15. Srikantan, S., Marasa, B. S., Becker, K. G., Gorospe, M., Abdelmohsen, K. Paradoxical microRNAs: individual gene repressors, global translation enhancers. Cell Cycle. 10, (5), 751-759 (2011).
  16. Abdelmohsen, K., Gorospe, M. Noncoding RNA control of cellular senescence. Wiley Interdisciplinary Reviews: RNA. (2015).
  17. Bhaumik, D., et al. MicroRNAs miR-146a/b negatively modulate the senescence-associated inflammatory mediators IL-6 and IL-8. Aging. 1, (4), 402-411 (2009).
  18. Rodier, F., et al. DNA-SCARS: distinct nuclear structures that sustain damage-induced senescence growth arrest and inflammatory cytokine secretion. J Cell Sci. 124, (PT 1), 68-81 (2011).
  19. Bernardes de Jesus, B., Blasco, M. A. Assessing cell and organ senescence biomarkers. Circ Res. 111, (1), 97-109 (2012).
  20. Sharpless, N. E., Sherr, C. J. Forging a signature of in vivo senescence. Nat Rev Cancer. 15, (7), 397-408 (2015).
  21. Rubio, M. A., Kim, S. -H., Campisi, J. Reversible Manipulation of Telomerase Expression and Telomere Length: implications for the ionizing radiation response and replicative senescence of human cells. J Biol Chem. 277, (32), 28609-28617 (2002).
  22. Chen, Q. M., Prowse, K. R., Tu, V. C., Purdom, S., Linskens, M. H. K. Uncoupling the Senescent Phenotype from Telomere Shortening in Hydrogen Peroxide-Treated Fibroblasts. Experimental Cell Research. 265, (2), 294-303 (2001).
  23. Dumont, P., et al. Induction of replicative senescence biomarkers by sublethal oxidative stresses in normal human fibroblast. Free Radic Biol Med. 28, (3), 361-373 (2000).
  24. Roninson, I. B. Tumor Cell Senescence in Cancer Treatment. Cancer Research. 63, (11), 2705-2715 (2003).
  25. Nyunoya, T., et al. Cigarette Smoke Induces Cellular Senescence. J Respir Cell Mol Biol. 35, (6), 681-688 (2006).
  26. Bai, H., Gao, Y., Hoyle, D. L., Cheng, T., Wang, Z. Z. Suppression of Transforming Growth Factor-β Signaling Delays Cellular Senescence and Preserves the Function of Endothelial Cells Derived From Human Pluripotent Stem Cells. Stem Cells Transl Med. (2016).
  27. Senturk, S., et al. Transforming growth factor-beta induces senescence in hepatocellular carcinoma cells and inhibits tumor growth. Hepatology. 52, (3), 966-974 (2010).
  28. Aird, K. M., Zhang, R. Detection of senescence-associated heterochromatin foci (SAHF). Methods Mol Biol. 965, 185-196 (2013).
  29. Pospelova, T. V., Chitikova, Z. V., Pospelov, V. A. An integrated approach for monitoring cell senescence. Methods Mol Biol. 965, 383-408 (2013).
  30. Di Micco, R., et al. Interplay between oncogene-induced DNA damage response and heterochromatin in senescence and cancer. Nat Cell Biol. 13, (3), 292-302 (2011).
  31. Wright, W. E., Pereira-Smith, O. M., Shay, J. W. Reversible cellular senescence: implications for immortalization of normal human diploid fibroblasts. Mol Cell Biol. 9, (7), 3088-3092 (1989).
  32. Bursuker, I., Rhodes, J. M., Goldman, R. Beta-galactosidase--an indicator of the maturational stage of mouse and human mononuclear phagocytes. J Cell Physiol. 112, (3), 385-390 (1982).
  33. Kopp, H. G., Hooper, A. T., Shmelkov, S. V., Rafii, S. Beta-galactosidase staining on bone marrow. The osteoclast pitfall. Histol Histopathol. 22, (9), 971-976 (2007).
  34. Witkiewicz, A. K., Knudsen, K. E., Dicker, A. P., Knudsen, E. S. The meaning of p16(ink4a) expression in tumors: functional significance, clinical associations and future developments. Cell Cycle. 10, (15), 2497-2503 (2011).
  35. Baker, D. J., et al. Naturally occurring p16(Ink4a)-positive cells shorten healthy lifespan. Nature. 530, (7589), 184-189 (2016).
  36. Baker, D. J., et al. Clearance of p16Ink4a-positive senescent cells delays ageing-associated disorders. Nature. 479, (7372), 232-236 (2011).
  37. Demaria, M., et al. An Essential Role for Senescent Cells in Optimal Wound Healing through Secretion of PDGF-AA. Dev Cell. 31, (6), 722-733 (2014).
  38. Noren Hooten, N., et al. Metformin-mediated increase in DICER1 regulates microRNA expression and cellular senescence. Aging Cell. 15, (3), 572-581 (2016).
  39. Barzilai, N., Crandall, J. P., Kritchevsky, S. B., Espeland, M. A. Metformin as a Tool to Target Aging. Cell Metab. 23, (6), 1060-1065 (2016).
  40. Foretz, M., Guigas, B., Bertrand, L., Pollak, M., Viollet, B. Metformin: from mechanisms of action to therapies. Cell Metab. 20, (6), 953-966 (2014).
  41. Cahu, J., Sola, B. A sensitive method to quantify senescent cancer cells. J Vis Exp. (78), (2013).
  42. Debacq-Chainiaux, F., Erusalimsky, J. D., Campisi, J., Toussaint, O. Protocols to detect senescence-associated beta-galactosidase (SA-betagal) activity, a biomarker of senescent cells in culture and in vivo. Nat Protoc. 4, (12), 1798-1806 (2009).
  43. Noppe, G., et al. Rapid flow cytometric method for measuring senescence associated beta-galactosidase activity in human fibroblasts. Cytometry A. 75, (11), 910-916 (2009).
  44. Bassaneze, V., Miyakawa, A. A., Krieger, J. E. Chemiluminescent detection of senescence-associated beta galactosidase. Methods Mol Biol. 965, 157-163 (2013).
  45. Redon, C. E., et al. gamma-H2AX detection in peripheral blood lymphocytes, splenocytes, bone marrow, xenografts, and skin. Methods Mol Biol. 682, 249-270 (2011).
  46. Kosar, M., et al. Senescence-associated heterochromatin foci are dispensable for cellular senescence, occur in a cell type- and insult-dependent manner and follow expression of p16(ink4a). Cell Cycle. 10, (3), 457-468 (2011).
  47. Kennedy, A. L., et al. Senescent mouse cells fail to overtly regulate the HIRA histone chaperone and do not form robust Senescence Associated Heterochromatin Foci. Cell Div. 5, 16 (2010).
Le tecniche per indurre e Quantificare cellulare senescenza
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Noren Hooten, N., Evans, M. K. Techniques to Induce and Quantify Cellular Senescence. J. Vis. Exp. (123), e55533, doi:10.3791/55533 (2017).More

Noren Hooten, N., Evans, M. K. Techniques to Induce and Quantify Cellular Senescence. J. Vis. Exp. (123), e55533, doi:10.3791/55533 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter