Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biology

Técnicas para induzir e quantificar Cellular Senescence

doi: 10.3791/55533 Published: May 1, 2017

Summary

A senescência celular, o estado irreversível de paragem do ciclo celular, pode ser induzida por vários stresses celulares. Aqui, descrevemos os protocolos para induzir a senescência e métodos celular para avaliar marcadores de senescência.

Abstract

Em resposta ao stress celular ou dano, as células em proliferação podem induzir um programa específico que inicia um estado de paragem do ciclo celular a longo prazo, denominado senescência celular. A acumulação de células senescentes ocorre com o envelhecimento do organismo e por meio de cultura contínua in vitro. As células senescentes influenciam diversos processos biológicos, incluindo o desenvolvimento embrionário, reparação e regeneração de tecidos, supressão de tumores, e o envelhecimento. Características das células senescentes incluem, mas não estão limitados a, um aumento da actividade β-galactosidase associada à senescência (SA-β-gal); p16 ink4a, p53, e p21 níveis; níveis mais elevados de danos no ADN, incluindo γ-H2AX; a formação de senesccia associada Heterocromatina Focos (SAHF); e a aquisição de um associado com a senescência secretora Fenótipo (SASP), um fenómeno caracterizado pela secreção de um número de citocinas pró-inflamatórias e as moléculas de sinalização. Aqui, descrevemos os protocolos tanto para replicativo esenescência danificam o ADN induzida em células de cultura. Além disso, podemos destacar as técnicas de controlo do fenótipo senescente utilizando vários marcadores associada com a senescência, incluindo SA-β-gal, γ-H2AX e coloração SAHF, e para quantificar os níveis de proteína e ARNm de reguladores do ciclo celular e factores de SASP. Estes métodos podem ser aplicados para a avaliação da senescência em vários modelos e tecidos.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Mais de meio século atrás, Hayflick e colegas descreveram como células não transformadas proliferar em cultura, mas apenas por um período limitado de tempo 1. cultura de longo prazo de fibroblastos humanos causado as células para parar a proliferar; no entanto, eles foram metabolicamente ativo, e este foi chamado senescência celular. Senescência pode ser benéfica para inibir tumorigênese, mas também pode ser prejudicial, como é pensado para contribuir para a perda de capacidade de regeneração que ocorre com o envelhecimento 2, 3. As células senescentes foram mostrados a acumular-se em tecidos como os seres humanos 4 anos de idade e têm sido implicadas num certo número de processos biológicos, incluindo o desenvolvimento embrionário, a cicatrização de feridas, reparação de tecidos, e inflamação relacionada com a idade 2.

passagem contínua de células em cultura induz a senescência replicativa, que tem sido associadapara telômero atrito e instabilidade genômica. Várias tensões de células, incluindo danos no DNA e oncogenes, pode também causar a senescência 3. Senescência causada por outros que o atrito dos telómeros factores é muitas vezes chamado induzida pelo stress ou senescência prematura e geralmente depende da INK4A p16 / Rb via da 5. Embora a proliferação, as células não transformadas geralmente aparecem eixo em forma, as células senescentes pode ser identificado como tendo certas características, incluindo um, grande morfologia plana e aumento da actividade β-galactosidase associada à senescência (SA-β-gal) (Figuras 1 e 2). As células senescentes também acumular marcadores de dano de ADN, incluindo γ-H2AX (Figura 3) 6, e, potencialmente, associada à senescência heterocromatina focos (SAHF) (Figura 4) 7. As células senescentes tem níveis mais elevados de reguladores do ciclo celular, incluindo p 16 (INK4A p16) e / ou p21 e p53 (Figura 5) 8, 9. Além disso, dados recentes têm mostrado que as células senescentes pode ter efeitos não autónomos através da secreção de uma série de citoquinas pró-inflamatórias e quimiocinas chamado o associada à senescência secretora fenótipo (SASP) 10. Embora este fenómeno SASP pode variar de tipo de célula para tipo de célula, em geral, é demonstrado por um aumento da interleucina-6 (IL-6), IL-8, factor de estimulação de colónias de granulócitos-macrófagos (GM-CSF), growth- α regulado oncogene (GRO-α), e GRO-β, entre outros (Figura 6). O esforço particular ou danos que induz senescência também pode influenciar o fenótipo secretor 11, 12, 13. SASP pode ser detectada através da medição dos níveis de proteínas segregadas utilizando ELISA ou matrizes de citoquinas / proteínass = "xref"> 10, 14. Apesar de mecanismos de pós-transcricional pode regular os níveis de proteína SASP 11, 15, 16, 17, as alterações nos níveis de ARNm pode também ser detectada em muitos casos. Estas alterações são, geralmente, mais sensível e mais fácil de quantificar do que as medições de nível de proteína. Outros marcadores senescentes também pode ser avaliada, incluindo danos no DNA focos nuclear persistente, chamados segmentos de ADN com alterações na cromatina de reforço senescência (ADN-CICATRIZES) 18, e vários outros marcadores de 3, 19, 20.

Aqui, nós descrevemos técnicas comuns para induzir a senescência em células em cultura e também para a medição de vários marcadores de senescência, incluindo SA-β-Gal, γ-H2AX, SAHF, e a proteína e ARNm de senescemoléculas dno-associado.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Indução replicativa Senescence

  1. De baixa passagem fibroblastos diplóides humanos descongelamento (por exemplo, WI-38 e células IMR-90) ou outras linhas celulares.
    NOTA: Aqui, foram utilizados fibroblastos diplóides humanos, mas estes protocolos podem ser utilizados para avaliar a senescência em outros tipos de células, tais como endoteliais, epiteliais, ou células estaminais mesenquimais. As condições de cultura podem ser optimizados para os diferentes tipos celulares utilizadas devido a diferentes taxas de crescimento ou de condições de crescimento.
    NOTA: As células devem ser proliferação e têm uma morfologia de eixo (ver Figura 1 para uma representação esquemática e a Figura 2 para exemplos). Idealmente, as células devem ter uma duplicação da população Nível (PDL) de <30 no início de experimentos para evitar que possíveis células senescentes replicativo.
    1. Calcular o PDL das células usando a seguinte equação PDL = log (N f / N 0) / log 2, onde N é o número f de células final e <em> N 0 é o número inicial de células semeadas 21.
  2. Culturas WI-38 em células de Dulbecco Modified Eagle Médium (DMEM) suplementado com 10% de Soro Fetal Bovino (FBS), 1% de aminoácidos não essenciais, e 1% de penicilina / estreptomicina.
  3. Cresça IMR-90 células em DMEM suplementado com 10% FBS e 1% de penicilina / estreptomicina.
  4. Todas as células crescer a 37 ° C e 5% de CO 2. Continuamente crescer as células e dividir cada 2-4 d quando as células atingem ~ 70 - 80% de confluência. Monitorar confluência celular utilizando um microscópio de luz. Evitar as células com maior confluência, como esta pode afectar o crescimento celular, devido ao contacto de inibição.
  5. Monitorizar as células sob um microscópio de luz para a aparência morfológica de células senescentes (ver Figuras 1 e 2) e para quando não houver alteração no PDL de uma subcultura para a próxima.

2. ADN senesccia induzida por danos

    (por exemplo, WI-38, células IMR-90, ou um outro tipo de célula), a uma densidade escasso (isto é, ~ 300.000 células / disco de 6 cm) em um prato adequado para o tipo de análise (ou seja, uma placa de 6 cm para proteína / marcadores de ARN ou de um prato de 6 poços para a coloração SA-β-gal). Utilização células precoce de passagem que são novos e em proliferação (<30 PDL) e a placa-los de modo que as células são cerca de 50-60% confluentes no dia seguinte.
  1. Remover o meio de crescimento, utilizando uma pipeta de vidro, ligado a um vácuo e lava-se as células por adição de solução salina 1x com fosfato (PBS). Repetir esta etapa para um total de duas lavagens. Adicionar uma camada fina de PBS (~ 750 mL para um disco de 6 cm) tanto para uma condição "simulado" tratado e para uma radiação ionizante (RI) tratadas.
  2. Usar um irradiador gama de expor as células a uma dose única de 10 Gray (Gy) de IR; esta é uma exposição típico para a maioria das linhas celulares. Em um capuz, remover o PBS e substituí-lo por meio de crescimento. Em alternativa, tratar as células com bleomycin a 20 ug / mL durante 2 h.
  3. Mudar o meio sobre as células a cada 48 -7 2 ​​h e dividir as células se necessário.
  4. Monitorizar as células sob um microscópio de luz para as alterações morfológicas (ver Figura 1 para uma representação esquemática e a Figura 2 para imagens de células representativas) e o ensaio para os marcadores senescentes 7-10 d após o tratamento IV.
    NOTA: Este protocolo descreve a senesccia induzida por IR. Senescência também pode ser induzida por outros stresses, incluindo bleomicina (ver acima para as condições), H 2 O 2 a 22, 23, 24, fármacos quimioterapêuticos fumo do cigarro 25, factor de crescimento transformante (TGF) -β1 26, 27, e 21 outros métodos , 28, 29.

3. Coloração CelLS para a senescência-associado β-Galactosidase

  1. Antes da coloração, examinar as células sob um microscópio de luz para monitorar as alterações morfológicas.
    NOTA: senescentes células são tipicamente alargada e plana, ao contrário das células em proliferação, que têm uma morfologia do fuso (Ver Figura 1 para uma representação esquemática e a Figura 2 para obter resultados representativos). As células em proliferação podem ser utilizados como um controlo negativo, e as células tratadas com IR ou outro agente danificador de ADN (ver secção 2) podem ser utilizadas como controlos positivos.
  2. Quantificar a actividade SA-β-gal utilizando reagentes de um kit comercial (ver a Tabela Materiais). Descongelar todos os reagentes e trazê-los à temperatura ambiente, aquecendo-os até 37 ° C.
    1. Calcular a quantidade de solução de coloração e solução fixadora necessário.
      NOTA: Tipicamente, um volume de 1 ml é suficiente para um poço numa placa de 6 poços. tamanhos diferentes de placas pode ser utilizado, mas um tamanho de placa de 6 poços é WELl-adequada para executar um ensaio, em triplicado para cada condição. Esta densidade geralmente proporciona um número suficiente de células por campo de contagem, sem utilizar um número excessivo de células.
    2. Dilui-se a solução de coloração 1:10 com água destilada.
    3. Dilui-se a solução fixadora 1:10 com água destilada.
    4. Adicione-se uma solução 20x estoque de X-gal (5-bromo-4-cloro-3-indolil-β-D-galactopiranósido) em N, N-dimetilformamida (DMF; por exemplo, 20 mg de X-gal em 1 mL de DMF). Para maximizar a utilização do kit, medir a X-gal para o valor necessário para cada ensaio e, em seguida, adicionar a quantidade calculada de DMF para dissolver. Alternativamente, armazenar a solução estoque a -20 ° C em um tubo de luz-protegido durante um mês. Utilizar apenas polipropileno tubos (opaco) para diluir e armazenagem de soluções com X-gal.
    5. Prepare β-gal solução de coloração: 930 uL de solução de coloração 1x, 10 uL de coloração suplemento A, 10 uL de coloração suplemento B, e 50 uL de 20 mg / mL de X-gal em DMF. Faça uma mistura mestre dependendo de quantos poços precisam ser manchada.
  3. remover cuidadosamente o meio a partir das células utilizando uma pipeta de transferência ou o equivalente.
  4. Lavar suavemente as células uma vez com sala de temperatura 1x PBS.
  5. Adicionar 1 ml de solução fixadora 1x a cada poço e incubar durante 10-15 minutos à temperatura ambiente.
  6. Remover a solução de fixador com uma pipeta de transferência.
    NOTA: A solução fixadora (1x) contém 2% de formaldeído e 0,2% de glutaraldeído e deve ser eliminado como um resíduo perigoso de acordo com as recomendações do escritório segurança laboratorial.
  7. Lavar suavemente as células duas vezes com PBS 1x.
  8. Remover o PBS completamente e adicionar solução 1x coloração β-gal às cavidades (1 ml / poço de uma placa de 6 poços). Cobrir a placa completamente com uma folha de alumínio e incuba-se durante 24 - 48 h numa incubadora a 37 ° C (de preferência, na ausência de CO 2, como este pode baixar o pH da solução tampão e afectar coloração).
    1. Verificar as células em 24 h para a coloração, e se a mancha é muito leve, incubar durante mais 24 h.
  9. Após o tempo de incubação, remover a solução β-gal e substituí-la com PBS 1x.
    NOTA: Este passo remove um pouco da cor de fundo quando imagem e também evita derramamento perigosos da solução X-gal.
    NOTA: Elimine a solução de β-gal adequadamente, de acordo com as recomendações do gabinete de segurança do laboratório.
  10. Examinar as células num microscópio de luz, com uma câmara montada utilizando uma objectiva de 10x ou mais elevada; células-SA-β-gal positivo será azul. Adquirir o número desejado de imagens para o experimento. Se a contagem da percentagem de células-SA-β-gal positivos, adquirir o número apropriado de imagens (> 5) para a quantificação por poço. Certifique-se de que as imagens são não-sobreposição de vários campos de visão dentro de cada poço.
  11. Contar o número de SA-β-gal-positivo (azul) células versus o número de células totaispara calcular a percentagem de células-SA-β-gal positivos. Contagem> 100 células por condição.
    NOTA: Representante fotos também pode ser usado para números. Note-se que a confluência celular é crítica, se as células de contagem, como muitas células tornam difícil diferenciar cada célula e muito poucos não pode dar um número suficiente de células para a quantificação e estatísticas. Pictures para figuras para publicação estão na melhor resolução, se salvos como arquivos .tiff, embora .jpeg também são adequados. imagens a cores devem ser de 300 dpi.

4. As células de coloração para γ-H2AX

  1. Placa as células a partir de secções 1 ou 2 em lamelas de vidro em uma placa de 24 poços.
  2. No dia seguinte, lava-se as células com PBS 1x. Lavar cuidadosamente, como células senescentes não aderem bem a lamelas e pode ser facilmente removido durante a lavagem. Em alternativa, fixar directamente as culas, sem lavagem.
  3. Remover o PBS e fixar as células com formaldeído preparado de fresco 3,7% em PBS durante10 min à TA.
  4. Remover a solução e permeabilizar as células com 0,2% de Triton X-100 em PBS durante 10 min.
  5. Remover a solução e bloco em 5% de FBS em PBS durante 2 h à TA.
  6. Incubar com anticorpo anti-fosfo-H2AX γ (Ser139) e conjugado FITC em 5% de FBS / PBS durante 2 h a 37 ° C ou O / N a 4 ° C. Proteger da luz.
  7. Lavar 3 - 6x com PBS a 37 ° C para um total de 30 - 60 min.
  8. Mancha com DAPI (diluído 1: 15000 em PBS) durante 10 min à TA.
  9. Lavar 3x com PBS.
  10. lavar rapidamente com água para remover os sais e montar a lamela numa lâmina de vidro usando 3 - 5 uL de antifade reagente. Em alternativa, usar uma solução de montagem contendo DAPI.
  11. Deixe que ó seco / N e visualizar as células coradas num microscópio de fluorescência ou confocal utilizando uma objectiva de 63X ou superior.
  12. Quantificar os focos γ-H2AX usando um dos dois métodos descritos abaixo. Pontuação para qualquer um dos protocolos de olho usando um microscópio fluorescente. Idealmente, nósea microscópio confocal. Tome Z-secções e condensam-se em um plano único, a fim de visualizar todos os focos detectável (imagens representativas para a coloração γ-H2AX em células em proliferação e senescentes são mostrados na Figura 3). Contagem dos focos de olho usando software de imagem; em geral, ~ 100 - 200 núcleos são suficientes para contagem.
    1. Para quantificar a percentagem de células que têm focos-γ-H2AX positivo, contar cada célula que tem pelo menos um foco visível e dividir pelo número total de núcleos corados DAPI.
    2. Para quantificar o número de focos γ-H2AX, conte os focos γ-H2AX por célula.
      NOTA: Os níveis de γ-H2AX pode variar dependendo do factor de stress ou dano específico que induzida senescência.

5. As células de coloração para marcadores SAHF

NOTA: células senescentes Humanos, muitas vezes, têm regiões nucleares de ADN condensado / cromatina. Em células senescentes, estas regiões heterocromáticasPensa-se que inibem a expressão de genes de promoção da proliferação, tais como os membros da famia E2F. SAHF pode ser visualizado pela reorganização do DAPI; pela presença de marcas de histonas associada a heterocromatina, incluindo a di- e tri-metilação de Lys9 em Histona H3 (H3K9Me2 e H3K9Me3); e por proteínas de reorganização da cromatina, incluindo HP1 proteína heterocromatina 1 (HP1), HIRA (histona repressor de A), e ASF1a (anti-silenciamento função-1a) a cromatina 30. Optamos por utilizar um modelo de senescência induzida pelo oncogene (OIS), como SAHF é mais proeminente em modelos OIS 30. Células IDH4 proliferar na presença de dexametasona, devido à presença do antigénio T grande de SV40, mas tornam-se senescentes após a remoção da dexametasona a partir do meio 31. SAHF pode ser detectado por coloração com DAPI e por coloração com anticorpos contra os marcadores específicos listados acima. Aqui, descrevemos DAPI e H3K9Me2 coloração para o visualizatião de SAHF em células 28.

  1. Cultivar células IDH4 em DMEM suplementado com 10% FBS, 1% de penicilina / estreptomicina, e 1 ug / ml de dexametasona. Para induzir a senescência, remover a dexametasona e mudar a forma de modo a que ele contém FBS separado com carvão activado; após um crescimento de ~ 10 dias neste novo meio, as células tornam-se senescentes IDH4 31.
  2. células IDH4 placa ou células de secções 1 ou 2, descrito acima, em lamelas de vidro em uma placa de 24 poços.
  3. No dia seguinte, lava-se as células com PBS 1x. Lavar cuidadosamente, como células senescentes não aderem bem a lamelas e pode ser facilmente removido durante a lavagem. Alternativamente, as células fixar directamente sem lavagem.
  4. Remover o PBS e fixar as células com formaldeído preparado de fresco 3,7% em PBS durante 10 min à TA.
  5. Lavam-se as células 3 vezes com PBS 1x.
  6. Remover a solução e permeabilizar as células com 0,2% de Triton X-100 em PBS durante 5 min.
  7. Lavam-se as células com 1xPBS. Remover o PBS e bloquear as lamelas pela adição de tampão de bloqueio que continha 3% de BSA (w / v) em PBS durante 5 min à TA. Sempre filtrar soluções contendo BSA antes da utilização para remover a matéria particulada.
  8. Remover o tampão de bloqueamento e incubar as células com anticorpos primários contra marcadores SAHF tais como anticorpos anti-H3KMe2 (Figura 4; ver a Tabela Materiais para detalhes). Dilui-se a anticorpos em tamp de bloqueio e incubar durante 1 - 2 h à TA.
  9. Remover a solução de anticorpo primário e lava-se as lamelas 3 vezes com 1% (v / v) de Triton X-100 em PBS.
  10. Diluir os anticorpos secundários em tampão de bloqueio (Tabela Materiais) e incubar durante 1 h à TA. Proteger da luz.
  11. Lavar as células duas vezes com PBS 1x. Mancha com DAPI (diluído 1: 15000 em PBS; ver a Tabela Materiais) durante 10 min à TA.
  12. Lavam-se as lamelas 3 vezes com PBS 1x.
    1. lavar rapidamente com água para remover os sais de umnd montar cada lamela sobre uma lâmina de vidro usando 3 - 5 uL de antifade reagente. Em alternativa, usar uma solução de montagem contendo DAPI.
    2. Deixar secar O / N e visualizar as células coradas num microscópio de fluorescência ou confocal utilizando uma objectiva 63X ou superior (ver os resultados representativos na Figura 4). Quantificar o SAHF conforme descrito na Seção 4.
      NOTA: Os anticorpos primários de controlo de isotipo ou sem anticorpo primário (isto é secundário sozinho) deve ser usado como um controlo negativo para a coloração por imunofluorescência.

6. Análise de Proteínas A senescência-associados por imunotransferência

NOTA: O fenótipo senescente é caracterizada pela sobre-regulação de reguladores do ciclo celular, incluindo INK4A p16, p21, e p53. Este protocolo irá descrever a quantificação dos níveis destas proteínas nos lisados ​​celulares. Estas técnicas podem ser usadas para avaliar a senesccia induzida pelo uso de uma variedade deMétodos 21, 28, 29.

  1. Induzir a senescência celular, tal como descrito nas secções 1 e 2 ou por outro método, 21, 28, 29. Para analisar marcadores de senescência celular, a chapa células em placas de 6 cm e analisar ambos a proteína e o ARN simultaneamente (ver Secção 7 para instruções de isolamento de ARN).
  2. Remover o meio de cultura celular. Coloque as células em uma bandeja de gelo.
    1. Lavam-se as células 2 vezes com PBS frio 1x. Inclinar o prato para assegurar que todo o PBS é aspirado, de modo a ser tão precisa em termos dos volumes utilizados para o procedimento.
    2. Após aspiração da última lavagem de PBS, adiciona-se 200 uL de PBS frio 1x (para um disco de 6 cm) para o prato. Raspar as culas utilizando um raspador de células.
    3. Pipetar a mistura de células / PBS para um tubo livre de ARNase para o isolamento de ARN. Tome cerca de 150 &# 181; L desta mistura e pipeta-o para um novo tubo. Esta alíquota irá ser utilizado para análise de proteínas, para ter certeza de pipetar a mesma quantidade de cada tubo.
  3. Lisar as células por adição de 75-100 ul de tampão de amostra de 2x Laemmli modificado (Tris-HCl 60 mM, pH 6,8, 12,5% de glicerol, 2% de SDS, 5% β-mercaptoetanol (BME), e azul de bromofenol; pode ser constituído pelos um grande lote, dividido em alíquotas e armazenado a -20 ° C até à utilização) ou um tampão de amostra equivalente.
    1. Alternativamente, lisar as células em 75-100 pL de tamp de lise e centrifugar a 15000 xg durante 10 min a 4 ° C para remover os restos celulares. Remover o sobrenadante e pipeta para um tubo limpo. Um ensaio de proteínas de Bradford ou um ensaio de proteína equivalente pode ser usado no lisados ​​para assegurar o carregamento igual de protea.
      NOTA: Os ensaios de proteína não pode ser realizada em amostras submetidas a lise em tampão de amostra.
    2. Retire ~ 25? L de lisado e adicioná-lo a 15 uL de tampão de amostra 2x. Pipeta cima e fazerwn no tampão de amostra para lisar as células.
      NOTA: Os volumes de tampão de lise tampão de amostra ou pode ser ajustada de acordo com confluência celular. Se a amostra é "pegajosos" devido à lise nuclear, adicionar mais tampão de amostra ou PBS para diluir. As amostras podem ser armazenadas a -20 ° C até à sua utilização.
  4. Ferver as amostras durante 5 min a 95 ° C num bloco de aquecimento (ou equipamento equivalente) e carga de ~ 40 ul de amostra foram lisadas em tampão de amostra sobre um gel de Tris-Glicina a 18%.
    NOTA: Um gel de gradiente (4-15%) ou um gel de Tris-Glicina a 14% são também suficientes para a detecção de proteínas de baixo peso molecular. Diferentes tipos de geles de acrilamida pode também ser utilizado, mas assegurar que os géis e sistema são adequados para a detecção de proteínas de baixo peso molecular.
    1. Executado usando tampão de corrida 1x a uma temperatura constante de 100 V durante 20 min (através do gel de empilhamento) e ~ 60 min a 180 V. Monitorar o gel de modo a frente de corante apenas fora ou é executado na parte inferior do gel de modo a que a de baixo peso molecular proteínas de peso não fazer run fora do gel.
  5. Transferir o gel de acrilamida para uma membrana de PVDF (pré-molhados com 100% de metanol para activar). Se a fazer uma transferência molhado, apenas 1 h é necessária para a transferência (versus o normal, ~ 1,75 h). Ajustar em conformidade para o sistema de transferência apropriado; utilizando marcadores de peso molecular pré-corados podem auxiliar na avaliação da eficiência de transferência.
  6. Lava-se a membrana em água. Usar um corante de Ponceau para monitorizar a carga igual das amostras. Lava-se a Ponceau com água.
    1. Bloquear a membrana em leite seco a 5% não gordo em TBST (Tris-HCl 50 mM pH 7,5, NaCl 150 mM e 0,1% de Tween-20) durante 1 h à TA ou O / N a 4 ° C com agitação.
  7. Lavagem blot uma vez com TBST e incubar com anticorpo primário diluído em TBST 5% de leite (ver a Tabela Materiais para as diluições e recomendações de anticorpo) durante 1 h à TA.
  8. Executar duas lavagens rápidas com TBST e, em seguida, lavar duas vezes num agitador durante total de ~ 30 min (~ 15 min cada erah).
  9. Incubar com um anticorpo secundário por 40 minutos à temperatura ambiente. Repita o passo 6.10.
  10. Incubar com substrato de Western blot, acabado de fazer e desenvolver o filme ou ler num leitor de quimioluminescência.
  11. Imunotransferência sonda com anticorpos ink4a p16 primeiros (Figura 5). Tira da membrana por incubação durante 15 min com água, 15 min com NaOH 0,2 N, e 15 min com água. Continuar com a Etapa 6.9, utilizando anticorpos anti-p21.
  12. Tira da membrana utilizando Tris-HCl 62,5 mM, pH 6,8 e SDS a 2% com 300 ul de BME recentemente adicionado por 50 mL de solução de extracção.
  13. Incubar a 50 ° C durante 30 min e lava-se extensivamente com TBS e, em seguida, TBST. Sonda com anticorpos anti-actina ou anti-GAPDH para controlos proteína de carregamento (Figura 5 mostra resultados representativos).
    NOTA: Os níveis de p53 pode também ser avaliada nas mesmas membranas. No entanto, uma vez que o p53 é um peso molecular mais elevado, que é melhor resolvido sobre um gel de menor percentagem (por exemplo,

7. Analisar os níveis de mRNA da senescência Marcadores

NOTA: Quando isolamento de ARN, assegurar que as superfícies de trabalho são limpos com soluções de remoção de RNase ou um equivalente e que os materiais são todos isenta de RNase.

  1. Utilizando a mistura de células / PBS a partir do Passo 4.2, adicionar 1 ml de solução de extracção de ARN e vortex durante 30 s (não deve haver aglomerados visíveis ou fragmentos celulares).
  2. Adicionar 200 mL de clorofórmio e agitou-se vigorosamente durante 15 s.
  3. Centrifuga-se a velocidade máxima (> 15.000 x g) durante 15 min a 4 ° C.
  4. Remover ~ 400 ul da camada aquosa de ARN topo e pipeta-lo para um novo tubo de microcentruga.
  5. Adicionar 400 L de isopropanol (1: 1 com o volume total da camada aquosa pipetados na etapa anterior) e 4 mL de precipitant para a camada de ARN.
  6. Centrifugar durante 15-30 minutos à velocidade máxima (> 15.000 x g) e 4 ° C para sedimentar a ARN.
  7. Remover o sobrenadante e adicionar 1 mL de etanol a 75% arrefecido com gelo.
  8. Centrifugar durante 1 minuto à velocidade máxima (> 15.000 x g) e 4 ° C.
  9. Remover o sobrenadante e centrifuga-se durante 1 minuto à velocidade máxima (> 15.000 x g) e 4 ° C.
  10. Pipetar para fora tanto líquido quanto possível e ar seco durante 2 min.
  11. Re-suspender em 10 ul de tampão de ADNase 10x, 85 ul de H2O e 5 ul de DNase 1.
  12. Incubar a 37 ° C durante 30 min.
  13. Adicionar 200 de tamp NT2 (50 mM Tris-HCl pH 7,4, NaCl 150 mM, MgCl 2 1 mM, e 0,05% de Nonidet P-40) e adicionam-se 300 mL da camada inferior de ácido fenol-CHCl 2.
  14. Vortex durante 1 min e centrifuga-se à temperatura ambiente durante 5 minutos à velocidade máxima (> 15.000 x g).
  15. Recolher 250 uL da camada superior de ARN (2 x 125 mL), adicionar 253 ul de acetato de sódio 5,2 M, pH, 625 ul de etanol a 100% arrefecido em gelo, e 5 mL de agente precipitante. Misturar bem e precipitar O / N à temperatura de -20 ° C.
  16. No dia seguinte, a mistura e centrifugação à velocidade máxima (> 15.000 x g) e 4 ° C durante 30 min e desprezar o sobrenadante.
  17. Repita os passos 6,8-6,11.
  18. Re-suspender o sedimento em 12 mL de água isenta de nuclease e armazenar a -80 ° C até à sua utilização.
    NOTA: Outros processos de isolamento de RNA e kits podem ser usadas também.
  19. Realizar a transcrição reversa com hexâmeros aleatórios e transcriptase reversa SSII de acordo com o protocolo do fabricante.
    NOTA: Tendo em conta a baixa quantidade de ARN isolado a partir de células senescentes, o melhor é utilizar todo o ARN (12 ul) para a síntese de transcrição reversa. Alternativamente, o ARN pode ser quantificada utilizando um espectrofotetro, e quantidades iguais de ARN pode ser utilizado para a transcrição reversa.
  20. Analisar os níveis de ARNm utilizando-qPCR em tempo real quantitativo amplific (RT-qPCR)ção e SYBR green PCR master mix com iniciadores especicos para o gene.
    1. Como em uma reacção típica de RT-qPCR, dilui-se a 1:30 de ADNc (em RNase / água isenta de ADNase) e adicionar 3 mL para o tempo real placa de 96 poços para uma melhor precisão de pipetagem. Prepara-se uma mistura principal reacção de frente específico do gene e inverter iniciadores (concentração 2,5 M, adicionam-se 5 ul / reacção), SYBR verde mistura de PCR (6,25 ul / reacção, usar menos do que a recomendação do fabricante), e 5,75 uL de RNase / água isenta de ADNase para um volume de reacção final de 20 ul (17 ul de iniciadores / SYBR verde / água e 3 mL de ADNc).
    2. Realizar amplificação RT-qPCR utilizando uma máquina em tempo real, PCR; siga o protocolo do fabricante.
      NOTA: A lista de humano validado frente e verso iniciadores em tempo real podem ser encontrados na Tabela 1. Estes genes incluem proteas SASP e outros marcadores associados com a senescência e / ou genes. Os resultados representativos de senesccia induzida por IR são mostradas em

8. Quantificação Níveis de Proteína SASP

  1. Induzir a senescência usando secções 1 ou 2 ou por qualquer outro método. Placa as células em 6 ou placas de 10 cm, como descrito acima (~ 250000 células / placa de 6 cm ou ~ 650000 / placa de 10 cm).
  2. Quer com células 10 d tratamento pós-IR ou com células senescentes replicativas (e células de controlo adequadas), lava-se as células três vezes com PBS 1x e adicionar meio isento de soro com antibióticos em um pequeno volume (2,5 mL para 6 cm ou 5 ml para 10 cm).
  3. Incubar durante a noite a 37 ° C e 5% de CO 2 num incubador de cultura de tecido. No dia seguinte, recolher o meio e colocá-lo num tubo cónico em gelo.
  4. Lavam-se as células 2 vezes com PBS e em seguida adicionar 1 ml de tripsina (por um disco de 6 cm). Contar as células utilizando um hemocitómetro para ajustar as concentrações mais tarde de acordo com o número de células.
  5. Centrifugar o meio durante 5 min a 300 x g.
  6. Filter do meio utilizando um filtro de seringa de 0,45? m.
  7. Alíquota a forma e congelamento a -80 ° C até à sua utilização ou ensaio directamente utilizando ELISA ou ensaios equivalentes.
  8. Calcular o número de células de concentração / mL, tendo o número de células / volume total do meio recolhido.
  9. Executar um ensaio apropriado ligado a enzima (ELISA), de acordo com as instruções do fabricante. Ver a Tabela Materiais para kits de ELISA recomendadas para ensaiar para IL-6, IL-8, GROa, e outras citocinas / quimiocinas (Figura 6B).
  10. Para assegurar que os factores que são medidos estão dentro do intervalo linear do kit de ELISA, fazer diluições do meio de células senescentes, em comparação com o meio de células em proliferação. Conta para estas diluições e o volume quando se calcula a quantidade de IL-6. Para adquirir a quantidade de IL-6 segregada por célula por dia, calcular o valor de IL-6 obtido a partir do estojo (em pg) por concentração diluída de células por mL (from passo 7.8).
    NOTA: Outros métodos, tais como matrizes de citocinas, pode ser utilizado para detectar os níveis de proteína SASP e podem ser adequados para o rastreio de um grande número de factores de SASP. Os níveis de proteínas de factores de SASP pode variar de acordo com o tempo após a indução da senescência, o tipo de célula, ou do tipo de senesccia induzida.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

As Figuras 2-6 mostram resultados representativos de colorao SA-β-gal; coloração para γ-H2AX e SAHF; avaliação dos níveis de proteína de INK4A p16, p21, e p53; e o ARNm e os níveis proteicos de moléculas senescentes-associado. O aumento da coloração SA-β-gal ocorre com replicativo e ADN senesccia induzida por danos. Além disso, observe as alterações morfológicas que ocorrem com a senescência. As células tornam-se alargada e plana em relação ao eixo aparência de fibroblastos em proliferação. Para este paradigma experimental, as células foram coradas e ARN / proteína foram isoladas sete d após a exposição ao IV. Resultados mais robustos pode ocorrer por espera mais longo após a exposição IV (isto é, 10 d). Condições precisa ser determinado para cada condição e configuração experimental. Estes resultados são representativos e estes marcadores também podem ser detectados quando senescência é induzida através de outros métodos.

a Figura 6, os nomes de genes estão listados e correspondem a CXCL1 (GRO), CXCL2 (GRO), e QCA 2 (GM-CSF). A regulação positiva dos níveis de ARNm de alguns, mas não todos, dos factores de SASP foram observados depois de senesccia induzida por IR em células WI-38. Outros ARNm associado com a senescência, incluindo CDKN1A (codifica p21) e CDKN2A (codifica p16 INK4A), foram regulados positivamente. Outros ARNm (EDN1 e ANKRD1) também foram incluídos e foram previamente demonstrado ser mais elevada em células senescentes 15. Os iniciadores estão listadas na Tabela 1.

figura 1
Figura 1: Proliferating e senescentes fibroblastos. Uma representação esquemática de proliferar (esquerda) e (direita) fibroblastos senescentes. Exemplos de indutores de senescência são mostrados no voscaixa lLow. Senescência está associada com níveis mais elevados dos marcadores indicados. SA-β-gal, actividade β-galactosidase associada à senescência; SASP, associada à senescência fenótipo secretor; SAHF, associada à senescência focos heterocromatina; DDR, resposta de ADN-danos. Por favor clique aqui para ver uma versão maior desta figura

Figura 2
Figura 2. Características morfológicas e aumento da actividade SA-β-gal das células senescentes. WI-38 células, quer a proliferar "novo" (PDL 27), senescência replicativa (PDL 40), ou os expostos a radiação ionizante (IR), foram coradas por actividade de SA-β-gal. IMR-90 células, quer a proliferar "novo" (PDL 30), senescência replicativa (PDL 52), ou os expostos a radiação ionizante (RI), foram stainada para actividade SA-β-gal. Secções 1-2 descrevem induzir replicativo e ADN senesccia induzida por dano, e Secção 3 explica coloração para SA-β-gal. As células foram coradas 7 d após IR. Con, controle. Escala da barra = 50 m. Por favor clique aqui para ver uma versão maior desta figura.

Figura 3
Figura 3. Aumento γ-H2AX Focos em células senescentes. WI-38 células, quer a proliferar "novo" (PDL 30) ou senescente replicativa (PDL 53), foram fixadas e coradas com anticorpos anti-y-H2AX e DAPI. Notar o aumento no número de focos γ-H2AX em células senescentes. As imagens foram obtidas em um microscópio confocal. Z-secções foram tomadas, e a projecção de intensidade máxima foi usada para obter uma imagem de plano único para visualizar todos detecfocos de mesa. Escala da barra = 20 m. Por favor clique aqui para ver uma versão maior desta figura.

Figura 4
Figura 4. Coloração Fluorescente de SAHF em células senescentes. (A) As células em proliferação WI-38 (PDL 27) não foram tratados ou exposto a radiação ionizante (IR). Após 10 dias, as células foram coradas com DAPI para visualizar SAHF (note ponteada DAPI coloração densa / em células tratadas com IR) (B) IDH4 foram cultivadas na presença de dexametasona (proliferação) ou em FBS separado com carvão activado a induzir a senescência ( senescente). Depois de 10 d, as células foram coradas com anticorpos contra H3K9Me2 e DAPI. As imagens foram obtidas em um microscópio confocal. Z-secções foram tomadas, e a projecção de intensidade máxima foi usada para obter um único planoimagem. Proliferação de células em (A) e (B) têm coloração DAPI difusa, enquanto que as células senescentes tem ponteada coloração DAPI. Em (B), células de controlo têm coloração difusa, muito leve para H3K9Me2, enquanto H3K9Me2 coloração é mais robusto e colocaliza com focos corados com DAPI em células senescentes. Escala da barra = 20 m. Por favor clique aqui para ver uma versão maior desta figura.

Figura 5
Figura 5. A quantificação de proteínas senescência-associados. A proteína foi isolada a partir de qualquer proliferantes "novo" (PDL 30) IMR-90 culas (-) ou células IMR-90 que foram expostas a 10 Gy de radiação ionizante (IR). O meio foi trocado a cada 48 horas e as células foram lisadas após 7 d IR. As amostras foram analisadas por SDS-PAGE, imunotransf com anti-p16 INK4A Antibomorre, e re-sondadas com anti-p21 e, em seguida, anticorpos anti-p53. GAPDH foi usada como um controlo de carga da proteína. Por favor clique aqui para ver uma versão maior desta figura.

Figura 6
Figura 6. A quantificação de ARNm senescência-associados e SASP Proteínas. (A) ARN foi isolado a partir de qualquer proliferantes "novo" (PDL 27 ou 34) de células WI-38 (-) ou WI-38 as células que foram expostas a 10 Gy de radiação ionizante (IR). O meio foi trocado a cada 48 horas e isolamento do ARN foi realizada 7 d após IR. RT-qPCR foi usada para quantificar os níveis de ARNm associado com a senescência indicados utilizando os iniciadores especicos de gene listados na Tabela 1. Níveis 18S foram usados para normalização. Os histogramas representam a média normalizada to ± SEM não tratada a partir de 5 experiências independentes. (B) As células WI-38 (PDL 26) foram expostas a 10 Gy de IR; 10 d mais tarde, o meio foi mudado para meio isento de soro (ver Secção 7). Após 24 h, o meio condicionado foi recolhido e os níveis de IL-6, IL-8, GROa e foram quantificados utilizando ensaios de ELISA. O histograma representa a média ± MEP de 3 experiências. * P <0,05 e *** P <0,001 pelo teste t de Student. Por favor clique aqui para ver uma versão maior desta figura.

Primers humanos progressivo Marcha ré
18S CCCTATCAACTTTCGATGGTAGTCG CCAATGGATCCTCGTTAAAGGATTT
ANKRD1 AGT AGA GGA ACT GGT CACTGG TGG GCT AGA AGT GTCTTC AGA T
CDKN1A (p21) GAC ACCACT GGA GGG TGA CT CAGGTC CAC ATG GTC TTC CT
CDKN2A (p16) CCAACGCACCGAATAGTTACG GCGCTGCCCATCATCATG
QCA 2 (GM-CSF) GGCCCCTTGACCATGATG TCTGGGTTGCACAGGAAGTTT
CXCL1 GAAAGCTTGCCTCAATCCTG CACCAGTGAGCTTCCTCCTC
CXCL2 AACTGCGCTGCCAGTGCT CCCATTCTTGAGTGTGGCTA
EDN1 CAG CAGTCT TAG GCG CTG AG ACTCTT TAT CCA TCA GGG ACG AG
IL6 CCGGGAACGAAAGAGAAGCT GCGCTTGTGGAGAAGGAGTT
IL7 CTCCAGTTGCGGTCATCATG GAGGAAGTCCAAAGATATACCTAAAAGAA
IL8 CTTTCCACCCCAAATTTATCAAAG CAGACAGAGCTCTCTTCCATCAGA

Tabela 1: RT-qPCR Primers para mRNAs senescência-associados. iniciadores directos e inversos para RT-qPCR utilizando tecnologia de SYBR verde são indicados.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Aqui, nós descrevemos métodos para replicativa e a DNA-danos senesccia induzida utilizando fibroblastos diplóides humanos. Além disso, as técnicas para quantificar os níveis de mRNA de várias proteínas associadas com a senescência proteína e estão incluídos, bem como a coloração para SA-β-gal e para a ADN-danos marcador γ-H2AX. Estes protocolos podem ser amplamente utilizada para avaliar os fenótipos senescentes tanto in vitro como in vivo, embora existam muitas advertências para a caracterização in vivo senescência 20. Outras células podem expressar marcadores senescentes, mesmo que eles não são células senescentes. Por exemplo, as células, tais como os osteoclastos e macróf agos têm níveis mais elevados de actividade β-gal 32, 33. Além disso, muitas células cancerosas têm upregulated p16 INK4A 34. As células também podem acumular-se danos no ADN (por exemplo, γ-H2AX focos) e não ser senescente. factores SASP também pode ser regulada positivamente pelavários fisiológico normal ou condições patológicas que podem ou não envolvem células senescentes. Portanto, vários marcadores de senescência devem ser utilizados, especialmente quando se avalia a senescência in vivo.

Embora as células senescentes foram encontrados para ser aumentada em tecidos envelhecimento normal mais de 20 anos atrás 4, é apenas agora que estamos a apreciar plenamente a multiplicidade de papéis que as células senescentes desempenhar tanto na homeostase do tecido normal e em condições patológicas. A recente emprego de modelos de ratinhos para eliminar p16 ink4a células senescentes -positivas permitiu a investigadores mais claramente e precisamente apreciar a função de células senescentes, em tecidos e órgãos 35, 36, 37. Estes modelos têm descoberto que as células senescentes contribuir para uma multidão de patologias relacionadas com a idade, tumorigênese e mouse vida útil 35 </ sup>, 36, 37. Dadas estas recentes descobertas e a validação da importância das células senescentes na fisiologia, o momento é propício para mais pesquisas sobre essas células específicas. Por exemplo, estudos utilizando estratégias para remover terapeuticamente células senescentes ou para atrasar a senesccia poderia ser benéfico para ambos os estudos Healthspan e vida útil.

Recentemente, o nosso laboratório, foi observado que a metformina, uma droga utilizada para o tratamento de diabetes mellitus tipo 2, diminui a senescência celular 38. Como a metformina está actualmente a ser propostos como uma terapia anti-envelhecimento e tem propriedades anti-cancerosas 39, 40, será interessante no futuro para explorar se esta droga, ou outras intervenções envelhecimento, afecta os resultados de saúde através da modulação senescência celular.

Os protocolos que discutimos aqui são comuns e amplamente umaccepted técnicas para avaliar o fenótipo senescente. Para as células cultivadas in vitro, que é crítico para monitorizar as alterações celulares a partir de um fuso semelhante a uma morfologia achatada, a fim de assegurar que as células são senescentes (Ver Figuras 1 e 2). Se as células não são positivas para SA-β-gal ou outros marcadores descritos aqui, avaliar a senescência no PDLs celulares mais elevadas (por senesccia replicativa) ou a um aumento do tempo depois de ADN senesccia induzida por danos. Além disso, esses protocolos pode precisar de ser optimizada para diferentes tipos de células. Para avaliar os níveis de proteína SASP, é crítico para remover o soro a partir do meio celular, como isso vai fazer com que elevados níveis de fundo no ELISA ou matrizes de proteínas. Portanto, manter isso em mente ao projetar experimentos, pois pode não ser ideal para avaliar simultaneamente vários marcadores.

A coloração para SA-β-gal, como descrito aqui, é limitada pelo facto de que ele requer a fixação das células.Além disso, confluência celular foi mostrado para influenciar a actividade SA-β-gal. Protocolos foram desenvolvidas para avaliar a actividade de SA-β-Gal utilizando um substrato fluorogico para a actividade β-gal, o que permite a quantificação do marcador, em células vivas, utilizando citometria de fluxo 41, 42, 43. Actividade SA-β-gal também pode ser medido nos lisados celulares utilizando um método de quimioluminescência 44. Além disso, γ-H2AX também pode ser medida utilizando vários outros métodos, incluindo citometria de fluxo ou a imunotransferência de lisados de células 45.

Deve notar-se que a formação é SAHF linha celular dependente e é geralmente associada com induzida por oncogene senescência 20, 30, 46. Portanto, SAHF pode não estar presente em todos os modelos de senescência. O utilitário deSAHF como um marcador senescentes em modelos de ratinho pode também ser limitada pelo facto de que SAHF geralmente não é observado no rato células senescentes 30, 46, 47. Aqui, foram utilizados anticorpos contra H3K9Me2, mas outros marcadores moleculares de SAHF pode ser utilizado, incluindo macroH2A, grupo de alta mobilidade A (HMGA) proteínas, e tri-metilado lisina 9 histona H3 (H3K9Me3) e proteínas ligadas HP1. Além disso, ensaios de imunoprecipitao da cromatina pode ser utilizada para avaliar sinais de histona ou a associação de proteínas de ligação da cromatina de genes alvo de E2F.

Um deve estar ciente de que existem várias limitações para caracterizar a senescência, incluindo heterogeneidade para os marcadores e o fato de que estes marcadores não são expressos exclusivamente em células senescentes. Múltipla (em geral, 2 - 3) marcadores deve ser empregada para avaliar a senescência, incluindo marcadores não são descritos aqui. Por exemplo, ADN-CICATRIZES, telomeresinalização de danos, e / ou dano de DNA também pode ser quantificado. Além disso, como a senescência e, em particular, o fenótipo de SASP, foi recentemente mostrado para ser afectada pela estressor ou dano específico que induz a senescência 11, 12, 13, é importante para avaliar os vários marcadores em cada paradigma experimental.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Os autores não têm nada a revelar.

Acknowledgments

Este estudo foi apoiado pelo Programa de Pesquisa Intramural dos Institutos Nacionais de Saúde, Instituto Nacional sobre Envelhecimento. Os autores agradecem a Myriam Gorospe e Kotb Abdelmohsen para muitas discussões úteis sobre senescência e Kotb Abdelmohsen para também leitura crítica do manuscrito. Agradecemos também a nossos membros de laboratório, especialmente Douglas Dluzen pela leitura crítica do manuscrito.

Materials

Name Company Catalog Number Comments
16% Tris-glycine gels Invitrogen XP00160BOX
Acid-Phenol ChCl3 Ambion AM9720
Alexa-Fluor 568 goat anti-mouse antibody Invitrogen A11031 1:300 dilution
Cell lifters Corning Inc. 3008 Cell scraper
ECL anti-mouse HRP linked antibody Amersham NA931V
ECL Plus Western Blotting Substrate Pierce 32132 ECL
DAPI Molecular Probes MP01306 stock 5 mg/mL in dH2O
GAPDH antibody Santa Cruz sc-32233 1:1,000 - 5,000 dilution
GlycoBlue Ambion AM9515
Histone H3 dimethyl K9 monoclonal antibody Abcam 1220 1:500 dilution
Human IL-6 Quantikine ELISA assay R&D systems D6050
Human IL-8 Quantikine ELISA assay R&D systems D8000C
Human GROa Quantikine ELISA assay R&D systems DRG00
N-N-dimethylformamide  Sigma D4551 DMF
p16 monoclonal antibody BD Biosciences 51-1325gr 1:500 dilution
p21 monoclonal antibody Millipore 05-345 1:750 dilution
p53 monoclonal antibody Santa Cruz sc-126 1:500 dilution clone DO-1
phospho-H2AX (Ser139) FITC conjugate antibody Cell Signaling 9719 1:2,000 dilution
POWER SYBR-green PCR master mix  Applied Biosystems 4367659
Pre-stained molecular weight markers Biorad 161-0374
ProLong Gold Antifade  Invitrogen P36930
PVDF membrane  Thermo Scientific 88518
Senescence β-Galactosidase Staining Kit Cell Signaling 9860
TRIzol Ambion/Life Tech 10296028

DOWNLOAD MATERIALS LIST

References

  1. Hayflick, L. The Limited in Vitro Lifetime of Human Diploid Cell Strains. Exp Cell Res. 37, 614-636 (1965).
  2. van Deursen, J. M. The role of senescent cells in ageing. Nature. 509, (7501), 439-446 (2014).
  3. Campisi, J., d'Adda di Fagagna, F. Cellular senescence: when bad things happen to good cells. Nat Rev Mol Cell Biol. 8, (9), 729-740 (2007).
  4. Dimri, G., et al. A biomarker that identifies senescent human cells in culture and in aging skin in vivo. Proc Natl Acad Sci U S A. 92, 9363-9367 (1995).
  5. Kuilman, T., Michaloglou, C., Mooi, W. J., Peeper, D. S. The essence of senescence. Genes Dev. 24, (22), 2463-2479 (2010).
  6. Pospelova, T. V., et al. Pseudo-DNA damage response in senescent cells. Cell Cycle. 8, (24), 4112-4118 (2009).
  7. Narita, M., et al. Rb-mediated heterochromatin formation and silencing of E2F target genes during cellular senescence. Cell. 113, (6), 703-716 (2003).
  8. Ben-Porath, I., Weinberg, R. A. The signals and pathways activating cellular senescence. Int J Biochem Cell Biol. 37, (5), 961-976 (2005).
  9. Campisi, J. Senescent cells, tumor suppression, and organismal aging: good citizens, bad neighbors. Cell. 120, (4), 513-522 (2005).
  10. Coppe, J. P., et al. Senescence-associated secretory phenotypes reveal cell-nonautonomous functions of oncogenic RAS and the p53 tumor suppressor. PLoS Biol. 6, (12), 2853-2868 (2008).
  11. Tominaga-Yamanaka, K., et al. NF90 coordinately represses the senescence-associated secretory phenotype. Aging (Albany NY). 4, (10), 695-708 (2012).
  12. Wiley, C. D., et al. Mitochondrial Dysfunction Induces Senescence with a Distinct Secretory Phenotype. Cell Metab. 23, (2), 303-314 (2016).
  13. Hoare, M., et al. NOTCH1 mediates a switch between two distinct secretomes during senescence. Nat Cell Biol. 18, (9), 979-992 (2016).
  14. Rodier, F. Detection of the senescence-associated secretory phenotype (SASP). Methods Mol Biol. 965, 165-173 (2013).
  15. Srikantan, S., Marasa, B. S., Becker, K. G., Gorospe, M., Abdelmohsen, K. Paradoxical microRNAs: individual gene repressors, global translation enhancers. Cell Cycle. 10, (5), 751-759 (2011).
  16. Abdelmohsen, K., Gorospe, M. Noncoding RNA control of cellular senescence. Wiley Interdisciplinary Reviews: RNA. (2015).
  17. Bhaumik, D., et al. MicroRNAs miR-146a/b negatively modulate the senescence-associated inflammatory mediators IL-6 and IL-8. Aging. 1, (4), 402-411 (2009).
  18. Rodier, F., et al. DNA-SCARS: distinct nuclear structures that sustain damage-induced senescence growth arrest and inflammatory cytokine secretion. J Cell Sci. 124, (PT 1), 68-81 (2011).
  19. Bernardes de Jesus, B., Blasco, M. A. Assessing cell and organ senescence biomarkers. Circ Res. 111, (1), 97-109 (2012).
  20. Sharpless, N. E., Sherr, C. J. Forging a signature of in vivo senescence. Nat Rev Cancer. 15, (7), 397-408 (2015).
  21. Rubio, M. A., Kim, S. -H., Campisi, J. Reversible Manipulation of Telomerase Expression and Telomere Length: implications for the ionizing radiation response and replicative senescence of human cells. J Biol Chem. 277, (32), 28609-28617 (2002).
  22. Chen, Q. M., Prowse, K. R., Tu, V. C., Purdom, S., Linskens, M. H. K. Uncoupling the Senescent Phenotype from Telomere Shortening in Hydrogen Peroxide-Treated Fibroblasts. Experimental Cell Research. 265, (2), 294-303 (2001).
  23. Dumont, P., et al. Induction of replicative senescence biomarkers by sublethal oxidative stresses in normal human fibroblast. Free Radic Biol Med. 28, (3), 361-373 (2000).
  24. Roninson, I. B. Tumor Cell Senescence in Cancer Treatment. Cancer Research. 63, (11), 2705-2715 (2003).
  25. Nyunoya, T., et al. Cigarette Smoke Induces Cellular Senescence. J Respir Cell Mol Biol. 35, (6), 681-688 (2006).
  26. Bai, H., Gao, Y., Hoyle, D. L., Cheng, T., Wang, Z. Z. Suppression of Transforming Growth Factor-β Signaling Delays Cellular Senescence and Preserves the Function of Endothelial Cells Derived From Human Pluripotent Stem Cells. Stem Cells Transl Med. (2016).
  27. Senturk, S., et al. Transforming growth factor-beta induces senescence in hepatocellular carcinoma cells and inhibits tumor growth. Hepatology. 52, (3), 966-974 (2010).
  28. Aird, K. M., Zhang, R. Detection of senescence-associated heterochromatin foci (SAHF). Methods Mol Biol. 965, 185-196 (2013).
  29. Pospelova, T. V., Chitikova, Z. V., Pospelov, V. A. An integrated approach for monitoring cell senescence. Methods Mol Biol. 965, 383-408 (2013).
  30. Di Micco, R., et al. Interplay between oncogene-induced DNA damage response and heterochromatin in senescence and cancer. Nat Cell Biol. 13, (3), 292-302 (2011).
  31. Wright, W. E., Pereira-Smith, O. M., Shay, J. W. Reversible cellular senescence: implications for immortalization of normal human diploid fibroblasts. Mol Cell Biol. 9, (7), 3088-3092 (1989).
  32. Bursuker, I., Rhodes, J. M., Goldman, R. Beta-galactosidase--an indicator of the maturational stage of mouse and human mononuclear phagocytes. J Cell Physiol. 112, (3), 385-390 (1982).
  33. Kopp, H. G., Hooper, A. T., Shmelkov, S. V., Rafii, S. Beta-galactosidase staining on bone marrow. The osteoclast pitfall. Histol Histopathol. 22, (9), 971-976 (2007).
  34. Witkiewicz, A. K., Knudsen, K. E., Dicker, A. P., Knudsen, E. S. The meaning of p16(ink4a) expression in tumors: functional significance, clinical associations and future developments. Cell Cycle. 10, (15), 2497-2503 (2011).
  35. Baker, D. J., et al. Naturally occurring p16(Ink4a)-positive cells shorten healthy lifespan. Nature. 530, (7589), 184-189 (2016).
  36. Baker, D. J., et al. Clearance of p16Ink4a-positive senescent cells delays ageing-associated disorders. Nature. 479, (7372), 232-236 (2011).
  37. Demaria, M., et al. An Essential Role for Senescent Cells in Optimal Wound Healing through Secretion of PDGF-AA. Dev Cell. 31, (6), 722-733 (2014).
  38. Noren Hooten, N., et al. Metformin-mediated increase in DICER1 regulates microRNA expression and cellular senescence. Aging Cell. 15, (3), 572-581 (2016).
  39. Barzilai, N., Crandall, J. P., Kritchevsky, S. B., Espeland, M. A. Metformin as a Tool to Target Aging. Cell Metab. 23, (6), 1060-1065 (2016).
  40. Foretz, M., Guigas, B., Bertrand, L., Pollak, M., Viollet, B. Metformin: from mechanisms of action to therapies. Cell Metab. 20, (6), 953-966 (2014).
  41. Cahu, J., Sola, B. A sensitive method to quantify senescent cancer cells. J Vis Exp. (78), (2013).
  42. Debacq-Chainiaux, F., Erusalimsky, J. D., Campisi, J., Toussaint, O. Protocols to detect senescence-associated beta-galactosidase (SA-betagal) activity, a biomarker of senescent cells in culture and in vivo. Nat Protoc. 4, (12), 1798-1806 (2009).
  43. Noppe, G., et al. Rapid flow cytometric method for measuring senescence associated beta-galactosidase activity in human fibroblasts. Cytometry A. 75, (11), 910-916 (2009).
  44. Bassaneze, V., Miyakawa, A. A., Krieger, J. E. Chemiluminescent detection of senescence-associated beta galactosidase. Methods Mol Biol. 965, 157-163 (2013).
  45. Redon, C. E., et al. gamma-H2AX detection in peripheral blood lymphocytes, splenocytes, bone marrow, xenografts, and skin. Methods Mol Biol. 682, 249-270 (2011).
  46. Kosar, M., et al. Senescence-associated heterochromatin foci are dispensable for cellular senescence, occur in a cell type- and insult-dependent manner and follow expression of p16(ink4a). Cell Cycle. 10, (3), 457-468 (2011).
  47. Kennedy, A. L., et al. Senescent mouse cells fail to overtly regulate the HIRA histone chaperone and do not form robust Senescence Associated Heterochromatin Foci. Cell Div. 5, 16 (2010).
Técnicas para induzir e quantificar Cellular Senescence
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Noren Hooten, N., Evans, M. K. Techniques to Induce and Quantify Cellular Senescence. J. Vis. Exp. (123), e55533, doi:10.3791/55533 (2017).More

Noren Hooten, N., Evans, M. K. Techniques to Induce and Quantify Cellular Senescence. J. Vis. Exp. (123), e55533, doi:10.3791/55533 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter