Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biology

Técnicas para inducir la senescencia celular y cuantificar

doi: 10.3791/55533 Published: May 1, 2017

Summary

La senescencia celular, el estado irreversible de la detención del ciclo celular, puede ser inducida por diferentes tipos de estrés celular. A continuación, describimos protocolos para inducir senescencia y métodos celular para evaluar marcadores de senescencia.

Abstract

En respuesta a estrés celular o daño, las células proliferantes pueden inducir un programa específico que inicia un estado de detención del ciclo celular a largo plazo, denominado senescencia celular. La acumulación de células senescentes se produce con el envejecimiento del organismo y por medio de cultivo continuo in vitro. Las células senescentes influyen en muchos procesos biológicos, incluyendo el desarrollo embrionario, la reparación de tejidos y la regeneración, la supresión de tumores, y el envejecimiento. Características de las células senescentes incluyen, pero no se limitan a, aumento de la actividad β-galactosidasa asociada a la senescencia (SA-β-gal); INK4a p16, p53, y p21 niveles; mayores niveles de daño del ADN, incluyendo γ-H2AX; la formación de asociada a senescencia heterocromatina Foci (SAHF); y la adquisición de un fenotipo secretor asociada a la senescencia (SASP), un fenómeno que se caracteriza por la secreción de una serie de citoquinas pro-inflamatorias y moléculas de señalización. A continuación, describimos los protocolos para ambos replicativa ysenescencia daño en el DNA inducida en células cultivadas. Además, destacamos técnicas para controlar el fenotipo senescente utilizando varios marcadores asociados con la senescencia, incluyendo SA-β-gal, γ-H2AX y tinción SAHF, y para cuantificar los niveles de proteína y ARNm de reguladores del ciclo celular y factores de SASP. Estos métodos se pueden aplicar a la evaluación de la senescencia en varios modelos y tejidos.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Hace más de medio siglo, Hayflick y sus colegas describen cómo las células no transformadas proliferen en cultivo, pero sólo durante un periodo finito de tiempo 1. el cultivo a largo plazo de fibroblastos humanos hizo que las células para detener la proliferación; sin embargo, eran metabólicamente activa, y esto fue llamado senescencia celular. La senescencia puede ser beneficioso para la inhibición de la tumorigénesis, pero también puede ser perjudicial, ya que se cree que contribuyen a la pérdida de capacidad de regeneración que se produce con el envejecimiento 2, 3. Las células senescentes se han demostrado que se acumulan en los tejidos como humanos 4 edad y han sido implicados en una serie de procesos biológicos, incluyendo el desarrollo embrionario, la cicatrización de heridas, reparación de tejidos, y la inflamación 2 relacionada con la edad.

passaging continua de las células en cultivo induce senescencia replicativa, que se ha relacionadoa telómero desgaste y la inestabilidad genómica. Diversas tensiones de células, incluyendo daño en el ADN y oncogenes, también pueden causar la senescencia 3. La senescencia causado por factores distintos de desgaste de los telómeros se llama a menudo inducida por el estrés o la senescencia prematura y generalmente depende de la INK4A p16 / Rb ruta de la 5. Aunque la proliferación, las células no transformadas aparecen típicamente husillo en forma, las células senescentes pueden ser identificados como que tiene ciertas características, incluyendo una, gran morfología plana y aumento de la actividad β-galactosidasa asociada a la senescencia (SA-β-gal) (Figuras 1 y 2). Las células senescentes también se acumulan marcadores de daño de ADN, incluyendo γ-H2AX (Figura 3) 6, y, potencialmente, asociada a la senescencia heterocromatina focos (SAHF) (Figura 4) 7. Las células senescentes tienen mayores niveles de los reguladores del ciclo celular, incluyendo p 16 (INK4A p16) y / o p21 y p53 (Figura 5) 8, 9. Además, datos recientes han demostrado que las células senescentes pueden tener efectos no autónomos mediante la secreción de una serie de citocinas y quimiocinas pro-inflamatoria llamada la asociada a la senescencia secretora fenotipo (SASP) 10. Aunque este fenómeno SASP puede variar de tipo celular a tipo celular, en general, se demuestra por un aumento de la interleucina-6 (IL-6), IL-8, factor estimulante de colonias de granulocitos y macrófagos (GM-CSF), crecimiento- α regulado oncogén (GRO-α), y GRO-β, entre otros (Figura 6). El estrés o daño particular que induce la senescencia también pueden influir en el fenotipo secretor 11, 12, 13. SASP puede ser detectado mediante la medición de los niveles de proteínas secretadas utilizando ELISAs o matrices citoquina / proteínas = "xref"> 10, 14. Aunque los mecanismos post-transcripcionales pueden regular los niveles de proteína SASP 11, 15, 16, 17, los cambios en los niveles de mRNA también pueden detectarse en muchos casos. Estos cambios son generalmente más sensibles y más fácil de cuantificar que las mediciones de nivel de proteínas. Otros marcadores senescentes también pueden ser evaluados, incluyendo persistente daño en el ADN focos nucleares, denominados segmentos de ADN con alteraciones de la cromatina de refuerzo senescencia (DNA-cicatrices) 18, y diversos otros marcadores 3, 19, 20.

A continuación, describimos técnicas comunes para la inducción de la senescencia en células en cultivo y también para la medición de varios marcadores de senescencia, incluyendo SA-β-Gal, γ-H2AX, SAHF, y la proteína y ARNm de senescenciamoléculas NCE-asociado.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Inducción de la senescencia replicativa

  1. Fibroblastos diploides humanos bajo paso Descongelar (por ejemplo, WI-38 y IMR-90) u otras líneas celulares.
    NOTA: Aquí, se utilizaron fibroblastos diploides humanos, pero estos protocolos se puede utilizar para evaluar la senescencia en otros tipos de células, tales como endotelial, epitelial, o células madre mesenquimales. condiciones de cultivo pueden ser optimizadas para los diferentes tipos de células utilizados debido a las diferentes tasas de crecimiento o condiciones de crecimiento.
    NOTA: Las células deben estar proliferando y tienen una morfología de husillo (véase la Figura 1 para un esquema y la Figura 2 para los ejemplos). Idealmente, las células deben tener un nivel de duplicación de la población (PDL) de <30 en el inicio de los experimentos para evitar que posibles células senescentes replicativa.
    1. Calcular la PDL de las células utilizando la siguiente ecuación PDL = log (N f / N 0) / log2, donde N f es el número de células final y <em> N 0 es el número inicial de células sembradas 21.
  2. Cultura WI-38 células en de Eagle modificado por Dulbecco (DMEM) suplementado con 10% suero bovino fetal (FBS), 1% de aminoácidos no esenciales, y 1% de penicilina / estreptomicina.
  3. Crecer IMR-90 células en DMEM suplementado con 10% de FBS y 1% de penicilina / estreptomicina.
  4. Crecer todas las células a 37 ° C y 5% CO 2. continuamente crecer las células y dividir cada de 2 - 4 d cuando las células alcanzan ~ 70 - 80% de confluencia. Monitorear la confluencia celular usando un microscopio de luz. Evitar las células con una mayor confluencia, ya que esto puede afectar el crecimiento celular debido al contacto inhibición.
  5. Monitor de las células bajo un microscopio de luz para el aspecto morfológico de las células senescentes (ver las figuras 1 y 2) y para cuando no hay cambio en la PDL de un subcultivo a la siguiente.

2. ADN senescencia inducida por daños

    (por ejemplo, WI-38, IMR-90, u otro tipo de célula) a una densidad escasa (es decir, ~ 300.000 células / placa de 6 cm) en un plato apropiado para el tipo de análisis (es decir, un plato de 6 cm para la proteína / marcadores de ARN o un plato de 6 pocillos para la tinción SA-β-gal). Utilizar células de paso de principios que son jóvenes y proliferación (<30 PDL) y la placa de ellos de modo que las células son aproximadamente 50 - 60% de confluencia en el día siguiente.
  1. Retirar el medio de crecimiento utilizando una pipeta de vidrio conectado a un vacío y se lavan las células mediante la adición de solución salina tamponada con fosfato 1X (PBS). Repita este paso para un total de dos lavados. Añadir una capa delgada de PBS (~ 750 l para un plato de 6 cm) tanto para una condición de "mock" tratado y para una radiación ionizante (IR) tratada.
  2. Use un irradiador gamma para exponer las células a una dosis única de 10 Gray (Gy) de IR; se trata de una exposición típica para la mayoría de las líneas celulares. En una campana, eliminar el PBS y reemplazarlo con medio de crecimiento. Alternativamente, el tratamiento de las células con bleomycin a 20 mg / ml durante 2 h.
  3. Cambiar el medio sobre las células cada 48 -7 2 ​​h y dividir las células si es necesario.
  4. Supervisar las células bajo un microscopio de luz para los cambios morfológicos (véase la Figura 1 para un esquema y la Figura 2 para las imágenes de células representativas) y ensayo para marcadores senescentes 7 - 10 de d después del tratamiento con IR.
    NOTA: Este protocolo describe la senescencia inducida por IR. La senescencia también puede ser inducida por otros factores de estrés, incluyendo bleomicina (ver más arriba para las condiciones), H 2 O 2 22, 23, fármacos quimioterapéuticos 24, el humo del cigarrillo 25, factor de crecimiento transformante (TGF) -β1 26, 27, y otros métodos 21 , 28, 29.

3. La tinción Cells para asociada a senescencia β-galactosidasa

  1. Antes de la tinción, examinar las células bajo un microscopio de luz para monitorear los cambios morfológicos.
    NOTA: senescente células típicamente se agrandan y plana, a diferencia de las células en proliferación, que tienen una morfología de husillo (Véase la Figura 1 para un esquema y la Figura 2 para resultados representativos). Las células proliferantes se pueden utilizar como un control negativo, y las células tratadas con IR u otro agente que daña el ADN (véase la sección 2) se pueden utilizar como controles positivos.
  2. Cuantificar la actividad de SA-β-gal utilizando reactivos de un kit comercial (véase la Tabla de Materiales). Descongelar todos los reactivos y llevarlos a temperatura ambiente por el calentamiento de ellos de hasta 37 ° C.
    1. Calcular la cantidad de solución de tinción y solución de fijación necesario.
      NOTA: Típicamente, un ml de volumen 1 es suficiente para un pocillo de una placa de 6 pocillos. Diferentes tamaños de placas se pueden utilizar, pero un tamaño placa de 6 pocillos es well-adecuado para llevar a cabo un ensayo por triplicado para cada condición. Esta densidad por lo general proporciona un número suficiente de células por campo que contar sin utilizar un exceso de número de células.
    2. Se diluye la solución de tinción 01:10 con agua destilada.
    3. Se diluye la solución de fijación 1:10 con agua destilada.
    4. Preparar una solución 20x social de X-gal (5-bromo-4-cloro-3-indolil-β-D-galactopiranósido) en N, N-dimetilformamida (DMF; por ejemplo, 20 mg de X-gal en 1 ml de DMF). Para maximizar el uso del kit, mida X-gal a la cantidad necesaria para cada ensayo y luego añadir la cantidad calculada de DMF para disolver. Alternativamente, almacenar la solución madre a -20 ° C en un tubo protegido de la luz durante un mes. Utilice tubos solamente de polipropileno (opaco) para diluir y almacenamiento de soluciones de X-gal.
    5. Preparar solución de tinción β-gal: 930 l de solución de tinción 1x, 10 l de tinción suplemento A, 10 l de tinción suplemento B, y 50 l de 20 mg / ml Xgal en DMF. Hacer una mezcla maestra dependiendo del número de pozos que ser manchado.
  3. Retire cuidadosamente el medio de las células usando una pipeta de transferencia o el equivalente.
  4. lavar suavemente las células una vez con temperatura ambiente 1x PBS.
  5. Añadir 1 ml solución de fijación de 1x a cada pocillo y se incuba durante 10 - 15 min a TA.
  6. Retire la solución de fijación con una pipeta de transferencia.
    NOTA: La solución de fijación (1x) contiene 2% de formaldehído y 0,2% de glutaraldehído y debe desecharse como residuo peligroso de acuerdo con las recomendaciones de la oficina de seguridad en el laboratorio.
  7. lavar suavemente las células dos veces con 1x PBS.
  8. Retire el PBS completamente y añadir solución de tinción β-gal 1x a los pocillos (1 ml / pocillo de una placa de 6 pocillos). Cubrir la placa completamente con papel de aluminio y se incuba durante 24 - 48 h en una incubadora a 37 ° (preferiblemente en ausencia de CO 2, ya que esto puede reducir el pH del tampón y afectar tinción).
    1. Compruebe las células a las 24 h para la tinción, y si la mancha es demasiado clara, se incuba durante otras 24 h.
  9. Después del tiempo de incubación, eliminar la solución de β-gal y reemplazarlo con 1x PBS.
    NOTA: Este paso elimina parte del color de fondo cuando las imágenes y también evita derrames peligrosos de la solución X-gal.
    NOTA: Desechar la solución de β-gal adecuadamente, de acuerdo con las recomendaciones de la oficina de seguridad en el laboratorio.
  10. Se examinan las células en un microscopio de luz con una cámara conectada utilizando un objetivo de 10x o superior; células SA-β-gal-positivas serán azul. Adquirir el número deseado de imágenes para el experimento. Si contando el porcentaje de células SA-β-gal-positivas, adquirir el número adecuado de imágenes (> 5) para la cuantificación por pocillo. Asegúrese de que las imágenes no se solapan de varios campos de visión dentro de cada uno así.
  11. Contar el número de SA-β-gal-positivo (azul) células frente al número de células totalespara calcular el porcentaje de células SA-β-gal-positivas. Contar> 100 células por condición.
    NOTA: Representante imágenes también se pueden utilizar para las figuras. Tenga en cuenta que una confluencia celular es fundamental para que las células de conteo, como demasiadas células hacen que sea difícil diferenciar cada célula y demasiado pocos no puede dar un número suficiente de células para la cuantificación y la estadística. Fotos de las cifras de la publicación están en la mejor resolución si se guardan como archivos .tiff, .jpeg aunque también son adecuados. Las imágenes en color deben ser de 300 dpi.

4. Las células de tinción para γ-H2AX

  1. Placa de las células de las secciones 1 o 2 en cubreobjetos de vidrio en una placa de 24 pocillos.
  2. Al día siguiente, se lavan las células con PBS 1x. Enjuague cuidadosamente, ya que las células senescentes no se adhieren bien a cubreobjetos y se pueden quitar fácilmente durante el lavado. Alternativamente, fijar directamente las células sin lavado.
  3. Retire el PBS y fijar las células con recién preparada formaldehído 3,7% en PBS durante10 min a TA.
  4. Eliminar la solución y permeabilizar las células con 0,2% de Triton X-100 en PBS durante 10 min.
  5. Eliminar la solución y el bloque en FBS al 5% en PBS durante 2 h a TA.
  6. Incubar con anti-fosfo γ-H2AX (Ser139) y conjugado FITC en 5% de FBS / PBS durante 2 horas a 37 ° C o O / N a 4 ° C. Proteger de la luz.
  7. Lavar 3 - 6x con PBS a 37 ° C durante un total de 30 - 60 min.
  8. Mancha con DAPI (diluido 1: 15.000 en PBS) durante 10 min a TA.
  9. Lavar 3x con PBS.
  10. lavar rápidamente con agua para eliminar las sales y montar el cubreobjetos en un portaobjetos de vidrio utilizando 3 - 5 l de antifade reactivo. Alternativamente, utilizar una solución de montaje que contiene DAPI.
  11. Deje que se O seco / N y visualizar las células teñidas en un microscopio de fluorescencia o confocal utilizando un objetivo 63X o superior.
  12. Cuantificar los focos γ-H2AX mediante el uso de cualquiera de los dos métodos descritos a continuación. Puntuación para cualquiera de los protocolos por ojo utilizando un microscopio de fluorescencia. Lo ideal sería que nosotros,ea microscopio confocal. Tome secciones Z y se condensan en un solo plano con el fin de visualizar todos los focos detectable (imágenes representativas para la tinción de γ-H2AX en células en proliferación y senescentes se muestra en la Figura 3). Contar los focos por ojo utilizando software de imagen; en general, ~ 100 - 200 núcleos son suficientes para el conteo.
    1. Para cuantificar el porcentaje de células que tienen focos γ-H2AX-positivo, contar cada célula que tiene al menos uno de los focos visibles y se dividen por el número total de núcleos teñidos con DAPI.
    2. Para cuantificar el número de focos γ-H2AX, cuente los focos γ-H2AX por célula.
      NOTA: Los niveles de γ-H2AX pueden variar en función del factor de estrés o daño específico que induce la senectud.

5. Las células de tinción para SAHF marcadores

NOTA: Las células senescentes humanos a menudo tienen regiones nucleares de ADN condensada / cromatina. En las células senescentes, estas regiones heterochromaticse cree que inhiben la expresión de genes de proliferación de promoción, tales como miembros de la familia E2F. SAHF puede ser visualizado por la reorganización de DAPI; por la presencia de marcas de histona heterocromatina asociada, incluyendo los di- y tri-metilación de Lys9 en Histona H3 (H3K9me2 y H3K9me3); y por las proteínas de la cromatina reorganización, incluyendo la proteína heterocromatina HP1 1 (HP1), HIRA (histona represor A), y ASF1a (anti-silenciamiento función-1a) a la cromatina 30. Hemos elegido utilizar un modelo senescencia oncogén inducida (OIS), como SAHF es más prominente en modelos OIS 30. Células IDH4 proliferan en presencia de dexametasona debido a la presencia de antígeno T grande de SV40 pero se vuelven senescentes después de la eliminación de dexametasona a partir del medio 31. SAHF se puede detectar por tinción con DAPI y por tinción con anticuerpos contra los marcadores específicos mencionados anteriormente. A continuación, describimos DAPI y H3K9me2 tinción para la visualization de SAHF en las células 28.

  1. Se cultivan las células IDH4 en DMEM suplementado con 10% de FBS, 1% de penicilina / estreptomicina, y 1 mg / ml de dexametasona. Para inducir la senescencia, retire la dexametasona y cambiar el medio de manera que contiene FBS tratado con carbón vegetal; Después de crecer durante ~ 10 días en este nuevo medio, las células se vuelven senescentes IDH4 31.
  2. células IDH4 placa o células procedentes de las secciones 1 o 2, descritos anteriormente, en cubreobjetos de vidrio en una placa de 24 pocillos.
  3. Al día siguiente, se lavan las células con PBS 1x. Enjuague cuidadosamente, ya que las células senescentes no se adhieren bien a cubreobjetos y se pueden quitar fácilmente durante el lavado. Alternativamente, fijar directamente las células sin lavado.
  4. Retire el PBS y fijar las células con recién preparada formaldehído 3,7% en PBS durante 10 min a TA.
  5. Lavar las células 3 veces con 1x PBS.
  6. Eliminar la solución y permeabilizar las células con 0,2% de Triton X-100 en PBS durante 5 min.
  7. Lavar las células con 1xPBS. Retire el PBS y bloquear los cubreobjetos mediante la adición de tampón de bloqueo que contenía% de BSA 3 (w / v) en PBS durante 5 min a TA. Siempre filtrar soluciones que contienen BSA antes de su uso para eliminar la materia en partículas.
  8. Eliminar el tampón de bloqueo y se incuban las células con anticuerpos primarios contra marcadores SAHF tales como anticuerpos anti-H3KMe2 (Figura 4; véase la Tabla de Materiales para más detalles). Diluir los anticuerpos en tampón de bloqueo y se incuba durante 1 - 2 h a TA.
  9. Retirar la solución de anticuerpo primario y lavar los cubreobjetos 3 veces con 1% (v / v) de Triton X-100 en PBS.
  10. Diluir los anticuerpos secundarios en tampón de bloqueo (Tabla de Materiales) y se incuba durante 1 h a TA. Proteger de la luz.
  11. Lavar las células dos veces con 1x PBS. Mancha con DAPI (diluido 1: 15.000 en PBS; ver la Tabla de Materiales) durante 10 min a RT.
  12. Lavar los cubreobjetos 3 veces con 1x PBS.
    1. lavar rápidamente con agua para eliminar las sales de unand montar cada cubreobjetos sobre un portaobjetos de vidrio utilizando 3 - 5 l de antifade reactivo. Alternativamente, utilizar una solución de montaje que contiene DAPI.
    2. Deje O seco / N y visualizar las células teñidas en un microscopio de fluorescencia o confocal utilizando un objetivo 63X o superior (ver los resultados representativos en la Figura 4). Cuantificar el SAHF como se describe en la Sección 4.
      NOTA: anticuerpos primarios de control de isotipo o sin anticuerpo primario (es decir secundario solo) deben utilizarse como un control negativo para la tinción de inmunofluorescencia.

6. Análisis de proteínas asociadas a la senescencia por inmunotransferencia

NOTA: El fenotipo senescente se caracteriza por la regulación al alza de los reguladores del ciclo celular, incluyendo INK4A p16, p21, y p53. Este protocolo describe la cuantificación de los niveles de estas proteínas en los lisados ​​celulares. Estas técnicas se pueden utilizar para evaluar la senescencia inducida usando una variedad demétodos de 21, 28, 29.

  1. Inducir la senescencia celular como se describe en las secciones 1 y 2 o utilizando otro método de 21, 28, 29. Para analizar marcadores de senescencia celular, la placa de las células en placas de 6 cm y analizar tanto la proteína y el ARN de forma simultánea (véase la Sección 7 para obtener instrucciones de aislamiento de ARN).
  2. Retire el medio de cultivo celular. Poner las células en una bandeja de hielo.
    1. Se lavan las células 2 veces con frío 1x PBS. Incline el plato para asegurar que todo el PBS es aspirado de modo que sea lo más precisa en términos de los volúmenes utilizados para el procedimiento.
    2. Después de aspirar el último lavado de PBS, añadir 200 l de frío 1x PBS (para un plato de 6 cm) al plato. Raspar las células utilizando un raspador de células.
    3. Pipetear la mezcla / PBS de células en un tubo de RNasa libre para el aislamiento de ARN. Tome aproximadamente 150 y# 181; L de esta mezcla y la pipeta en un tubo nuevo. Esta alícuota se utilizó para el análisis de proteínas, así que asegúrese de pipetear la misma cantidad de cada tubo.
  3. Lisar las células mediante la adición de 75 a 100! L de tampón de muestra de 2x Laemmli modificado (Tris-HCl 60 mM pH 6,8, 12,5% de glicerol, 2% SDS, 5% β-mercaptoetanol (BME), y azul de bromofenol; se pueden hacer hasta como un lote grande, se dividió en alícuotas y se almacenó a -20 ° C hasta su uso) o un tampón de muestra equivalente.
    1. Alternativamente, lisar las células en el 75 - 100 l de tampón de lisis y se centrifuga a 15.000 xg durante 10 min a 4 ° C para eliminar los restos celulares. Eliminar el sobrenadante y la pipeta en un tubo limpio. Un ensayo de proteínas de Bradford o un ensayo de proteína equivalente se pueden utilizar en lisados ​​para garantizar la igualdad de la carga de proteína.
      NOTA: los ensayos de proteínas no se pueden realizar en muestras lisadas en tampón de muestra.
    2. Sacar ~ 25 l de lisado y agregarlo a 15! L de tampón de muestra 2x. La pipeta hacia arriba y hacerwn en el tampón de muestra para lisar las células.
      NOTA: Los volúmenes de tampón de lisis o tampón de muestra pueden ajustarse dependiendo de la confluencia celular. Si la muestra es "pegajosa" debido a la lisis nuclear, añadir más tampón de muestra o PBS para diluir. Las muestras se pueden almacenar a -20 ° C hasta su uso.
  4. Hervir las muestras durante 5 min a 95 ° C en un bloque de calor (o equipo equivalente) y la carga ~ 40 l de muestra se lisaron en tampón de muestra en un gel de Tris-glicina al 18%.
    NOTA: un gel de gradiente (4-15%) o un gel de Tris-glicina al 14% también son suficientes para la detección de proteínas de bajo peso molecular. Los diferentes tipos de geles de acrilamida se pueden utilizar también, pero asegurar que los geles y sistema son adecuadas para la detección de proteínas de bajo peso molecular.
    1. Ejecutar utilizando tampón de ejecución 1x a una temperatura constante de 100 V durante 20 min (a través del gel de apilamiento) y ~ 60 min a 180 V. Supervisión de la gel por lo que el frente de colorante sólo se ejecuta fuera o está en el fondo del gel de manera que la baja molecular proteínas de peso no lo hacen rONU fuera del gel.
  5. Transferir el gel de acrilamida a una membrana de PVDF (pre-empapados con 100% de metanol para activar). Si al hacer una transferencia húmeda, sólo se necesita 1 hora para la transferencia (en comparación con el normal de ~ 1,75 h). Ajustar en consecuencia para el sistema de transferencia apropiado; utilizando marcadores de peso molecular teñidos previamente puede ayudar en la evaluación de la eficiencia de transferencia.
  6. Lavar la membrana en agua. Utilice una mancha Ponceau para vigilar para la igualdad de la carga de las muestras. Lavar el Ponceau con agua.
    1. Bloquear la membrana en leche en polvo al 5% sin grasa en TBST (Tris-HCl 50 mM pH 7,5, NaCl 150 mM, y 0,1% de Tween-20) durante 1 h a TA o O / N a 4 ° C con agitación.
  7. Wash borra una vez con TBST y se incuba con el anticuerpo primario diluido en 5% de leche en TBST (véase la Tabla de Materiales para las diluciones y recomendaciones de anticuerpo) durante 1 h a TA.
  8. Realizar dos lavados rápidos con TBST y luego se lava dos veces en un agitador durante total de ~ 30 min (~ 15 min cada uno eramarido).
  9. Incubar con un anticuerpo secundario durante 40 min a RT. Repita el paso 6.10.
  10. Incubar con sustrato de transferencia Western recién hecho y desarrollar la película o leer en un lector de quimioluminiscencia.
  11. Inmunoblot sonda con anticuerpos p16 INK4a primeros (Figura 5). Franja de la membrana por incubación durante 15 min con agua, 15 min con NaOH 0,2 N, y 15 min con agua. Continuar con el paso 6.9 utilizando anticuerpos anti-p21.
  12. Franja de la membrana utilizando Tris-HCL 62,5 mM pH 6,8 y SDS al 2% con 300 l de BME recién añadido por 50 ml de solución de separación.
  13. Incubar a 50 ° C durante 30 min y se lava extensamente con TBS y luego TBST. La sonda con anticuerpos anti-actina o anti-GAPDH para los controles de la proteína de carga (Figura 5 muestra resultados representativos).
    NOTA: los niveles de p53 también pueden ser evaluados en las mismas membranas. Sin embargo, ya que p53 es un peso molecular más alto, es mejor resolvió en un gel de menor porcentaje (por ejemplo,

7. Análisis de los niveles de mRNA de la senescencia marcadores

NOTA: Cuando el aislamiento de ARN, asegurarse de que las superficies de trabajo se limpian con soluciones de eliminación de RNasa o un equivalente y que los materiales son todos libre de RNasa.

  1. Uso de la mezcla / PBS de células de la Etapa 4.2, añadir 1 ml de solución de extracción de RNA y de vórtice durante 30 s (no debe haber grumos visibles o residuos celulares).
  2. Añadir 200! L de cloroformo y agitar enérgicamente durante 15 s.
  3. Centrifugar a velocidad máxima (> 15.000 xg) durante 15 min a 4 ° C.
  4. Retire ~ 400! L de la capa acuosa ARN parte superior y la pipeta en un tubo de microcentrífuga nuevo.
  5. Añadir 400! L de isopropanol (1: 1 con el volumen total de la capa acuosa con pipeta en el paso anterior) y 4 l de precipitant a la capa de ARN.
  6. Centrifugar durante 15-30 min a la velocidad máxima (> 15.000 xg) y 4 ° C para sedimentar el ARN.
  7. Eliminar el sobrenadante y añadir 1 ml de etanol al 75% enfriado con hielo.
  8. Centrifugar durante 1 min a velocidad máxima (> 15.000 xg) y 4 ° C.
  9. Eliminar el sobrenadante y centrifugar durante 1 min a velocidad máxima (> 15.000 xg) y 4 ° C.
  10. Pipetear a cabo tanto líquido como sea posible y aire seco durante 2 min.
  11. Vuelva a suspender en 10 l de 10x tampón de ADNasa, 85 l de H 2 O, y 5 l de DNasa 1.
  12. Incubar a 37 ° C durante 30 min.
  13. Añadir 200 l de tampón NT2 (50 mM Tris-HCl pH 7,4, NaCl 150 mM, MgCl2 1 mM, y 0,05% de Nonidet P-40) y añadir 300 l de la capa inferior de ácido fenol-CHCl 2.
  14. Vortex durante 1 min y se centrifuga a temperatura ambiente durante 5 min a la velocidad máxima (> 15.000 xg).
  15. Recoger 250 l de la capa de RNA superior (2 x 125 l), agregar 25l de sodio 3 M de acetato de pH 5,2, 625 l de etanol al 100% enfriado en hielo, y 5 l de precipitante. Mezclar bien y precipitar O / N a -20 ° C.
  16. Al día siguiente, mezclar y centrifugado a la velocidad máxima (> 15.000 xg) y 4 ° C durante 30 min y se descarta el sobrenadante.
  17. Repita los pasos 6.8 a 6.11.
  18. Vuelva a suspender el precipitado en 12 l de agua libre de nucleasa y se almacena a -80 ° C hasta su uso.
    NOTA: Otros procedimientos de aislamiento de ARN y kits se pueden utilizar también.
  19. Realizar la transcripción inversa con hexámeros aleatorios y transcriptasa inversa SSII de acuerdo con el protocolo del fabricante.
    NOTA: Dada la baja cantidad de ARN aislado de células senescentes, lo mejor es utilizar todo el ARN (12 l) para la síntesis de transcripción inversa. Alternativamente, el ARN se puede cuantificar utilizando un espectrofotómetro, y cantidades iguales de RNA puede ser usado para la transcripción inversa.
  20. Analizar los niveles de mRNA en tiempo real mediante qPCR amplific cuantitativa (RT-qPCR)ación y SYBR verde mezcla maestra de PCR con cebadores específicos de genes.
    1. Como en una típica reacción RT-qPCR, diluir el ADNc de una y media (en RNasa agua / libre de DNasa) y añadir 3 l para el tiempo real de placa de 96 pocillos para una mayor precisión de pipeteo. Preparar una mezcla maestra reacción del gen específico de cebadores directo e inverso (concentración 2,5 M, añadir 5 l / reacción), mezcla de PCR SYBR verde (6,25 l / reacción, el uso de menos de la recomendación del fabricante), y 5,75 l de RNasa / agua libre de DNasa para un volumen final de reacción de 20 l (17 l de cebadores / SYBR verde / agua y 3 l de cDNA).
    2. Realizar la amplificación RT-qPCR utilizando una máquina de PCR en tiempo real; siga el protocolo del fabricante.
      NOTA: Una lista de los validado humana cebadores directo e inverso en tiempo real se puede encontrar en la Tabla 1. Estos genes incluyen proteínas SASP y otros marcadores asociados con la senescencia y / o genes. Los resultados representativos de la senescencia IR inducida se muestran en la

8. Cuantificación de los niveles de proteína SASP

  1. Inducir la senescencia usando secciones 1 o 2 o utilizando otro método. Placa de las células en cualquiera de las placas de 6 o 10 cm, como se describe anteriormente (~ 250.000 células / placa de 6 cm o ~ 650.000 / 10 cm de placa).
  2. Ya sea con células 10 d de tratamiento post-IR o con células senescentes replicativas (y células de control apropiadas), se lavan las células tres veces con 1x PBS y añadir medio libre de suero con antibióticos en un pequeño volumen (2,5 mL para 6 cm o 5 mL por 10 cm).
  3. Incubar durante la noche a 37 ° C y 5% de CO2 en un incubador de cultivo de tejidos. Al día siguiente, recoger el medio y lo puso en un tubo cónico en hielo.
  4. Se lavan las células 2 veces con PBS y después se añade 1 ml de tripsina (para un plato de 6 cm). Contar las células usando un hemocitómetro para ajustar más tarde las concentraciones de acuerdo con el número de células.
  5. Centrifugar el medio durante 5 min a 300 x g.
  6. filter el medio utilizando un filtro de jeringa de 0,45 m.
  7. Alícuota el medio y se congelan a -80 ° C hasta su uso o ensayo directamente usando ELISA o ensayos equivalentes.
  8. Calcular el número de células / ml de concentración mediante la adopción de la célula número / volumen total de medio recogido.
  9. Realizar un ensayo apropiado inmunoabsorbente ligado a enzimas (ELISA) según las instrucciones del fabricante. Ver la Tabla de Materiales para kits de ELISA recomendados para el ensayo de IL-6, IL-8, GRO, y otras citocinas / quimiocinas (Figura 6B).
  10. Para asegurarse de que los factores que se miden están dentro del rango lineal del kit ELISA, hacer diluciones del medio de células senescentes en comparación con el medio de células en proliferación. Cuenta de estas diluciones y el volumen en el cálculo de la cantidad de IL-6. Para adquirir la cantidad de IL-6 secretada por célula por día, calcular el valor de IL-6 obtenido a partir del kit (en pg) por la concentración de células diluida por ml (frpaso om 7,8).
    NOTA: Otros métodos, tales como matrices de citoquinas, se puede utilizar para detectar los niveles de proteína SASP y puede ser adecuado para el cribado de un gran número de factores SASP. Los niveles de proteína de factores SASP pueden variar en función del tiempo después de la inducción de senescencia, el tipo de célula, o el tipo de la senescencia inducida.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Las figuras 2 - 6 muestran resultados representativos de tinción SA-β-gal; tinción de γ-H2AX y SAHF; evaluación de los niveles de proteína de p16 INK4a, p21, y p53; y el ARNm y los niveles de proteína de moléculas-senescentes asociado. Aumento de la tinción SA-β-gal se produce con replicativa y daño en el DNA inducido por senescencia. También, observar los cambios morfológicos que se producen con la senescencia. Las células se agrandan y plana en comparación con la aparición de husillo de los fibroblastos proliferantes. Para este paradigma experimental, las células se tiñeron y ARN / proteína se aislaron 7 d después de la exposición IR. Resultados más robustos se pueden producir por esperar más tiempo después de la exposición IR (es decir, 10 d). Las condiciones deben ser determinados para cada condición y configuración experimental. Estos resultados son representativos y estos marcadores también se pueden detectar cuando la senescencia se induce utilizando otros métodos.

la Figura 6, los nombres de genes se enumeran y se corresponde con CXCL1 (GRO), CXCL2 (GRO), y CSF2 (GM-CSF). Se observaron La regulación por incremento de los niveles de ARNm de algunos, pero no todos, de los factores SASP después de la senescencia inducida por IR en las células WI-38. Otros mRNAs asociados con la senescencia, incluyendo CDKN1A (codifica p21) y CDKN2A (codifica INK4A p16), se upregulated. Otros mRNAs (edn1 y ANKRD1) también se han incluido y han sido previamente demostrado ser mayor en las células senescentes 15. Los cebadores se enumeran en la Tabla 1.

Figura 1
Figura 1: proliferar y senescentes fibroblastos. Una representación esquemática de la proliferación (izquierda) y fibroblastos senescentes (derecha). Ejemplos de inductores de senescencia se muestran en la yellow cuadro. La senescencia se asocia con niveles más altos de los marcadores indicados. SA-β-gal, la actividad β-galactosidasa asociada a la senescencia; SASP, asociada a la senescencia fenotipo secretor; SAHF, asociada a la senescencia focos heterocromatina; DDR, la respuesta de daño de ADN. Haga clic aquí para ver una versión más grande de esta figura

Figura 2
Figura 2. Características morfológicas y una mayor actividad SA-β-gal de las células senescentes. WI-38 células, ya sea en proliferación "joven" (PDL 27), senescente replicativa (PDL 40), o las personas expuestas a la radiación ionizante (IR), se tiñeron para la actividad de SA-β-gal. 90-IMR células, la proliferación de "joven" (PDL 30), senescente replicativa (PDL 52), o las personas expuestas a la radiación ionizante (IR), eran stained para la actividad SA-β-gal. Secciones 1 - 2 describen la inducción de replicativa y daño en el DNA inducido por senescencia, y la Sección 3 explica tinción para SA-β-gal. Las células se tiñeron 7 d después de IR. Con, el control. Barra de escala = 50 m. Haga clic aquí para ver una versión más grande de esta figura.

figura 3
Figura 3. Aumento de la γ-H2AX focos en células senescentes. WI-38 células, la proliferación de "joven" (PDL 30) o senescente replicativa (PDL 53), se fijaron y se tiñeron con anticuerpos anti-gamma-H2AX y DAPI. Tenga en cuenta el aumento en el número de focos γ-H2AX en células senescentes. Las imágenes fueron obtenidas en un microscopio confocal. Se tomaron secciones Z, y la proyección de intensidad máxima se utilizó para obtener una imagen de plano único para visualizar todos DETECfocos de mesa. Barra de escala = 20 m. Haga clic aquí para ver una versión más grande de esta figura.

Figura 4
Figura 4. Tinción fluorescente de SAHF en células senescentes. (A) Proliferación células WI-38 (PDL 27) se dejaron sin tratar o se expone a la radiación ionizante (IR). Después de 10 días, las células se tiñeron con DAPI para visualizar SAHF (nota punteada DAPI tinción densa / en las células tratadas con IR) (B) IDH4 se cultivaron en presencia de dexametasona (proliferación) o en FBS tratado con carbón vegetal para inducir la senescencia ( senescente). Después de 10 d, las células se tiñeron con anticuerpos contra H3K9me2 y DAPI. Las imágenes fueron obtenidas en un microscopio confocal. Se tomaron secciones Z, y la proyección de máxima intensidad se utilizó para obtener un solo planoimagen. Las células proliferantes en (A) y (B) tienen tinción DAPI difusa, mientras que las células senescentes tienen punteada tinción con DAPI. En (B), las células de control tienen tinción difusa, muy ligero para H3K9me2, mientras que H3K9me2 tinción es más robusto y colocaliza con focos DAPI-manchado en células senescentes. Barra de escala = 20 m. Haga clic aquí para ver una versión más grande de esta figura.

Figura 5
Figura 5. La cuantificación de proteínas asociadas a la senescencia. La proteína se aisló a partir de cualquiera de la proliferación de células "joven" (PDL 30) IMR-90 (-) o células IMR-90 que fueron expuestos a 10 Gy de radiación ionizante (IR). El medio se cambió cada 48 h y las células se lisaron 7 d después de IR. Las muestras se analizaron por SDS-PAGE, inmunotransferencia con anti-p16 Antibo INK4Amuere, y re-sondaron con anti-p21 y luego los anticuerpos anti-p53. GAPDH se utilizó como control de carga de proteínas. Haga clic aquí para ver una versión más grande de esta figura.

Figura 6
Figura 6. La cuantificación de los ARNm asociados a la senescencia y la SASP proteínas. (A) Se aisló el ARN de cualquiera de proliferación "joven" (PDL 27 o 34) células WI-38 - células o WI-38 que fueron expuestos a 10 Gy de radiación ionizante (IR) (). El medio se cambió cada 48 h y el aislamiento de ARN se realizó 7 días después de la IR. RT-qPCR se utilizó para cuantificar los niveles de los ARNm asociados con la senescencia indican usando los cebadores específicos de gen enumerados en la Tabla 1. Los niveles de 18S se utilizaron para la normalización. Los histogramas representan la media t normalizadoo ± SEM sin tratar a partir de 5 experimentos independientes. (B) las células WI-38 (PDL 26) se expusieron a 10 Gy de IR; 10 d después, el medio se cambió a medio libre de suero (véase la Sección 7). Después de 24 h, se recogió el medio acondicionado y los niveles de IL-6, IL-8, GRO y se cuantificaron utilizando ensayos ELISA. El histograma representa la media ± SEM de 3 experimentos. * P <0,05 y *** P <0,001 mediante la prueba t de Student. Haga clic aquí para ver una versión más grande de esta figura.

Los cebadores humanos Adelante Marcha atrás
18S CCCTATCAACTTTCGATGGTAGTCG CCAATGGATCCTCGTTAAAGGATTT
ANKRD1 CACTGG AGT AGA GGA ACT GGT TGG TCG AGT AGA AGA T GTCTTC
CDKN1A (p21) GAC ACCACT GGA GGG TGA CT CAGGTC CAC ATG GTC TTC CT
CDKN2A (p16) CCAACGCACCGAATAGTTACG GCGCTGCCCATCATCATG
CSF2 (GM-CSF) GGCCCCTTGACCATGATG TCTGGGTTGCACAGGAAGTTT
CXCL1 GAAAGCTTGCCTCAATCCTG CACCAGTGAGCTTCCTCCTC
CXCL2 AACTGCGCTGCCAGTGCT CCCATTCTTGAGTGTGGCTA
EDN1 CAG CTG CAGTCT TAG GCG AG ACTCTT TAT CCA TCA GGG ACG AG
IL6 CCGGGAACGAAAGAGAAGCT GCGCTTGTGGAGAAGGAGTT
IL7 CTCCAGTTGCGGTCATCATG GAGGAAGTCCAAAGATATACCTAAAAGAA
IL-8 CTTTCCACCCCAAATTTATCAAAG CAGACAGAGCTCTCTTCCATCAGA

Tabla 1: RT-qPCR Los cebadores para los ARNm asociados a la senescencia. cebadores directo e inverso para RT-qPCR utilizando la tecnología SYBR verde se indican.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Aquí, hemos descrito métodos para replicativa y daño de ADN inducido por senescencia utilizando fibroblastos diploides humanos. Además, las técnicas para la cuantificación de proteínas y niveles de ARNm de varias proteínas de la senescencia asociado se incluyen, así como tinción para SA-β-gal y para el marcador de daño de ADN γ-H2AX. Estos protocolos pueden ser ampliamente utilizados para evaluar fenotipos senescentes tanto in vitro como in vivo, aunque existen muchas advertencias para la caracterización de la senescencia en vivo 20. Otras células pueden expresar marcadores senescentes, incluso si no son células senescentes. Por ejemplo, células tales como los osteoclastos y los macrófagos tienen niveles más altos de actividad β-gal 32, 33. Además, muchas células cancerosas se han upregulated p16 INK4A 34. Las células también se pueden acumular daño en el ADN (por ejemplo, γ-H2AX focos) y no ser senescentes. SASP factores también pueden ser regulados al alza pordiversos fisiológico normal o condiciones patológicas que pueden o no pueden implicar células senescentes. Por lo tanto, múltiples marcadores de senescencia deben ser utilizados, especialmente cuando la evaluación de la senescencia en vivo.

Aunque se encontraron células senescentes que aumentarse en los tejidos normales de envejecimiento hace más de 20 años 4, es sólo ahora que estamos apreciando completamente la gran cantidad de papeles que juegan las células senescentes tanto en la homeostasis del tejido normal y en condiciones patológicas. El reciente empleo de modelos de ratón para eliminar p16 INK4a células senescentes positivas ha permitido a los investigadores a apreciar con mayor claridad y precisión el papel de las células senescentes en tejidos y órganos 35, 36, 37. Estos modelos han descubierto que las células senescentes contribuyen a una multitud de patologías relacionadas con la edad, la tumorigénesis, y la vida útil del ratón 35 </ sup>, 36, 37. Teniendo en cuenta estos descubrimientos recientes y la validación de la importancia de las células senescentes en la fisiología, ha llegado el momento de realizar más investigaciones sobre estas células específicas. Por ejemplo, los estudios que emplean estrategias para eliminar terapéuticamente células senescentes o para retrasar la senescencia podría ser beneficioso para ambos estudios Healthspan y vida útil.

Recientemente, nuestro laboratorio encontró que la metformina, un fármaco comúnmente utilizado para tratar la diabetes mellitus tipo 2, disminuye la senescencia celular 38. Como actualmente se está propuesto metformina como una terapia anti-envejecimiento y tiene propiedades anti-cáncer 39, 40, que será interesante en el futuro para explorar si este fármaco, u otras intervenciones envejecimiento, afectan a los resultados de salud mediante la modulación de la senescencia celular.

Los protocolos que se discuten aquí son comunes y ampliamente unatécnicas ccepted para evaluar el fenotipo senescente. Para las células cultivadas in vitro, es crítico para monitorear los cambios celulares a partir de un husillo-como a una morfología aplanada con el fin de asegurar que las células son senescentes (Ver Figuras 1 y 2). Si las células no son positivos para SA-β-gal o otros marcadores que se describen aquí, evaluar la senescencia en PDL celulares superiores (por senescencia replicativa) o en un mayor tiempo después de DNA senescencia daño inducido. Además, estos protocolos pueden necesitar ser optimizada para diferentes tipos de células. Para evaluar los niveles de proteína SASP, es crítico para eliminar el suero del medio de células, ya que esto hará que los altos niveles de fondo en el ELISA o matrices de proteínas. Por lo tanto, tenga esto en cuenta en el diseño de experimentos, ya que puede no ser ideal para evaluar simultáneamente múltiples marcadores.

La tinción para SA-β-gal, tal como se describe aquí, está limitado por el hecho de que requiere la fijación de las células.Además, la confluencia celular se ha demostrado que influyen en la actividad de SA-β-gal. Se han desarrollado protocolos para evaluar la actividad SA-β-Gal usando un sustrato fluorogénico para la actividad β-gal, lo que permite la cuantificación de este marcador en células vivas mediante citometría de flujo 41, 42, 43. Actividad SA-β-gal también se puede medir en los lisados celulares usando un método quimioluminiscente 44. Además, γ-H2AX también se puede medir usando varios otros métodos, incluyendo citometría de flujo o la inmunotransferencia de lisados de células 45.

Cabe señalar que la formación de SAHF es la línea celular dependiente y se asocia principalmente con oncogén inducida por senescencia 20, 30, 46. Por lo tanto, SAHF no puede estar presente en todos los modelos de senescencia. La utilidad deSAHF como un marcador de senescencia en modelos de ratón también puede estar limitado por el hecho de que SAHF generalmente no se observó en células senescentes ratón 30, 46, 47. Aquí, se utilizaron anticuerpos contra H3K9me2, pero otros marcadores moleculares de SAHF se pueden utilizar, incluyendo las proteínas macroH2A, de alta movilidad grupo A (HMGA), y tri-metilado lisina 9 de la histona H3 (H3K9me3) y las proteínas HP1 encuadernados. Además, ensayos de inmunoprecipitación de cromatina pueden ser utilizados para evaluar marcas de histona o la asociación de la cromatina proteínas de unión a E2F genes diana.

Uno debe ser consciente de que hay varias limitaciones a la caracterización de la senescencia, incluyendo la heterogeneidad de los marcadores y el hecho de que estos marcadores no se expresan exclusivamente en células senescentes. Múltiple (en general, 2 - 3) marcadores deberían emplearse para evaluar la senescencia, incluyendo marcadores no descritos aquí. Por ejemplo, DNA-cicatrices, los telómerosla señalización de daño, y / o daños en el ADN también se puede cuantificar. Además, como la senescencia y, en particular, el fenotipo SASP, recientemente se ha demostrado que ser afectados por el factor de estrés o daño específico que induce senescencia 11, 12, 13, es importante para evaluar múltiples marcadores en cada paradigma experimental.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores no tienen nada que revelar.

Acknowledgments

Este estudio fue apoyado por el Programa de Investigación Intramural de los Institutos Nacionales de Salud, Instituto Nacional sobre el Envejecimiento. Los autores desean agradecer a Myriam Gorospe y Kotb Abdelmohsen útil para muchos debates sobre la senescencia y Kotb Abdelmohsen para también la lectura crítica del manuscrito. Agradecemos también a los miembros de nuestro laboratorio, especialmente Douglas Dluzen para la lectura crítica del manuscrito.

Materials

Name Company Catalog Number Comments
16% Tris-glycine gels Invitrogen XP00160BOX
Acid-Phenol ChCl3 Ambion AM9720
Alexa-Fluor 568 goat anti-mouse antibody Invitrogen A11031 1:300 dilution
Cell lifters Corning Inc. 3008 Cell scraper
ECL anti-mouse HRP linked antibody Amersham NA931V
ECL Plus Western Blotting Substrate Pierce 32132 ECL
DAPI Molecular Probes MP01306 stock 5 mg/mL in dH2O
GAPDH antibody Santa Cruz sc-32233 1:1,000 - 5,000 dilution
GlycoBlue Ambion AM9515
Histone H3 dimethyl K9 monoclonal antibody Abcam 1220 1:500 dilution
Human IL-6 Quantikine ELISA assay R&D systems D6050
Human IL-8 Quantikine ELISA assay R&D systems D8000C
Human GROa Quantikine ELISA assay R&D systems DRG00
N-N-dimethylformamide  Sigma D4551 DMF
p16 monoclonal antibody BD Biosciences 51-1325gr 1:500 dilution
p21 monoclonal antibody Millipore 05-345 1:750 dilution
p53 monoclonal antibody Santa Cruz sc-126 1:500 dilution clone DO-1
phospho-H2AX (Ser139) FITC conjugate antibody Cell Signaling 9719 1:2,000 dilution
POWER SYBR-green PCR master mix  Applied Biosystems 4367659
Pre-stained molecular weight markers Biorad 161-0374
ProLong Gold Antifade  Invitrogen P36930
PVDF membrane  Thermo Scientific 88518
Senescence β-Galactosidase Staining Kit Cell Signaling 9860
TRIzol Ambion/Life Tech 10296028

DOWNLOAD MATERIALS LIST

References

  1. Hayflick, L. The Limited in Vitro Lifetime of Human Diploid Cell Strains. Exp Cell Res. 37, 614-636 (1965).
  2. van Deursen, J. M. The role of senescent cells in ageing. Nature. 509, (7501), 439-446 (2014).
  3. Campisi, J., d'Adda di Fagagna, F. Cellular senescence: when bad things happen to good cells. Nat Rev Mol Cell Biol. 8, (9), 729-740 (2007).
  4. Dimri, G., et al. A biomarker that identifies senescent human cells in culture and in aging skin in vivo. Proc Natl Acad Sci U S A. 92, 9363-9367 (1995).
  5. Kuilman, T., Michaloglou, C., Mooi, W. J., Peeper, D. S. The essence of senescence. Genes Dev. 24, (22), 2463-2479 (2010).
  6. Pospelova, T. V., et al. Pseudo-DNA damage response in senescent cells. Cell Cycle. 8, (24), 4112-4118 (2009).
  7. Narita, M., et al. Rb-mediated heterochromatin formation and silencing of E2F target genes during cellular senescence. Cell. 113, (6), 703-716 (2003).
  8. Ben-Porath, I., Weinberg, R. A. The signals and pathways activating cellular senescence. Int J Biochem Cell Biol. 37, (5), 961-976 (2005).
  9. Campisi, J. Senescent cells, tumor suppression, and organismal aging: good citizens, bad neighbors. Cell. 120, (4), 513-522 (2005).
  10. Coppe, J. P., et al. Senescence-associated secretory phenotypes reveal cell-nonautonomous functions of oncogenic RAS and the p53 tumor suppressor. PLoS Biol. 6, (12), 2853-2868 (2008).
  11. Tominaga-Yamanaka, K., et al. NF90 coordinately represses the senescence-associated secretory phenotype. Aging (Albany NY). 4, (10), 695-708 (2012).
  12. Wiley, C. D., et al. Mitochondrial Dysfunction Induces Senescence with a Distinct Secretory Phenotype. Cell Metab. 23, (2), 303-314 (2016).
  13. Hoare, M., et al. NOTCH1 mediates a switch between two distinct secretomes during senescence. Nat Cell Biol. 18, (9), 979-992 (2016).
  14. Rodier, F. Detection of the senescence-associated secretory phenotype (SASP). Methods Mol Biol. 965, 165-173 (2013).
  15. Srikantan, S., Marasa, B. S., Becker, K. G., Gorospe, M., Abdelmohsen, K. Paradoxical microRNAs: individual gene repressors, global translation enhancers. Cell Cycle. 10, (5), 751-759 (2011).
  16. Abdelmohsen, K., Gorospe, M. Noncoding RNA control of cellular senescence. Wiley Interdisciplinary Reviews: RNA. (2015).
  17. Bhaumik, D., et al. MicroRNAs miR-146a/b negatively modulate the senescence-associated inflammatory mediators IL-6 and IL-8. Aging. 1, (4), 402-411 (2009).
  18. Rodier, F., et al. DNA-SCARS: distinct nuclear structures that sustain damage-induced senescence growth arrest and inflammatory cytokine secretion. J Cell Sci. 124, (PT 1), 68-81 (2011).
  19. Bernardes de Jesus, B., Blasco, M. A. Assessing cell and organ senescence biomarkers. Circ Res. 111, (1), 97-109 (2012).
  20. Sharpless, N. E., Sherr, C. J. Forging a signature of in vivo senescence. Nat Rev Cancer. 15, (7), 397-408 (2015).
  21. Rubio, M. A., Kim, S. -H., Campisi, J. Reversible Manipulation of Telomerase Expression and Telomere Length: implications for the ionizing radiation response and replicative senescence of human cells. J Biol Chem. 277, (32), 28609-28617 (2002).
  22. Chen, Q. M., Prowse, K. R., Tu, V. C., Purdom, S., Linskens, M. H. K. Uncoupling the Senescent Phenotype from Telomere Shortening in Hydrogen Peroxide-Treated Fibroblasts. Experimental Cell Research. 265, (2), 294-303 (2001).
  23. Dumont, P., et al. Induction of replicative senescence biomarkers by sublethal oxidative stresses in normal human fibroblast. Free Radic Biol Med. 28, (3), 361-373 (2000).
  24. Roninson, I. B. Tumor Cell Senescence in Cancer Treatment. Cancer Research. 63, (11), 2705-2715 (2003).
  25. Nyunoya, T., et al. Cigarette Smoke Induces Cellular Senescence. J Respir Cell Mol Biol. 35, (6), 681-688 (2006).
  26. Bai, H., Gao, Y., Hoyle, D. L., Cheng, T., Wang, Z. Z. Suppression of Transforming Growth Factor-β Signaling Delays Cellular Senescence and Preserves the Function of Endothelial Cells Derived From Human Pluripotent Stem Cells. Stem Cells Transl Med. (2016).
  27. Senturk, S., et al. Transforming growth factor-beta induces senescence in hepatocellular carcinoma cells and inhibits tumor growth. Hepatology. 52, (3), 966-974 (2010).
  28. Aird, K. M., Zhang, R. Detection of senescence-associated heterochromatin foci (SAHF). Methods Mol Biol. 965, 185-196 (2013).
  29. Pospelova, T. V., Chitikova, Z. V., Pospelov, V. A. An integrated approach for monitoring cell senescence. Methods Mol Biol. 965, 383-408 (2013).
  30. Di Micco, R., et al. Interplay between oncogene-induced DNA damage response and heterochromatin in senescence and cancer. Nat Cell Biol. 13, (3), 292-302 (2011).
  31. Wright, W. E., Pereira-Smith, O. M., Shay, J. W. Reversible cellular senescence: implications for immortalization of normal human diploid fibroblasts. Mol Cell Biol. 9, (7), 3088-3092 (1989).
  32. Bursuker, I., Rhodes, J. M., Goldman, R. Beta-galactosidase--an indicator of the maturational stage of mouse and human mononuclear phagocytes. J Cell Physiol. 112, (3), 385-390 (1982).
  33. Kopp, H. G., Hooper, A. T., Shmelkov, S. V., Rafii, S. Beta-galactosidase staining on bone marrow. The osteoclast pitfall. Histol Histopathol. 22, (9), 971-976 (2007).
  34. Witkiewicz, A. K., Knudsen, K. E., Dicker, A. P., Knudsen, E. S. The meaning of p16(ink4a) expression in tumors: functional significance, clinical associations and future developments. Cell Cycle. 10, (15), 2497-2503 (2011).
  35. Baker, D. J., et al. Naturally occurring p16(Ink4a)-positive cells shorten healthy lifespan. Nature. 530, (7589), 184-189 (2016).
  36. Baker, D. J., et al. Clearance of p16Ink4a-positive senescent cells delays ageing-associated disorders. Nature. 479, (7372), 232-236 (2011).
  37. Demaria, M., et al. An Essential Role for Senescent Cells in Optimal Wound Healing through Secretion of PDGF-AA. Dev Cell. 31, (6), 722-733 (2014).
  38. Noren Hooten, N., et al. Metformin-mediated increase in DICER1 regulates microRNA expression and cellular senescence. Aging Cell. 15, (3), 572-581 (2016).
  39. Barzilai, N., Crandall, J. P., Kritchevsky, S. B., Espeland, M. A. Metformin as a Tool to Target Aging. Cell Metab. 23, (6), 1060-1065 (2016).
  40. Foretz, M., Guigas, B., Bertrand, L., Pollak, M., Viollet, B. Metformin: from mechanisms of action to therapies. Cell Metab. 20, (6), 953-966 (2014).
  41. Cahu, J., Sola, B. A sensitive method to quantify senescent cancer cells. J Vis Exp. (78), (2013).
  42. Debacq-Chainiaux, F., Erusalimsky, J. D., Campisi, J., Toussaint, O. Protocols to detect senescence-associated beta-galactosidase (SA-betagal) activity, a biomarker of senescent cells in culture and in vivo. Nat Protoc. 4, (12), 1798-1806 (2009).
  43. Noppe, G., et al. Rapid flow cytometric method for measuring senescence associated beta-galactosidase activity in human fibroblasts. Cytometry A. 75, (11), 910-916 (2009).
  44. Bassaneze, V., Miyakawa, A. A., Krieger, J. E. Chemiluminescent detection of senescence-associated beta galactosidase. Methods Mol Biol. 965, 157-163 (2013).
  45. Redon, C. E., et al. gamma-H2AX detection in peripheral blood lymphocytes, splenocytes, bone marrow, xenografts, and skin. Methods Mol Biol. 682, 249-270 (2011).
  46. Kosar, M., et al. Senescence-associated heterochromatin foci are dispensable for cellular senescence, occur in a cell type- and insult-dependent manner and follow expression of p16(ink4a). Cell Cycle. 10, (3), 457-468 (2011).
  47. Kennedy, A. L., et al. Senescent mouse cells fail to overtly regulate the HIRA histone chaperone and do not form robust Senescence Associated Heterochromatin Foci. Cell Div. 5, 16 (2010).
Técnicas para inducir la senescencia celular y cuantificar
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Noren Hooten, N., Evans, M. K. Techniques to Induce and Quantify Cellular Senescence. J. Vis. Exp. (123), e55533, doi:10.3791/55533 (2017).More

Noren Hooten, N., Evans, M. K. Techniques to Induce and Quantify Cellular Senescence. J. Vis. Exp. (123), e55533, doi:10.3791/55533 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter