Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Los protocolos para la investigación de la distribución original de los tejidos, modo de transmisión, y el efecto sobre la aptitud de un anfitrión Densovirus en el gusano de la cápsula del algodón

doi: 10.3791/55534 Published: April 12, 2017

Summary

Aquí, se presenta un protocolo para investigar la distribución host-tejido, el modo de transmisión, y el efecto sobre la aptitud de host de un densovirus dentro de una especie de lepidópteros, el gusano bellotero del algodón. Este protocolo también se puede utilizar para el estudio de la interacción entre otros virus transmitidos por vía oral y sus anfitriones de insectos.

Abstract

Muchos virus nuevos se han descubierto en huéspedes animales que utilizan las tecnologías de secuenciación de próxima generación. Anteriormente, se informó de un virus mutualista, Helicoverpa armigera densovirus (HaDV2), en una especie de lepidópteros, el gusano del algodón, Helicoverpa armigera (Hübner). A continuación, describimos los protocolos que se utilizan actualmente para estudiar el efecto de HaDV2 en su huésped. En primer lugar, se establece una colonia gusano del algodón libre de HaDV2 desde una sola pareja reproductora. Luego, por vía oral inocular algunos descendientes de las larvas recién nacido con HaDV2 que contienen líquido filtrado para producir dos colonias con los mismos antecedentes genéticos: HaDV2 infectada por uno, el otro no infectados. Un protocolo para comparar los parámetros de tabla de vida (por ejemplo, larva, pupa, y períodos de adultos y la fecundidad) entre los individuos infectados por el HaDV2 y no infectadas también se presenta, como son los protocolos para determinar la distribución de host-tejido y la eficiencia de transmisión de HaDV2. Estos protocolos woULD también ser adecuado para la investigación de los efectos de otros virus transmitidos por vía oral en sus anfitriones de insectos, anfitriones de lepidópteros en particular.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

En las últimas décadas, el desarrollo de la tecnología de secuenciación tal como secuenciación de próxima generación (NGS) ha facilitado el descubrimiento de muchos nuevos ADN y ARN virus, virus especialmente no patógenas, sino también nuevos aislamientos de virus conocidos anteriormente 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12. En el organismo modelo Drosophila melanogaster, más de 20 nuevos genomas de virus parciales se han detectado usando técnicas metagenomic 13. Muchas secuencias virales, incluyendo virus nuevos, también se han identificado en otros insectos, tales como las abejas de miel, mosquitoes, psílido asiático del cítrico, libélulas, y múltiples especies de lepidópteros 14, 15, 16, 17, 18, 19, 20, 21.

En el futuro, se puede esperar que más nuevos virus se descubrirán en los insectos que utilizan estas tecnologías avanzadas; por lo tanto, nuestra comprensión de la interacción virus-huésped puede cambiar en consecuencia 6, 9. Por ejemplo, las interacciones virus-huésped se consideran ser más complicado que se pensaba anteriormente, debido a que muchos nuevos virus se están definiendo como socios mutualistas en lugar de patógenos estrictos 22. Por ejemplo, el DplDNV densovirus mutualistic en Dysaphis plantaginea induce la morph alada y aumenta la movilidad, lo que facilita la dispersión del anfitrión, así como el virus 23. Por otra parte, los virus mutualistas se han descrito con respecto a la salud de los mamíferos, la sequía y la tolerancia al frío de las plantas, y el impacto de infecciones bacterianas 24. Seneca valle virus-001 se muestra para mediar en la citotoxicidad selectiva hacia células tumorales con cáncer neuroendocrino cuenta con 25. Infecciones por virus de la hepatitis A suprimir la replicación del virus de la hepatitis C y pueden conducir a la recuperación de la hepatitis C 26. Latencia del herpesvirus confiere protección simbiótica de una infección bacteriana 27. La glicoproteína de la envuelta de retrovirus endógeno HERV-W humana induce resistencia celular a bazo virus de la necrosis 28. Curvularia virus tolerancia térmica (CThTV) a partir de un hongo endófito está implicado en la interacción entre mutualistic este hongo y una hierba pánico tropicalref "> 29. Por lo tanto, el conocimiento de las interacciones entre los virus recién descubiertos y sus anfitriones debería generar nuevas perspectivas sobre su biología y gestión. Sin embargo, los nuevos virus, especialmente los virus encubiertos que muestran signos evidentes típicos de la infección aguda, tienen pocas veces han investigado, y necesitamos una tubería y protocolos para investigar los efectos de los virus recién descubiertos en sus anfitriones.

Anteriormente, hemos informado de la prevalencia de una nueva monosense densovirus Helicoverpa armigera densovirus (HaDV2) en el gusano del algodón, Helicoverpa armigera, y se presentó evidencia de una relación mutualista entre HaDV2 y el gusano del algodón 30, 31. En este documento, se describirá el protocolo de laboratorio para estudiar en detalle la interacción entre HaDV2 y su huésped gusano del algodón. El protocolo que se presenta aquí también puede ser de gran importancia para los investigadores que examinan la role de otros virus transmitidos por vía oral, especialmente en las plagas de lepidópteros.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Construcción de la colonia gusano del algodón HaDV2 libre

  1. Algodón posterior gusano de la cápsula larvas (H. armigera) en una dieta artificial 32 en un cuarto de crecimiento controlado o una cámara de clima artificial a 25 ± 1 ° C, con 14 h de luz / 10 h de oscuridad y 60% de humedad relativa.
  2. Ayuda de apareamiento de un solo par de polillas recién eclosed mediante el uso de una jaula de plástico por par (altura 10 cm, 5 cm de diámetro) cubierto con una gasa de algodón para asegurar una buena ventilación y para servir como un sustrato de oviposición. Para aumentar la probabilidad de obtener una colonia libre de virus, utilizar al menos 30 pares de apareamientos de un solo par. Polillas RSS adultos con una solución de vitamina% de azúcar 10 y 2% 32 empapados en una bola de algodón y reponían a diario.
  3. Como adultos hembras ponen sus huevos en la gasa de algodón aproximadamente 2 días después del apareamiento, cambiar la gasa diaria. Recopilar y mantener gasa que contiene los huevos en la misma sala de crecimiento (o Cham clima artificialBER) como las polillas adultas hasta la eclosión de los huevos.
  4. Transferir inmediatamente larvas recién eclosionadas a nuevas placas de 24 pocillos, con un individuo por pocillo.
  5. Cinco días después de la primera fecha de la puesta de huevos, recoger las polillas de padres y almacenarlas en nitrógeno líquido.
    NOTA: Recogida de las polillas 5 días después de la primera fecha de la puesta de huevos se asegura de que los padres están vivos en el punto de recogida y, por tanto, evita cualquier posible impacto del uso de polillas muertas en la precisión de la extracción de ADN.
  6. Aislar el ADN genómico a partir de estas muestras usando un kit de extracción de ADN de acuerdo con las instrucciones del fabricante.
    1. Amplificar un fragmento de 574 pb del gen de la actina con cebadores de actina F / actina R (actina F: 5-CATCTACGAGGGTTACGC-3 y actina R: 5-CATCTGTTGGAAGGTGGA-3). Visualizar la reacción en cadena de la polimerasa (PCR) de productos utilizando electroforesis en gel de agarosa de acuerdo con protocolos estándar; la amplificación con éxito del gen de la actina se asegura de que el ADN es de buena calidad.
    2. evaluar tél presencia de HaDV2 en las polillas matrices utilizando PCR con cebadores específicos: DVVPF (GGATTGGCCTGGGAAATGAC) y DVVPR (CGTTGTTTTTATATCCGAGG) 31.
  7. Una vez un par limpio ha sido identificado, la descendencia trasera de que solo par de cría no infectados-HaDV2 durante al menos cinco generaciones y mantener esto como la colonia libre de HaDV2 (NONINF-deformación); la colonia infectada con HaDV2 se define como el INF-deformación.
  8. Para confirmar el estado de la infección en el HaDV2 NONINF-deformación (y para excluir el efecto de las bacterias o los virus conocidos en el desarrollo de acogida), evaluar el estado de la infección por HaDV2, Wolbachia, y H. armigera nucleopoliedrovirus (HaNPV) en ocho individuos seleccionados al azar larvas de la NONINF-deformación usando PCR (con los cebadores específicos: DVVPF / DVVPR para HaDV2, NPVF / nPVR para HaNPV y 81F / 691R para Wolbachia 31, 33).
    NOTA: Se sabe que algunos virus podrían llegar tardent en el huésped infectado, con un nivel indetectable incluso cuando se utiliza una técnica basada en PCR. tecnologías NGS se podrían utilizar para confirmar que no hay secuencias víricas están presentes en las muestras de ADN genómico.

2. Preparación de HaDV2 que contienen fluidos líquidos

Nota: Hemos demostrado que el intento de purificación de las partículas del virus HaDV2 inhibe su infectividad y la actividad 31; Por lo tanto, el siguiente protocolo se lleva a cabo para lograr la solución HaDV2 infecciosa mediante el filtrado de los individuos infectados por el HaDV2.

  1. Recoger las polillas adultas de forma individual e inmediatamente almacenarlas en nitrógeno líquido.
  2. Completamente moler las polillas individuales recogidos en nitrógeno líquido utilizando un mortero y mano de mortero esterilizado. Transferir aproximadamente 10 g de residuos a un tubo limpio de 1,5 ml. Transferir el residuos restantes a un nuevo tubo e inmediatamente almacenar a -80 ° C.
  3. Extraer ADN de la 10 g de escombros, Folloel ala de los protocolos proporcionados por el fabricante. Una vez se ha aislado el ADN de la polilla, la verificación de HaDV2 utilizando el protocolo, como se describe en el paso 1.6.
  4. Según los resultados obtenidos en la etapa 2.3, se divide el residuos restantes en dos grupos: HaDV2-positivas y HaDV2-negativas, dependiendo de su estado de infección. Añadir 1 ml de solución salina tamponada con fosfato (PBS; NaCl 137 mM, KCl 2,7 mM, 8 mM Na 2 HPO 4, y 1,5 mM KH 2 PO 4; pH 7,5) a cada individuo para disolver completamente los restos de larvas restante.
  5. Centrifugar el homogeneizado (de la etapa 2.4) a 6500 × g durante 15 min a 4 ° C. Filtrar el sobrenadante líquido con un filtro de membrana de 0,22 m. Recoger los líquidos filtrados (200 l por tubo) e inmediatamente almacenar a -80 ° C.
    Nota: El filtro de membrana de 0,22 micras-filtrará la mayoría de la indeseable partículas, bacterias y hongos. Primero preenfriar la centrífuga a 4 ° C. Realizar todos los protocolos involving de la operación del líquido filtrado en hielo para evitar que el homogeneizado se pongan marrones y coagular.

3. Construcción de la colonia gusano del algodón infectado con HaDV2

  1. capacidad de transmisión horizontal de HaDV2
    1. Generar una curva estándar HaDV2.
      1. Amplificar los fragmentos que contienen cebadores (VPF: CTGGTGAGGCGATGGACATG; VPR: TGACAAGATCCAGCGTAGACATC) y sonda (VP-sonda: GCCACCACTAGAGGACCCACCAGATG), que se utilizan para la cuantificación de virus HaDV2, con los cebadores de novo (PF: GGACAATGCTGGTGAGGC; PR: AATCCTCTTTGTCCGTTATCTATG). Utiliza el siguiente programa: 30 s a 94 ° C, 30 s a 53 ° C, y 60 s a 72 ° C durante 40 ciclos en una máquina de PCR 31. Añadir 1 l de ADN genómico que contiene el genoma HaDV2 (paso 2.3) a la reacción de 25! L de PCR como plantilla de ADN. Clonar los fragmentos amplificados en un vector de clonación de acuerdo con los protocolos del fabricante.
      2. Calcular el número de copiasplásmidos con la siguiente ecuación: copias / l = (N A × C) / (n × M × 10 9), donde N A es el número de Avogadro (6,02 × 10 23 moléculas / mol); C es la concentración en masa de plásmidos (ng / ml), que se pueden medir usando microespectrofotometrıa; n es la longitud de plásmido recombinante que contiene el producto de PCR (5195 pb); y M es el peso molecular de un par de bases promedio de ADN de doble cadena (660 g / mol).
      3. Preparar seis diluciones en serie de 10 veces en tubos de microcentrífuga de 1,5 ml, con concentraciones de 1,5 × 10 9, 1,5 × 10 8, 1,5 × 10 7, 1,5 × 10 6, 1,5 × 10 5, y 1,5 × 10 4 el número de copias / l.
      4. Realizar la reacción en cadena de la polimerasa cuantitativa en tiempo real (qPCR) usando cebadores específicos (VPF / VPR) y una sonda (VP-sonda) para generar ciclo threvalores shold (CT) de los plásmidos descritos en la etapa 3.1.1.3. Realizar tres repeticiones técnica independientes y promediarlos para los cálculos posteriores.
      5. Usando los resultados anteriores, generar una curva estándar correlacionar las concentraciones log2-transformado HaDV2 a los valores de Ct promediados relacionados.
    2. Cuantificar HaDV2 en los fluidos líquidos filtrados.
      1. Pipetear una muestra de ensayo de 100 l de fluido líquido filtrado (paso 2,6) que contiene HaDV2 para la extracción de ADN.
      2. Utilice tiempo real-qPCR para obtener los valores de Ct para los fluidos líquidos y calcular el número de copias usando la curva estándar en el paso 3.1.1.
    3. Determinar la eficacia de la infección oral con líquidos filtrados infectados por HaDV2 de diferentes concentraciones.
      1. Diluir el fluido líquido que contiene HaDV2 a las siguientes concentraciones: 10 8, 10 7, 10 6, el número 10 5, 10 4, y 0 copia / l.
      2. Corre la di artificialet uniformemente en un plato de 9 cm de diámetro Petri antes de la solidificación. Uniformemente repartidas líquido que contiene HaDV2 filtrado (200 l) para cada concentración en la superficie de la dieta artificial sólido. Para ello, en una campana extractora.
      3. Transferir 100 larvas incubadas recién a la dieta artificial HaDV2 que contiene en una caja de Petri. golpear suavemente la gasa de algodón (incluyendo larvas incubadas recién) para transferir las larvas de la gasa para una hoja de papel blanco. Batir el papel con cuidado para que la seda de giro y larvas "globo" en el papel. El uso de fórceps esterilizados para tocar la seda y mover las larvas a una placa de Petri.
      4. Después de 48 h, la transferencia de las larvas en la dieta artificial a placas de 24 pocillos (un individuo por pocillo).
      5. Posterior a las larvas inoculadas con HaDV2 a las concentraciones anteriores a la etapa adulta.
      6. Recoger las polillas adultas, extraer el ADN, y detectar HaDV2 usando PCR, tal como se describe en el paso 1.5.
        NOTA: En este caso, obtener una tasa de infección HaDV2 100% del cogusanos de la cápsula tton utilizando el 10 8 número de copias / l y por lo tanto establecer la colonia infectada con HaDV2 (INF-deformación).
  2. capacidad de transmisión vertical del HaDV2
    1. Seleccione polillas adultas de los NONINF y INF-cepas para generar pares individuales de ♀- / ♂-, ♀ + / ♂-, ♀- / ♂ + y + ♀ / ♂ + (+: positivo para la infección HaDV2; -: negativo para HaDV2 infección).
    2. La transferencia de la descendencia de los pares anteriores a placas de 24 pocillos libres de virus; trasera de las larvas en el tercer instar.
    3. Extraer el ADN de las larvas de tercer instar recogido utilizar como plantilla para determinar la presencia de HaDV2, como se describe en el paso 1.5.

4. Distribución tisular de HaDV2

  1. Para evitar la contaminación de virus y bacterias, esterilizar las pinzas y tijeras en etanol al 75% tres veces y luego ellos calentar en la llama de una lámpara de alcohol.
    NOTA: sterilizatio fórcepsn es necesario cuando se produce la contaminación.
  2. Utilizando una balanza analítica, pesar los tubos vacíos que se van a utilizar para almacenar los tejidos.
  3. Colocar las larvas y adultos polillas de la INF-deformación en hielo durante aproximadamente 5 min.
  4. Diseccionar los siguientes tejidos bajo un estereomicroscopio en las larvas, las hembras adultas, y los machos adultos en un plato limpio Petri que contenía tampón de PBS.
    1. Para las larvas, hemolinfa pipeta y diseccionar el intestino anterior, intestino medio, intestino posterior, grasa corporal, y túbulos de Malpighi (Figura 1A). Transferir inmediatamente cada tejido a los tubos en nitrógeno líquido.
      1. Fijar las larvas congelado en cystosepiment usando dos pasadores de insectos (200 micras de diámetro, 20 mm de longitud), insertando en las membranas intersegmentales cerca de la cabeza y el último segmento abdomen (Figura 1A).
      2. Cortar el Proleg en el abdomen posterior de las larvas de manera que la hemolinfa de larvas fluye hacia fuera. Pipeta de la hemolinfa de las larvas a los 10 s usando un microPipette para evitar el oscurecimiento y la coagulación de la hemolinfa.
        NOTA: feniltiourea (50 mg / mL) podría ser mezclado en una proporción / vol 01:20 vol con hemolinfa para prevenir la melanización.
      3. El uso de un par de tijeras, hacer una incisión en la cutícula que van desde la última membrana intersegmental a la cabeza. Diseccionar todos los tejidos restantes bajo un estereomicroscopio utilizando dos pinzas; la imagen para cada tejido se muestra en la Figura 1A.
      4. Mezclar muestras de tejido de tres individuos juntos como una réplica.
      5. Para evitar la contaminación de los tejidos restantes con la hemolinfa durante la disección, se lavan los tejidos disecados en tampón PBS tres veces. A continuación, probar el estado HaDV2-infección de la PBS utilizado para el lavado. Si el tampón de lavado final es HaDV2-libre, el tejido debe estar limpia de la contaminación con hemolinfa.
    2. Para las hembras adultas, diseccionar la cabeza (cerebro), los músculos, la grasa corporal, intestino, tubos de Malpighi y ovario (Figura 1B) bajo un estereomicroscopio en tampón PBS. Para los machos adultos, diseccionar la cabeza (cerebro), los músculos, la grasa y el cuerpo, intestino, túbulos de Malpighi, y los testículos (Figura 1C) bajo un estereomicroscopio en tampón PBS. Transferir inmediatamente cada tejido a los tubos en nitrógeno líquido.
      1. El uso de pinzas y tijeras, quite las alas de las polillas adultas y lavar el cuerpo restante tres veces para limpiar la balanza.
      2. Separar la cabeza, el tórax y el abdomen con unas tijeras.
      3. Retire el endoesqueleto del tórax y recoger el músculo.
      4. El uso de pinzas, retire la cutícula del abdomen y diseccionar los otros tejidos siguientes figuras 1B y 1C.
      5. Mezclar las muestras de tejido de tres individuos juntos como una réplica. Lavar los tejidos disecados en tampón PBS tres veces.
  5. Pesar los tubos y los tejidos anteriores cuando han sido congelados y asegurar que el masnos de los diferentes tejidos son casi iguales.
    Masa (tejidos) = masa (tubos / muestra de tejido) - masa (sólo tubo)
  6. Extraer el ADN de estos tejidos y realizar qPCR, como se describe en el paso 3.1.2.
  7. Calcular el número de copias por mg de cada tejido utilizando la curva estándar generada en el paso 3.1.1. Utilice el título de virus por unidad de masa para corregir el sesgo de la muestra causados ​​por cualquier diferencia en la cantidad de tejido utilizado para la extracción de ADN.
  8. Calcular el porcentaje de HaDV2 en el tejido específico de la siguiente manera: porcentaje de HaDV2 para cada tejido = HaDV2 número de copias por mg de tejido a prueba / (suma del número de copias por mg de todos los tejidos).

5. Los bioensayos probar el efecto de HaDV2 sobre el Desarrollo de host

  1. Place al menos 100 pupas o polillas adultas recién emergidas derivados de la NONINF-deformación en una, jaula 5-L, de malla de alambre de gasa de algodón-cubierto. Después de 2 días, se aparearon hembras adultas comienzan a poner huevos en la gasa de algodón. Recopilar y mantenerla gasa de algodón que contiene los huevos; los huevos eclosionan en unos tres días.
  2. La inoculación de las larvas recién nacido con HaDV2.
    1. Transferir las larvas recién nacidas de la NONINF-deformación a la dieta artificial que contiene HaDV2 (10 8 el número de copias / l) para establecer el INF-deformación.
    2. Del mismo modo, la transferencia de larvas neonatas a la dieta artificial cubierto con líquido filtrado HaDV2 libre (paso 2.4) para establecer los grupos de control (NONINF-deformación). Incluir al menos 240 larvas en cada tratamiento (Figura 2A).
      NOTA: Las larvas que se utilizan para construir el NONINF- e INF-cepas se derivan de la misma cohorte de padres y eclosionan al mismo tiempo, garantizar los mismos antecedentes genéticos. Asegúrese de que los NONINF- y INF-cepas se mantienen en la misma cámara climática (a 25 ± 1 ° C, con 14 h de luz / 10 h de oscuridad y 60% de humedad relativa) para una tasa de síncrono de desarrollo; la tasa puede variar dependiendo de la temperatura y la humedad. Manejar la Deliccomieron las larvas suavemente.
  3. Después de 48 h, la transferencia de las larvas individualmente a placas de 24 pocillos (un individuo por pocillo) (Figura 2B).
    1. número secuencial cada larva en cada pocillo y registrar la fase instar y estado de supervivencia diaria.
    2. Alrededor de 5 días después, cuando la dieta artificial se deteriora, transferir simultáneamente a estos individuos a una nueva placa de 24 pocillos que contenía dieta artificial fresco (Figura 2C).
    3. Pesar las larvas de día 7 al 11 después de la eclosión usando una balanza analítica con una precisión de 0,0001 g. Después de pesar, volver individualmente las larvas a la placa de 24 pocillos.
  4. Tras la muda al quinto estadio después de la cuarta ecdisis (alrededor de diez días después de la eclosión), transferir las larvas a tubos de vidrio (altura 10 cm, 2 cm de diámetro) (Figura 2D); quinto estadio las larvas también puede ser identificado por la anchura de la cápsula de la cabeza (aproximadamente 2,6 mm).
    NOTA: La transferencia de los individuosal tubo de vidrio al mismo tiempo cada día.
    1. Código cada larva con su número de referencia original en el tubo de vidrio utilizando pintura o marcadores. Registrar el estado larvario diaria; en los tubos de vidrio, las larvas puparán después de unos cinco días, la etapa de pupa dura aproximadamente 11 días.
    2. Registre la fecha pupas y eclosión para cada individuo en el tubo de vidrio. Se registra la masa de pupas de 3 días de edad.
  5. Después de la eclosión, poner una hembra y un macho en una sola jaula con 10% de sacarosa y solución de vitaminas 2% (Figura 2E). Reponer la solución de sacarosa cada día. Anote la fecha de la muerte para cada polilla.
  6. Cuando los huevos son puestos, cambiar la gasa de algodón al día. Contar el número de huevos inmediatamente. Contar crías recién nacida mientras su eclosión.
  7. Durante los bioensayos, seleccionar al azar a ocho personas por cada tratamiento para confirmar el estado de infección de HaDV2. Extraer el ARN total de estas muestras utilizando el reactivo tripsina comercialsiguiendo el protocolo del fabricante. Sintetizar la primera hebra de ADNc siguiendo el protocolo del fabricante y utilizar como una plantilla para probar si los virus se transcriben con éxito.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Las progenies de los padres que eran-HaDV2 libre (Figura 3A) se criaron como el NONINF-deformación. Amplificamos con éxito el gen de la actina utilizando los mismos moldes de ADN, lo que sugiere que las plantillas de ADN eran de buena calidad (Figura 3B). Además, los seleccionados al azar ocho progenie también estaban libres de HaDV2 (Figura 3C), HaNPV (Figura 3D), y Wolbachia (Figura 3E). Una vez más, se concluyó que las muestras de ADN de las progenies fueron de buena calidad, ya que una porción del gen de la actina se amplificó con éxito para todas las muestras analizadas (Figura 3F).

Una curva estándar que define la relación entre el registro de la calidad del material de partida y los valores de Ct obtenidos fue generado, como en la Figura 4. Una fuerte correlación lineal (R (Figura 4).

Recién larvas eclosionadas se inocularon con una curva estándar punto de HaDV2 fluidos líquidos utilizando diluciones en serie de 10 veces entre 10 4 y 10 8 el número de copias / mL. Se obtuvo una correlación lineal entre la frecuencia de la infección y las concentraciones de los fluidos líquidos HaDV2; 10 8 el número de copias / l produjo infección 100% para el gusano de la cápsula del algodón, pero otras concentraciones no (también ver Xu et al. 31). Las frecuencias de infección HaDV2 de las progenies de los padres con diferentes estados de infección HaDV2 fueron las siguientes: 100% para ♀ + / ♂-, 78% para ♀- / ♂ +, y 100% para ♀ + / ♂ + (también ver Xu et al. 31).

acorrect las diferencias individuales en el título HaDV2, se calculó el número de copias HaDV2 por mg de cada tejido y el porcentaje del total título HaDV2 para el tejido específico. Los resultados revelaron que HaDV2 se distribuye principalmente en la grasa corporal (Figura 5; véase también Xu et al 31.). Las comparaciones de los parámetros de la tabla de vida, incluyendo los periodos de larvas, pupas períodos, longitud de adultos, y la fecundidad, se muestran en la Tabla 1 (véase también Xu et al. 31). Las masas de larvas y pupas estaban según lo publicado por Xu et al. 31. Los estados de infección HaDV2 tanto en el NONINF-deformación y la INF-deformación se determinaron por PCR (resultados publicados por Xu et al. 31).

Figura 1
Figura 1. diseccionaron tejidos para (A) Las larvas, (B) unaHembra adulta, y (C) un macho adulto. H, la cabeza (cerebro); Él, hemolinfa; FB, grasa corporal; Mt, túbulos de Malpighi; G, el intestino; FG, intestino anterior; MG, intestino medio; HG, intestino posterior; Mu, músculos; O, ovario; T, testículo. Haga clic aquí para ver una versión más grande de esta figura.

Figura 2
Figura 2. Procedimiento bioensayo para determinar los efectos de HaDV2 en el algodón gusano de la cápsula. (A) La inoculación de las larvas recién nacidas con HaDV2. (B) La transferencia de los individuos infectados por el HaDV2 y HaDV2-gratuitas para placas de 24 pocillos después de 48 h. (C) Diferentes tamaños de las personas infectadas por HaDV2 y -free. (D) Transferencia de las larvas de quinto instar a nuevos tubos de vidrio (10 cm de altura, 2 cm de diámetro). (E) La colocación de unapolilla hembra y un macho en la misma jaula para determinar la longevidad de adultos, la producción de huevos, y la tasa de eclosión. Haga clic aquí para ver una versión más grande de esta figura.

figura 3
Figura 3. Estado de infecciones en la HaDV2, HaNPV o Wolbachia en colonias infectadas por HaDV2 y HaDV2-libres. HaDV2 estado de infección en los padres femeninos y masculinos (A). Estado de infección de HaDV2 (C), HaNPV (D), y Wolbachia (E) en las progenies seleccionadas al azar. Para comprobar la calidad del ADN genómico, la actina limpieza de genes también se amplificó para los padres (B) y progenie (F). Carril M muestra el marcador de DL2000 (2000 pb, 1000 pb, 750 pb, 500 pb, 250 pb, unad 100 pb). Carril 1: progenitor femenino. Carril 2: progenitor masculino. Carril 3 - 10: progenie. Haga clic aquí para ver una versión más grande de esta figura.

Figura 4
Figura 4. Las concentraciones HaDV2 curva estándar de Correlación Log 2 transformadas a ciclo valores de umbral (CT). Haga clic aquí para ver una versión más grande de esta figura.

Figura 5
Figura 5. Distribución Host-tejido de HaDV2 en larvas de (A), de la hembra adulta (B), y del varón adulto (C) de algodón gusanos de la cápsula. Porcentaje (%) = la relación de HaDV2 en diferentes tejidos (por mg), como se he descrito(:; Machos adultos n = 7: larvas n = 6; hembras adultas: n = 6) n paso 4.7 Los datos fueron analizados estadísticamente mediante análisis de varianza (ANOVA) y la prueba de Tukey. Medias ± SE. Los resultados fueron publicados por Xu et al. 31. Haga clic aquí para ver una versión más grande de esta figura.

parámetros de ciclo de vida HaDV2 + HaDV2- valor de t df valor P
período larval (días) Masculino 16,51 (± 0,72) 16,93 (± 1,21) 4.147 379 <0,001
Hembra 16,51 (± 0,79) 16,80 (± 1,05) 2,732 312 0,0067
período de pupa (días) Masculino 13,02 (± 0,68) 13,31 (± 0,69) 4,057 379 <0,001
Hembra 11,62 (± 0,67) 12,00 (± 0,63) 5.1 312 <0,001
Longevidad de adultos (días) Masculino 10,69 (± 1,98) 10,93 (± 2,46) 0,915 367 0.36
Hembra 9,07 (± 1,98) 8,51 (± 1,58) 2.992 367 0,003
Número de huevos producidos por hembra 482 (± 174) 403 (± 180) 2.172 93 0,032
Número de eclosiones por hembra 207 (± 108) 143 (± 99) 3.026 93 0,0032

Tabla 1. Parámetros de ciclo de vida para HaDV2 + y gusanos de la cápsula HaDV2 de algodón. La prueba t de Student se utiliza para determinar el nivel de significación. Medios ± SE se muestran. Los datos presentados en esta tabla fueron publicadas por Xu et al. 31.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

En las últimas décadas, la mayoría de los estudios sobre las interacciones de virus de insectos se han centrado en salud de las abejas 34, 35, 36, vectores de enfermedades humanas 37, virus de plantas 38, y algunos virus patógenos de insectos que tienen un gran potencial como agentes de control biológico 39. Poca atención se ha prestado a los virus encubiertos en insectos, especialmente en las plagas de lepidópteros. A continuación, se presenta un protocolo para el estudio de las interacciones entre un virus encubierta y su insecto huésped. Una comparación de los parámetros de la tabla de vida para infectadas por virus y libre de virus individuos anfitrionas idealmente debería excluir cualquier efecto de las diferencias en los antecedentes genéticos de acogida. Para estudiar el fenotipo viral, muchos estudios previos han comparado los parámetros de la tabla de vida de cualquiera de los individuos infectados de forma natural o no infectadas en la misma colonia o individuos inoculadospor microinyección, pero este esfuerzo es mucho tiempo 23, 40. La inoculación oral de gusanos de la cápsula de algodón con HaDV2, descritos aquí, sirve como un medio simple y eficaz para analizar fenotipos virales. Este procedimiento también se asegura el mismo fondo genético de las colonias infectadas y no infectadas-HaDV2-HaDV2.

inóculo de virus se puede preparar de muchas maneras. La purificación de partículas de virus utilizando centrifugación a alta velocidad inhibe la infectividad del virus, lo que resulta en baja infectividad; por lo tanto, se utilizó líquido filtrado que contiene el virus para infectar el algodón gusano de la cápsula larvas 31. El hecho de que la membrana de 0,22 micras puede filtrar la mayor parte de hongos y partículas bacterianas de líquido que contiene HaDV2 filtrada y que se utilizó el líquido filtrado HaDV2 libre como el control podría excluir el efecto de otros virus en nuestros resultados. Sin embargo, no podemos excluir la posibilidad de que los resultados de los bioensayos podría unalso estar sesgada por virus desconocidos. Por lo tanto, las partículas HaDV2 con alta infectividad idealmente deben ser purificados en el futuro para obtener resultados robustos.

La concentración de virus correlacionó positivamente con la infectividad del virus; por lo tanto, estábamos interesados ​​en la determinación de la concentración HaDV2 que producirá la infección del 100%. Nuestros resultados mostraron que el número 10 de 8 copias / l podría ser utilizado para la inoculación del virus para obtener este tipo de infección. Sin lugar a dudas, la correlación entre la concentración de virus y tasa de infección debe ser estudiado para otras interacciones virus-huésped estudiadas en el futuro. Además, el título de virus de cada individuo en el campo también se debe explorar. Por lo tanto, podríamos simular el efecto de los virus a los individuos en el campo.

El manejo cuidadoso de las larvas delicada durante los primeros días después de que nacen es muy importante, ya que son fácilmente dañadas fatalmente. Por otra parte, la col no infectados-HaDV2ony deben mantenerse por separado en el invernadero para prevenir la contaminación HaDV2-la tasa de infección de HaDV2 se ha encontrado para ser muy alta, tanto en el campo como en el laboratorio 31.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores declaran que no tienen intereses financieros en competencia.

Acknowledgments

Este trabajo fue apoyado por el Programa Nacional de Investigación Básica clave de China (Nº 2013CB127602) y el Fondo de Ciencia para creativos Grupos de Investigación de la Fundación Nacional de Ciencias de China (Nº 31321004).

Materials

Name Company Catalog Number Comments
24-well plate Corning 07-200-740 Multiple suppliers available.
DNA extraction kit TIANGEN DP304-03 Multiple suppliers available.
thermal cycler Veriti; Applied Biosystems 4375786
PBS Corning 21-040-CV
0.22 µm membrane filter Millipore SLGS025NB
pEASY-T Cloning Vector TransGen, Beijing, China CT301-02
Tweezers IDEAL-TEK 2.SA
Premix Ex Taq (Probe qPCR) Takara RR390A
Probes Invitrogen Custom order
Primers Invitrogen Custom order
microspectrophotometry NanoDrop 2000c  Thermo scientific  not available
7500 Real-Time PCR system Applied Biosystems not available
stereomicroscope SZX-16 Olympus not available
sucrose Multiple suppliers available.
vitamin complex Multiple suppliers available.

DOWNLOAD MATERIALS LIST

References

  1. Tang, P., Chiu, C. Metagenomics for the discovery of novel human viruses. Future Microbiol. 5, 177-189 (2010).
  2. Rosario, K., Breitbart, M. Exploring the viral world through metagenomics. Curr. Opin. Virol. 1, 289-297 (2011).
  3. Hugenholtz, P., Tyson, G. W. Microbiology - metagenomics. Nature. 455, 481-483 (2008).
  4. Kristensen, D. M., Mushegian, A. R., Dolja, V. V., Koonin, E. V. New dimensions of the virus world discovered through metagenomics. Trends Microbiol. 18, 11-19 (2010).
  5. Kleiner, M., Hooper, L. V., Duerkop, B. A. Evaluation of methods to purify virus-like particles for metagenomic sequencing of intestinal viromes. BMC Genomics. 16, 7 (2015).
  6. Ho, T., Tzanetakis, I. E. Development of a virus detection and discovery pipeline using next generation sequencing. Virology. 471, 54-60 (2014).
  7. Marx, C. J. Can you sequence ecology? Metagenomics of adaptive diversification. PLoS Biol. 11, e1001487 (2013).
  8. Radford, A. D., et al. Application of next-generation sequencing technologies in virology. J. Gen. Virol. 93, 1853-1868 (2012).
  9. Liu, S. J., Chen, Y. T., Bonning, B. C. RNA virus discovery in insects. Curr. Opin. Insect Sci. 8, 54-61 (2015).
  10. Mokili, J. L., Rohwer, F., Dutilh, B. E. Metagenomics and future perspectives in virus discovery. Curr. Opin. Virol. 2, 63-77 (2012).
  11. Liu, S. J., Vijayendran, D., Bonning, B. C. Next generation sequencing technologies for insect virus discovery. Viruses-Basel. 3, 1849-1869 (2011).
  12. Cook, S., et al. Novel virus discovery and genome reconstruction from field RNA samples reveals highly divergent viruses in Dipteran hosts. PLoS ONE. 8, e80720 (2013).
  13. Webster, C. L., et al. The discovery, distribution, and evolution of viruses associated with Drosophila melanogaster. PLoS Biol. 13, e1002210 (2015).
  14. Granberg, F., et al. Metagenomic detection of viral pathogens in spanish honeybees: co-infection by aphid lethal paralysis, israel acute paralysis and lake sinai viruses. PLoS ONE. 8, e57459 (2013).
  15. Runckel, C., et al. Temporal analysis of the honey bee microbiome reveals four novel viruses and seasonal prevalence of known viruses, Nosema, and Crithidia. PLoS ONE. 6, 20656 (2011).
  16. Cox-Foster, D. L., et al. A metagenomic survey of microbes in honey bee colony collapse disorder. Science. 318, 283-287 (2007).
  17. Chandler, J. A., Liu, R. M., Bennett, S. N. RNA shotgun metagenomic sequencing of northern California (USA) mosquitoes uncovers viruses, bacteria, and fungi. Front. Microbiol. 6, 185 (2015).
  18. Shi, C. Y., et al. A metagenomic survey of viral abundance and diversity in mosquitoes from Hubei province. PLoS ONE. 10, e0129845 (2015).
  19. Nouri, S., Salem, N., Nigg, J. C., Falk, B. W. Diverse array of new viral sequences identified in worldwide populations of the Asian citrus psyllid (Diaphorina citri) using viral metagenomics. J. Virol. 90, 2434-2445 (2016).
  20. Dayaram, A., et al. Identification of diverse circular single-stranded DNA viruses in adult dragonflies and damselflies (Insecta Odonata) of Arizona and Oklahoma, USA. Infect. Genet. Evol. 30, 278-287 (2015).
  21. Jakubowska, A. K., et al. Simultaneous occurrence of covert infections with small RNA viruses in the lepidopteran Spodoptera exigua. J.Invert. Pathol. 121, 56-63 (2014).
  22. Roossinck, M. J. Move over, Bacteria! Viruses make their mark as mutualistic microbial symbionts. J. Virol. 89, 6532-6535 (2015).
  23. Ryabov, E. V., Keane, G., Naish, N., Evered, C., Winstanley, D. Densovirus induces winged morphs in asexual clones of the rosy apple aphid, Dysaphis plantaginea. Proc. Natl. Acad. Sci. USA. 106, 8465-8470 (2009).
  24. Roossinck, M. J. The good viruses: viral mutualistic symbioses. Nat. Rev. Microbiol. 9, 99-108 (2011).
  25. Venkataraman, S., et al. Structure of seneca valley virus-001: an oncolytic picornavirus representing a new genus. Structure. 16, 1555-1561 (2008).
  26. Deterding, K., et al. Hepatitis a virus infection suppresses hepatitis c virus replication and may lead to clearance of hcv. J. Hepatol. 45, 770-778 (2007).
  27. Barton, E. S., et al. Herpesvirus latency confers symbiotic protection from bacterial infection. Nature. 447, 326-329 (2007).
  28. Ponferrada, V. G., Mauck, B. S., Wooley, D. P. The envelope glycoprotein of human endogenous retrovirus herv-w induces cellular resistance to spleen necrosis virus. Arch. Virol. 148, 659-675 (2003).
  29. Márquez, L. M., Redman, R. S., Rodriguez, R. J., Roossinck, M. J. A virus in a fungus in a plant: three-way symbiosis required for thermal tolerance. Science. 315, 513-515 (2007).
  30. Xu, P. J., et al. Complete genome sequence of a monosense densovirus infecting the cotton bollworm, Helicoverpa armigera. J. Virol. 86, 10909-10909 (2012).
  31. Xu, P. J., Liu, Y. Q., Graham, R. I., Wilson, K., Wu, K. M. Densovirus is a mutualistic symbiont of a global crop pest (Helicoverpa armigera) and protects against a baculovirus and Bt biopesticide. PLoS Pathog. 10, e1004490 (2014).
  32. Liang, G. M., Tan, W. J., Guo, Y. Y. An improvement in the technique of artificial rearing cotton bollworm. Plant Protec. 25, 15-17 (1999).
  33. Zhou, W. G., Rousset, F., O'Neill, S. Phylogeny and PCR-based classification of Wolbachia strains using wsp gene sequences. P. Roy. Soc. B-Biol. Sci. 265, 509-515 (1998).
  34. Mondet, F., de Miranda, J. R., Kretzschmar, A., Le Conte, Y., Mercer, A. R. On the front line: quantitative virus dynamics in honeybee (Apis mellifera L.) colonies along a new expansion front of the parasite Varroa destructor. PLoS Pathog. 10, e1004323 (2014).
  35. Chen, Y. P., et al. Israeli acute paralysis virus: epidemiology, pathogenesis and implications for honey bee health. PLoS Pathog. 10, e1004261 (2014).
  36. Hunter, W., et al. Large-scale field application of RNAi technology reducing israeli acute paralysis virus disease in honey bees (Apis mellifera, Hymenoptera: Apidae). PLoS Pathog. 6, e1001160 (2010).
  37. Halstead, S. B. Dengue virus - mosquito interactions. Annu. Rev. Entomol. 53, 273-291 (2008).
  38. Whitfield, A. E., Falk, B. W., Rotenberg, D. Insect vector-mediated transmission of plant viruses. Virology. 479-480, 278-289 (2015).
  39. Moscardi, F. Assessment of the application of baculoviruses for control of Lepidoptera. Annu. Rev. Entomol. 44, 257-289 (1999).
  40. Szelei, J., et al. Susceptibility of North-American and European crickets to Acheta domesticus densovirus (AdDNV) and associated epizootics. J. Invert. Pathol. 106, 394-399 (2011).
Los protocolos para la investigación de la distribución original de los tejidos, modo de transmisión, y el efecto sobre la aptitud de un anfitrión Densovirus en el gusano de la cápsula del algodón
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Yang, X., Xu, P., Graham, R. I., Yuan, H., Wu, K. Protocols for Investigating the Host-tissue Distribution, Transmission-mode, and Effect on the Host Fitness of a Densovirus in the Cotton Bollworm. J. Vis. Exp. (122), e55534, doi:10.3791/55534 (2017).More

Yang, X., Xu, P., Graham, R. I., Yuan, H., Wu, K. Protocols for Investigating the Host-tissue Distribution, Transmission-mode, and Effect on the Host Fitness of a Densovirus in the Cotton Bollworm. J. Vis. Exp. (122), e55534, doi:10.3791/55534 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter