Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Protocollen voor het onderzoeken van de host-weefsel Distribution, transmissie-mode, en het effect op de Host Geschiktheid van een Densovirus in de katoenkever

doi: 10.3791/55534 Published: April 12, 2017

Summary

Hier presenteren we een protocol om de host-weefselverdeling, transmissiemodus en gevolgen voor de gastheer geschiktheid van een densovirus binnen Lepidoptera species, de katoenkever onderzoeken. Dit protocol kan ook worden gebruikt voor het bestuderen van de interactie tussen andere oraal overdraagbare virussen en insecten hun gastheer.

Abstract

Veel nieuwe virussen zijn ontdekt in dierlijke gastheren met behulp van next-generation sequencing technologieën. Eerder berichtten we een mutualistische virus, Katoendaguil densovirus (HaDV2), in een lepidoptera soort, de katoenkever, Katoendaguil (Hubner). Hier beschrijven we de protocollen die momenteel worden gebruikt om het effect van HaDV2 op zijn gastheer te bestuderen. Ten eerste hebben we de oprichting van een HaDV2-vrije katoenkever kolonie van een enkel kweekkoppel. Dan hebben we oraal inoculeren enkele neonaat larvale nakomelingen met HaDV2 bevattende gefiltreerde vloeistof twee kolonies met dezelfde genetische achtergrond te produceren: een HaDV2 geïnfecteerde, geïnfecteerde andere. Een protocol om overlevingstafel parameters (bijvoorbeeld larven, popstadium en volwassen perioden en vruchtbaarheid) vergelijk tussen de HaDV2-geïnfecteerde individuen en -uninfected wordt ook getoond, evenals de protocollen voor het bepalen van de host-weefselverdeling en overdrachtsrendement van HaDV2. Deze protocollen would ook geschikt voor het onderzoeken van de effecten van andere mondeling overgedragen virussen op hun insect gastheren, lepidoptera gastheren in het bijzonder.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

In de afgelopen decennia is de ontwikkeling van sequentietechnologie zoals next-generation sequencing (NGS) vergemakkelijkt de ontdekking van vele nieuwe DNA- en RNA-virussen, met name niet-pathogene virussen, maar ook nieuwe isolaten van eerder bekende virussen 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12. In het modelorganisme Drosophila melanogaster, zijn meer dan 20 deelinfusie virusgenomen gedetecteerd middels metagenomic 13 technieken. Vele virale sequenties, inclusief nieuwe virussen zijn ook geïdentificeerd in andere insecten zoals bijen, mosquitoes, Aziatisch citrus bladvlooien, libellen, en meerdere soorten lepidoptera 14, 15, 16, 17, 18, 19, 20, 21.

In de toekomst kan worden verwacht dat er meer nieuwe virussen zullen worden ontdekt bij insecten het gebruik van deze geavanceerde technologieën; derhalve kunnen ons begrip van de virus-gastheer interacties dienovereenkomstig veranderen 6, 9. Zo worden bijvoorbeeld virus-gastheer interacties beschouwd ingewikkelder dan eerder gedacht te zijn, omdat veel nieuwe virussen worden gedefinieerd als mutualistische partners in plaats van strikte ziekteverwekkers 22. Bijvoorbeeld, de mutualistische densovirus DplDNV in Dysaphis plantaginea induceert de gevleugelde morph en vergroot de mobiliteit, vergemakkelijkt de verspreiding van de gastheer en het virus 23. Bovendien zijn mutualistic virussen beschreven met betrekking tot de gezondheid van zoogdieren, de droogte en koude tolerantie van planten, en de effecten van bacteriële infecties 24. Seneca valley virus-001 is aangetoond dat selectieve cytotoxiciteit mediëren richting tumorcellen met neuroendocriene kanker kenmerkt 25. Hepatitis A virusinfecties te onderdrukken hepatitis C virus replicatie en kunnen leiden tot terugwinning van hepatitis C 26. Herpesvirus latency verleent symbiotische bescherming tegen bacteriële infectie 27. De omhullende glycoproteïne van humaan endogeen retrovirus HERV-W induceert cellulaire resistentie tegen miltnecrosevirus 28. Curvularia thermische tolerantie virus (CThTV) vanaf een schimmel endofiet is betrokken bij de symbiotische interactie tussen deze schimmel en tropische paniek grasref "> 29. Vandaar dat de kennis van de interacties tussen de nieuw gevonden virussen en hun gastheren moeten nieuwe perspectieven op hun biologie en het management te genereren. Echter, de nieuwe virussen, in het bijzonder de geheime virussen tonen van geen duidelijke tekenen een typisch voorbeeld van een acute infectie, hebben zelden onderzocht, en we moeten een pijpleiding en protocollen om de gevolgen van de nieuw gevonden virussen te onderzoeken op hun gastheren.

Eerder hebben we de prevalentie een nieuwe monosense densovirus Katoendaguil densovirus (HaDV2) in de katoenkever, Katoendaguil gemeld, en presenteerde het bewijs van een mutualistische relatie tussen HaDV2 en de katoenkever 30, 31. In dit artikel, zullen wij laboratoriumprotocol te bestuderen in detail de interactie tussen HaDV2 en katoenkever gastheer beschrijven. De hier gepresenteerde protocol kan ook zeer relevant voor onderzoekers onderzoeken r zijnole andere oraal overdraagbare virussen, in het bijzonder in lepidoptera.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. De bouw van de HaDV2-vrije katoenkever Colony

  1. Achterste katoenbolworm larven (H. armigera) op een kunstmatig dieet 32 gecontroleerde groeikamer of kunstmatige klimaatkamer bij 25 ± 1 ° C met 14 uur licht / 10 uur donker en 60% relatieve vochtigheid.
  2. Steun enkelpaars paring nieuw Bijlage In motten door een plastic kooi per paar (10 cm hoog, diameter 5 cm) bedekt met een gaasje een goede ventilatie en dienen als een substraat ovipositie. Om de kans op het verkrijgen van een virusvrije kolonie te verhogen, gebruik tenminste 30 paren enkelpaars paringen. Feed volwassen motten met een 10% suiker en 2% vitamine oplossing 32 gedrenkt op een watje en dagelijks aangevuld.
  3. Als volwassen vrouwtjes leggen hun eieren op het gaasje ongeveer 2 dagen na de paring, wijzigt het gaas dagelijks. Verzamelen en bewaren gaas met eieren in dezelfde groei kamer (of kunstmatig klimaat chamber) als de volwassen vlinders tot de eieren uitkomen.
  4. Onmiddellijk overdracht pas uitgekomen larven om nieuwe 24-well platen, met één individu per putje.
  5. Vijf dagen na de eerste eierleggende datum, het verzamelen van de ouder motten en bewaar ze in vloeibare stikstof.
    LET OP: Het verzamelen van de motten 5 dagen na de eerste eierleggende date zorgt ervoor dat de ouders in leven zijn op het punt van de collectie en vermijdt daarom mogelijke gevolgen van het gebruik van dode motten op de nauwkeurigheid DNA-extractie.
  6. Isoleer genomisch DNA uit deze monsters met behulp van een DNA extractie kit volgens instructies van de fabrikant.
    1. Amplificeren een 574-bp fragment van het actine-gen met primers actine F / R actine (actine F: 5-CATCTACGAGGGTTACGC 3-actine en R: 5-CATCTGTTGGAAGGTGGA-3). Visualiseren de polymerasekettingreactie (PCR) producten met behulp van agarose gelelektroforese volgens standaard protocollen; de succesvolle versterking van het actine-gen zorgt ervoor dat het DNA is van goede kwaliteit.
    2. Assess thij aanwezig HaDV2 in de bovenliggende motten middels PCR met specifieke primers: DVVPF (GGATTGGCCTGGGAAATGAC) en DVVPR (CGTTGTTTTTATATCCGAGG) 31.
  7. Zodra een schone paar is geïdentificeerd, achter nakomelingen van die ene HaDV2-uninfected fokkenpaar minstens vijf generaties handhaven en dit als HaDV2-vrije kolonie (NONINF-stam); de HaDV2 geïnfecteerde kolonie wordt gedefinieerd als INF-stam.
  8. Om de HaDV2 infectie status in de NONINF-stam te bevestigen (en om het effect van bekende bacteriën of virussen op host-ontwikkeling uit te sluiten), evalueren de infectie status van HaDV2, Wolbachia, en H. armigera nucleopolyhedrovirus (HaNPV) in acht willekeurig gekozen larven individuen van de NONINF-stam onder toepassing van PCR (met specifieke primers: DVVPF / DVVPR voor HaDV2, NPVF / nPVR voor HaNPV en 81F / 691R voor Wolbachia 31, 33).
    LET OP: Het is bekend dat sommige virussen te laat zou kunnen zijnnt in de geïnfecteerde gastheer, met een niveau detecteerbaar zelfs bij gebruik van een PCR-gebaseerde techniek. NGS technologieën kunnen worden gebruikt om te bevestigen dat er geen virale sequenties die in het genomische DNA monsters.

2. Bereiding van HaDV2 bevattende vloeistof Fluids

OPMERKING: We hebben aangetoond dat de poging tot zuivering van de HaDV2 virusdeeltjes hun besmettelijkheid en de activiteit 31 remt; Daarom wordt het volgende protocol uitgevoerd om de infectieuze HaDV2 oplossing te komen door het filteren van de HaDV2-geïnfecteerde individuen.

  1. Verzamel volwassen motten afzonderlijk en direct opslaan in vloeibare stikstof.
  2. Geheel maal de verzamelde individuele motten in vloeibare stikstof met behulp van een gesteriliseerde mortier en stamper. Transfer ongeveer 10 ug puin schoon 1,5-ml buis. Draagt ​​de resterende resten een nieuwe buis en onmiddellijk opgeslagen bij -80 ° C.
  3. Extraheer DNA uit de 10 ug puin, following de protocollen van de fabrikant. Zodra de mot DNA is geïsoleerd, controleert HaDV2 behulp van het protocol, zoals beschreven in stap 1.6.
  4. Volgens de in stap 2.3 resultaten, verdeel het resterende vuil in twee groepen: HaDV2-positieve en HaDV2-negatief, afhankelijk van hun infectiestatus. Voeg 1 ml met fosfaat gebufferde zoutoplossing (PBS; 137 mM NaCl, 2,7 mM KCI, 8 mM Na2 HPO 4 en 1,5 mM KH 2PO 4, pH 7,5) aan elk individu volledig de resterende larvale puin lossen.
  5. Centrifugeer de homogenaat (uit stap 2.4) bij 6500 xg gedurende 15 min bij 4 ° C. Filtreer de bovenstaande vloeistof met een 0,22 urn membraanfilter. Verzamelen van de gefiltreerde vloeistof (200 pi per buis) en onmiddellijk opgeslagen bij -80 ° C.
    OPMERKING: De 0.22-um membraanfilter filtert meeste ongewenste deeltjes, bacteriën en schimmels. Eerst voorkoelen de centrifuge tot 4 ° C. Voer alle protocollen involving van de werking van de gefiltreerde vloeistof op ijs tot het homogenaat bruin kleurt en coagulatie te voorkomen.

3. Constructie van de HaDV2-geïnfecteerde katoenkever Colony

  1. Horizontale overdracht vermogen van HaDV2
    1. Genereer een HaDV2 standaard curve.
      1. Amplificeren van de fragmenten die primers (VPF: CTGGTGAGGCGATGGACATG; VPR: TGACAAGATCCAGCGTAGACATC) en probe (VP-probe: GCCACCACTAGAGGACCCACCAGATG), die worden gebruikt voor de kwantificering van HaDV2 virus, de de novo primers (PF: GGACAATGCTGGTGAGGC; PR: AATCCTCTTTGTCCGTTATCTATG). Met het volgende programma: 30 s bij 94 ° C, 30 seconden bij 53 ° C en 60 seconden bij 72 ° C gedurende 40 cycli van een PCR machine 31. Voeg 1 ul van genome DNA dat het genoom HaDV2 (stap 2.3) met de 25-pl PCR-reactie als matrijs DNA. Kloon de geamplificeerde fragmenten in een kloneringsvector volgens de protocollen van de fabrikant.
      2. Bereken het aantal kopieën vanplasmiden met de volgende vergelijking: kopieën / ul = (NA x C) / (n x M x 10 9), waarbij N A getal van Avogadro (6,02 x 10 23 moleculen / mol); C is de massaconcentratie van plasmiden (ng / pl), die kan worden gemeten met microspectrofotometrie; n is de lengte van recombinant plasmide dat het PCR-product (5195 bp); en M het molecuulgewicht van gemiddeld basenparen van dubbelstrengs DNA (660 g / mol).
      3. Bereid zes 10-voudige seriële verdunningen in 1,5 ml microcentrifuge buizen, met concentraties van 1,5 x 10 9, 1,5 x 10 8, 1,5 x 10 7, 1,5 x 10 6, 1,5 x 10 5 en 1,5 x 10 4 kopiegetal / ul.
      4. Een real-time kwantitatieve polymerase-kettingreactie (qPCR) gebruik van specifieke primers (VPF / VPR) en een sonde (VP-probe) fietsen thre genererenshold (CT) waarden van de in stap 3.1.1.3 beschreven plasmiden. Voer drie onafhankelijke technische herhalingen en het gemiddelde van hen voor verdere berekeningen.
      5. Met de bovenstaande resultaten genereren standaardkromme correleren log2-getransformeerde HaDV2 concentraties om de bijbehorende gemiddelde CT-waarden.
    2. Kwantificeren HaDV2 in de gefiltreerde vloeistof vloeistoffen.
      1. Pipet een 100 pl monster van gefilterde vloeistof fluïdum (stap 2.6) dat HaDV2 voor DNA-extractie.
      2. Gebruik realtime qPCR de CT waarden van de vloeibare media te verkrijgen en bereken het kopieaantal met de standaardcurve in stap 3.1.1.
    3. Bepaal de orale infectie efficiëntie HaDV2-geïnfecteerde gefiltreerde vloeistoffen met verschillende concentraties.
      1. Verdun de vloeibare vloeistof die HaDV2 de volgende concentraties: 10 8 10 7 10 6 10 5 10 4 en 0 kopieaantal / ul.
      2. Spreid de kunstmatige diet gelijkmatig op een 9 cm diameter Petrischaal voor stollen. Verdeel HaDV2-bevattende gefiltreerde vloeistof (200 pl) voor elke concentratie aan het oppervlak van de vaste kunstmatige voeding. Doe dit in een zuurkast.
      3. Transfer 100 vers uitgebroede larven van de HaDV2 bevattende kunstmatige voeding in een petrischaal. Voorzichtig klop het gaasje (waaronder vers-larven) om de larven te brengen van het gaas tot een vel wit papier. Klop het papier voorzichtig, zodat de larven spin-zijde en "ballon" van het papier. Gebruik gesteriliseerde tang om de zijde voelt en waarbij u de larven naar een petrischaal.
      4. Na 48 uur en spoel de larven op het kunstmatige voeding met 24 putjes (één persoon per putje).
      5. Achter de larven geënt met HaDV2 op het hierboven vermelde concentraties aan het volwassen stadium.
      6. Verzamel de volwassen motten, extraheer het DNA te detecteren HaDV2 behulp van PCR, zoals beschreven in stap 1.5.
        OPMERKING: Hier, het verkrijgen van een 100% HaDV2 infectiepercentage van de cotton bollworms met de 10 8 aantal kopieën / ul te beantwoorden en aldus de HaDV2 geïnfecteerde kolonie (INF-stam).
  2. Verticale overdracht vermogen van HaDV2
    1. negatief voor: -; positief voor HaDV2 infectie: Select volwassen vlinders uit de NONINF en INF-stammen tot enkele paren van ♀- / ♂-, ♀ + / ♂-, ♀- / ♂ + en ♀ + / ♂ + (+ genereren HaDV2 infectie).
    2. Breng de nakomelingen van de bovengenoemde paren om virusvrije 24-putjesplaten; achter de larven naar het derde instar.
    3. Extraheer het DNA uit de verzamelde derde instar larven gebruikt als sjabloon om de aanwezigheid van HaDV2 bepalen, zoals beschreven in stap 1.5.

4. Tissue Verdeling van HaDV2

  1. Besmetting door virussen en bacteriën te voorkomen, steriliseren de tang en schaar in 75% ethanol drie keer en verwarm ze in de vlam van een alcohol lamp.
    OPMERKING: Forceps sterilization is noodzakelijk wanneer vuil.
  2. Onder toepassing van een analytische balans, wegen de lege buizen die worden gebruikt om de weefsels te slaan.
  3. Plaats de larven en volwassen motten van het INF-stam op ijs gedurende ongeveer 5 min.
  4. Ontleden de volgende weefsels onder een stereomicroscoop larven, volwassen vrouwen en volwassen mannen in een schone petrischaal met PBS-buffer.
    1. Larven Pipetteer hemolymfe en het ontleden voordarm, middendarm, dikke darm, dikke-lichaam en Malpighi buisjes (figuur 1A). Onmiddellijk elk weefsel overbrengen naar de buizen in vloeibare stikstof.
      1. Bevestig de bevroren larven van insecten cystosepiment behulp van twee pennen (200 pm in diameter, 20 mm lang), inbrengen in de intersegmentale membranen bij het hoofd en de laatste abdomen segment (Figuur 1A).
      2. Snijd de Proleg in het achterste buik van de larven, zodat de larven hemolymfe stroomt. Pipetteer de larvale hemolymfe binnen 10 s met behulp van een microfipette om bruinkleuring en coagulatie van de hemolymfe te voorkomen.
        OPMERKING: fenylthioureum (50 ug / ml) worden gemengd in een 01:20 v / v verhouding met hemolymfe te melanisatie voorkomen.
      3. Met behulp van een schaar, een insnijding in de cuticula variërend van de laatste intersegmentale membraan naar de weg. Ontleden alle resterende weefsels onder een stereomicroscoop met behulp van twee tang; het beeld voor elk weefsel wordt getoond in figuur 1A.
      4. Meng weefselmonsters van drie individuen als één repliceren.
      5. Om de verontreiniging van de resterende weefsels met de hemolymfe tijdens de dissectie te voorkomen, was de ontleed weefsel in PBS buffer driemaal. Test vervolgens de HaDV2-infectie status van de PBS gebruikt voor het wassen. Als de laatste wasbehandeling buffer HaDV2-vrij, dient het weefsel vrij van verontreiniging met hemolymfe worden.
    2. Voor volwassen vrouwtjes, ontleden het hoofd (hersenen), spieren, vet-lichaam, darm, Malpighian buisjes en ovarium (Figuur 1B) onder een stereomicroscoop in PBS-buffer. Voor volwassen mannen, ontleden de kop (hersenen), spieren, vet lichaam, darm, Malpighian tubuli en testis (Figuur 1 C) onder een stereomicroscoop in PBS-buffer. Onmiddellijk elk weefsel overbrengen naar de buizen in vloeibare stikstof.
      1. Met behulp van een tang en schaar, verwijder de vleugels van de volwassen vlinders en was de resterende lichaam drie keer om de schalen te wissen.
      2. Scheid de kop, borststuk en achterlijf met een schaar.
      3. Verwijder de endoskeleton van de thorax en het verzamelen van de spier.
      4. Behulp van een tang, verwijder de cuticula van de buik en ontleden de andere weefsels volgende figuren 1B en 1C.
      5. Meng de weefselmonsters van drie individuen als één repliceren. Was de ontleed weefsel in PBS buffer driemaal.
  5. Weeg de buizen en de bovenstaande weefsels nadat ze zijn bevroren en dat de mezels van de verschillende weefsels zijn nagenoeg gelijk.
    Massa (weefsels) = massa (buizen / weefselmonster) - massa (alleen buis)
  6. Extraheer het DNA uit deze weefsels en qPCR voeren, zoals beschreven in stap 3.1.2.
  7. Bereken het aantal kopieën per mg van elk weefsel met behulp van de standaardcurve gegenereerd in stap 3.1.1. Met de virustiter per massaeenheid te corrigeren voor de vertekening monster veroorzaakt door een verschil in de hoeveelheid weefsel die voor DNA-extractie.
  8. Bereken het percentage HaDV2 in het specifieke weefsel als volgt: percentage van HaDV2 voor elk weefsel = HaDV2 aantal kopieën per mg geteste weefsels / (som van kopieaantal per mg van weefsel).

5. Bioassays testen van het effect van HaDV2 op Host Ontwikkeling

  1. Plaats tenminste 100 poppen of nieuw gebleken volwassen motten afgeleid van de NONINF-stam in een katoenen gaas bedekte, 5-L, gaas kooi. Na 2 dagen, zullen gepaard volwassen vrouwtjes beginnen om eieren te leggen op het gaasje. Verzamelen en bewarenhet gaasje waarin de eieren; de eitjes in ongeveer drie dagen.
  2. Enten van de pasgeborene larven met HaDV2.
    1. Breng de pasgeborene larven van de NONINF-stam aan de kunstmatige voeding met HaDV2 (10 8 aantal kopieën / ul) om het INF-stam vast te stellen.
    2. Evenzo dragen pasgeboren larven tot kunstmatige voeding bedekt met HaDV2-vrije gefiltreerde vloeistof (stap 2.4) met de controlegroepen (NONINF-stam) vast. Ten minste 240 larven in elke behandeling (Figuur 2A).
      OPMERKING: Larven die worden gebruikt om de NONINF- en INF-stammen te construeren zijn afgeleid van dezelfde oorspronkelijke cohort en komen tegelijkertijd, zodat dezelfde genetische achtergrond. Zorg ervoor dat de NONINF- en INF-stammen in dezelfde klimaatkamer bewaard (bij 25 ± 1 ° C met 14 uur licht / 10 uur donker en 60% relatieve vochtigheid) gedurende een synchrone snelheid van ontwikkeling; de snelheid kan variëren afhankelijk van temperatuur en luchtvochtigheid. Behandel de delicaten larven voorzichtig.
  3. Na 48 uur, breng de larven afzonderlijk 24 putjes (één persoon per putje) (Figuur 2B).
    1. Opeenvolgend nummer elke larve in elk putje en noteer de instar stadium en status overleving dagelijks.
    2. Ongeveer 5 dagen later, toen de kunstmatige voeding verslechtert, tegelijkertijd deze mensen over te dragen aan een nieuwe 24-well plaat met verse kunstmatige voeding (Figuur 2C).
    3. Weeg de larven van dag 7-11 na uitbroeden via een analytische weegschaal met een nauwkeurigheid van 0,0001 g. Na het wegen individueel de larven terug naar de 24-well plaat.
  4. Na vervellen tot het vijfde stadium na de vierde vervelling (ongeveer tien dagen na uitkomen), breng de larven glazen buizen (10 cm hoog, diameter 2 cm) (Figuur 2D); vijfde instar larven kunnen ook worden geïdentificeerd door de breedte van de capsule (ongeveer 2,6 mm).
    OPMERKING: Breng de individuende glazen buis op hetzelfde tijdstip van de dag.
    1. Code elke larve met de oorspronkelijke cijfercombinatie van de glasbuis via verf of stiften. Noteer het larvale staat dagelijks; in de glazen buizen, de larven verpoppen na ongeveer vijf dagen the popstadium duurt ongeveer 11 dagen.
    2. Noteer de poppen en eclosion datum voor elk individu in de glazen buis. Noteer de massa van 3 dagen oude poppen.
  5. Na eclosion, zet een vrouwelijke en een mannelijke in een kooi met 10% sucrose en 2% vitamineoplossing (figuur 2E). Vullen de sucrose oplossing elke dag. Noteer de datum van overlijden voor elke nachtvlinder.
  6. Wanneer eieren worden gelegd, veranderen de katoenen gaas dagelijks. Tel het aantal eieren onmiddellijk. Count pas uitgekomen nakomelingen terwijl ze uitkomen.
  7. Tijdens de bioassays, selecteert willekeurig acht personen voor elke behandeling om de infectie status van HaDV2 bevestigen. Extraheer het totale RNA van deze monsters met behulp van commerciële trypsine reagensvolgens het protocol van de fabrikant. Synthetiseren de eerste streng cDNA volgens het protocol van de fabrikant en gebruik het als een sjabloon om te testen of de virussen met succes worden getranscribeerd.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Nakomelingen van de ouders die HaDV2 free (figuur 3A) werden opgefokt als NONINF-stam. We met succes geamplificeerd het actine-gen met gelijke DNA templates, wat suggereert dat de DNA-matrijzen waren van goede kwaliteit (Figuur 3B). Bovendien, de willekeurig geselecteerde acht nakomelingen waren ook vrij van HaDV2 (figuur 3C), HaNPV (Figuur 3D) en Wolbachia (figuur 3E). Nogmaals, we geconcludeerd dat de DNA-monsters van de nakomelingen waren van goede kwaliteit, omdat een gedeelte van actine gen werd geamplificeerd met succes voor alle geteste monsters (Figuur 3F).

Een standaardcurve waarin de relatie tussen de logaritme van de kwaliteit van het uitgangsmateriaal en de opgedane CT-waarden gegenereerd, zoals in figuur 4. Een sterke lineaire correlatie (R (figuur 4).

Pas uitgekomen larven werden met een punt standaardcurve van HaDV2 vloeibare fluïda via 10-voudige seriële verdunningen tussen 10 4 en 10 8 kopieaantal / ul. We verkregen een lineaire correlatie tussen de frequentie infecties en de concentraties van de HaDV2 vloeibare media; 10 8 kopieaantal / ul leverde 100% infectie van de katoenkever, maar andere concentraties niet (zie ook Xu et al. 31). De HaDV2 infectie frequenties van de nakomelingen van de ouders met verschillende HaDV2 infectie statussen waren als volgt: 100% voor ♀ + / ♂-, 78% voor ♀- / ♂ +, en 100% voor ♀ + / ♂ + (zie ook Xu et al. 31).

om correct individuele verschillen in titer HaDV2 berekenden we het HaDV2 kopieaantal per mg van elk weefsel en het percentage van de totale HaDV2 titer van het specifieke weefsel. Uit de resultaten bleek dat vooral HaDV2 werd verdeeld in het vet lichaam (figuur 5; zie ook Xu et al. 31). Vergelijkingen van de overlevingstafel parameters, zoals de larven, tijdvakken poppen, volwassen lengte en vruchtbaarheid, getoond in tabel 1 (zie ook Xu et al. 31). Het larvale en popstadium massa waren zoals gepubliceerd door Xu et al. 31. De HaDV2 infectie statussen zowel de NONINF-stam en de INF-stam werden bepaald door PCR (gepubliceerde resultaten door Xu et al. 31).

Figuur 1
Figuur 1 Ontlede weefsels voor (A) Larven, (B) eenVrouwelijke volwassen, en (C) een mannelijke volwassene. H, kop (hersenen); Hij, hemolymph; FB, dik lichaam; Mt, Malpighian buisjes; G, gut; FG, voordarm; MG, midgut; HG, hindgut; Mu, spieren; O, ovarium; T, testis. Klik hier om een grotere versie van deze afbeelding te bekijken.

Figuur 2
Figuur 2. Biobepaling Procedure om de effecten van HaDV2 Bepaal op het katoenkever. (A) Enten van de pas uitgekomen larven HaDV2. (B) De overdracht van de HaDV2 geïnfecteerde en HaDV2-vrije individuen met 24 putjes na 48 uur. (C) Verschillende maten HaDV2-geïnfecteerde en -vrij individuen. (D) Overdracht van vijfde instar larven nieuwe glazen buizen (10 cm hoog, diameter 2 cm). (E) De plaatsing van eenvrouwelijke en een mannelijke motten in dezelfde kooi volwassen levensduur, eiproductie, en komen bepalen. Klik hier om een grotere versie van deze afbeelding te bekijken.

figuur 3
Figuur 3. Infectie Status voor HaDV2, HaNPV of Wolbachia in HaDV2-geïnfecteerde en HaDV2-vrij Colonies. HaDV2 infectie status in de vrouwelijke en mannelijke ouders (A). Infectiestatus van HaDV2 (C), HaNPV (D) en Wolbachia (E) in de willekeurig geselecteerde nakomelingen. Om de kwaliteit van genomisch DNA te controleren, werd het huishoud-gen geamplificeerd actine ook voor de ouders (B) en nakomelingen (F). Laan M toont de DL2000 marker (2000 bp, 1000 bp, 750 bp, 500 bp, 250 bp, eend 100 bp). Laan 1: vrouwelijke ouder. Laan 2: mannelijke ouder. Laan 3-10: nakomelingen. Klik hier om een grotere versie van deze afbeelding te bekijken.

figuur 4
Figuur 4. De standaardcurve correleren log2-getransformeerde concentraties HaDV2 Cycle Drempel (CT) waarden. Klik hier om een grotere versie van deze afbeelding te bekijken.

figuur 5
Figuur 5. Host-weefsel Verdeling van HaDV2 in Larven (A), Volwassen Vrouwelijke (B), en Adult Man (C) Cotton bollworms. Percentage (%) = de verhouding van HaDV2 in verschillende weefsels (per mg), zoals beschreven in stap 4.7 De gegevens werden statistisch geanalyseerd met variantieanalyse (ANOVA) en Tukey's test (larven: n = 7; volwassen mannen: n = 6; volwassen vrouwtjes: n = 6). Betekent ± SE. De resultaten werden gepubliceerd door Xu et al. 31. Klik hier om een grotere versie van deze afbeelding te bekijken.

Life-history parameters HaDV2 + HaDV2- t-waarde df P-waarde
Larvale periode (dagen) Mannetje 16.51 (± 0.72) 16.93 (± 1.21) 4.147 379 <0,001
Vrouw 16.51 (± 0.79) 16.80 (± 1.05) 2.732 312 0,0067
Pupal periode (dagen) Mannetje 13,02 (± 0,68) 13.31 (± 0.69) 4.057 379 <0,001
Vrouw 11,62 (± 0,67) 12.00 (± 0.63) 5.1 312 <0,001
Levensduur van volwassen (dagen) Mannetje 10,69 (± 1,98) 10,93 (± 2,46) 0,915 367 0.36
Vrouw 9,07 (± 1,98) 8,51 (± 1,58) 2.992 367 0,003
Aantal geproduceerde eieren per vrouw 482 (± 174) 403 (± 180) 2.172 93 0,032
Aantal arceringen per vrouwelijke 207 (± 108) 143 (± 99) 3.026 93 0,0032

Tabel 1. Life-history parameters voor HaDV2 + en HaDV2-katoen bollworms. Student t-test wordt gebruikt om het niveau van betekenis te bepalen. Gemiddelden ± SE getoond. De gegevens in deze tabel werden gepubliceerd door Xu et al. 31.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

In de afgelopen decennia meeste studies over insecten virus interacties gericht op honingbij gezondheid 34, 35, 36, vectoren voor humane ziekten 37, plantenvirussen 38 Sommige insecten pathogene virussen die een groot potentieel als biologische controlemiddelen 39 zijn. Weinig aandacht is besteed aan geheime virussen bij insecten, vooral in lepidoptera. Hier presenteren we een protocol voor de studie van de wisselwerking tussen een bedekte virus en de gastheer insect. Een vergelijking van het leven tafel parameters voor virus-geïnfecteerde en virusvrij gastheer individuen moeten idealiter elk effect van verschillen in de gastheer genetische achtergrond te sluiten. Om de virale fenotype te bestuderen, hebben veel eerdere studies het leven tafel parameters van een van beide natuurlijk geïnfecteerde of niet-geïnfecteerde individuen in dezelfde kolonie of individuen ingeënt vergelekendoor micro-injectie, maar deze inspanning is tijdrovend 23, 40. De orale inoculatie van katoen bollworms met HaDV2, hier beschreven, dient als een eenvoudige en effectieve manier om virale fenotype te analyseren. Deze procedure zorgt er ook voor dezelfde genetische achtergrond voor HaDV2-geïnfecteerde en HaDV2-niet-geïnfecteerde kolonies.

Virus entstof kunnen worden bereid op vele manieren. Het zuiveren van virusdeeltjes met behulp van high-speed centrifugatie remt virusinfectiviteit, wat resulteert in lage infectiviteit; daarom werd virus bevattende gefiltreerde vloeistof gebruikt voor het katoenbolworm 31 larven te infecteren. Dat de 0,22 urn membraan kan filteren meeste schimmel- en bacteriële deeltjes uit HaDV2-bevattende gefiltreerde vloeistof en dat de HaDV2-vrije gefiltreerde vloeistof werd als controle gebruikt kan het effect van andere virussen op onze uitsluiten. Echter, kunnen we de mogelijkheid niet uitsluiten dat de biologische resultaten kunnen eenLSO worden vertekend door onbekende virussen. Vandaar HaDV2 deeltjes met een hoge besmettelijkheid moet idealiter worden gezuiverd in de toekomst om robuuste resultaten te verkrijgen.

De virusconcentratie positief gecorreleerd met virusinfectiviteit; vandaar, waren we geïnteresseerd in het bepalen van de HaDV2 concentratie die 100% infectie oplevert. Onze resultaten toonden aan dat de 10 8 aantal kopieën / ul zou kunnen worden gebruikt voor het virus inenting deze infectie tarief te verkrijgen. Ongetwijfeld moet de correlatie tussen virus titer en infectie tarief worden bestudeerd voor andere virus-gastheer interacties bestudeerd in de toekomst. Daarnaast dient de virustiter van elk individu in het veld worden onderzocht. Daarom konden we vervolgens simuleren het effect van virussen op individuen in het veld.

De voorzichtige behandeling van de delicate larven tijdens de eerste paar dagen nadat ze uitkomen is erg belangrijk, omdat ze gemakkelijk fataal beschadigd. Bovendien is de HaDV2-uninfected colony dient afzonderlijk in de kas gehouden HaDV2 voorkomen contaminatie het infectiepercentage van HaDV2 gebleken zeer hoog, zowel op het terrein als in het laboratorium 31.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs verklaren dat zij geen concurrerende financiële belangen.

Acknowledgments

Dit werk werd ondersteund door de National Key Basic Research Program van China (Nr 2013CB127602) en de Wetenschap Fonds voor Creative Onderzoeksgroepen van de National Science Foundation of China (nr 31321004).

Materials

Name Company Catalog Number Comments
24-well plate Corning 07-200-740 Multiple suppliers available.
DNA extraction kit TIANGEN DP304-03 Multiple suppliers available.
thermal cycler Veriti; Applied Biosystems 4375786
PBS Corning 21-040-CV
0.22 µm membrane filter Millipore SLGS025NB
pEASY-T Cloning Vector TransGen, Beijing, China CT301-02
Tweezers IDEAL-TEK 2.SA
Premix Ex Taq (Probe qPCR) Takara RR390A
Probes Invitrogen Custom order
Primers Invitrogen Custom order
microspectrophotometry NanoDrop 2000c  Thermo scientific  not available
7500 Real-Time PCR system Applied Biosystems not available
stereomicroscope SZX-16 Olympus not available
sucrose Multiple suppliers available.
vitamin complex Multiple suppliers available.

DOWNLOAD MATERIALS LIST

References

  1. Tang, P., Chiu, C. Metagenomics for the discovery of novel human viruses. Future Microbiol. 5, 177-189 (2010).
  2. Rosario, K., Breitbart, M. Exploring the viral world through metagenomics. Curr. Opin. Virol. 1, 289-297 (2011).
  3. Hugenholtz, P., Tyson, G. W. Microbiology - metagenomics. Nature. 455, 481-483 (2008).
  4. Kristensen, D. M., Mushegian, A. R., Dolja, V. V., Koonin, E. V. New dimensions of the virus world discovered through metagenomics. Trends Microbiol. 18, 11-19 (2010).
  5. Kleiner, M., Hooper, L. V., Duerkop, B. A. Evaluation of methods to purify virus-like particles for metagenomic sequencing of intestinal viromes. BMC Genomics. 16, 7 (2015).
  6. Ho, T., Tzanetakis, I. E. Development of a virus detection and discovery pipeline using next generation sequencing. Virology. 471, 54-60 (2014).
  7. Marx, C. J. Can you sequence ecology? Metagenomics of adaptive diversification. PLoS Biol. 11, e1001487 (2013).
  8. Radford, A. D., et al. Application of next-generation sequencing technologies in virology. J. Gen. Virol. 93, 1853-1868 (2012).
  9. Liu, S. J., Chen, Y. T., Bonning, B. C. RNA virus discovery in insects. Curr. Opin. Insect Sci. 8, 54-61 (2015).
  10. Mokili, J. L., Rohwer, F., Dutilh, B. E. Metagenomics and future perspectives in virus discovery. Curr. Opin. Virol. 2, 63-77 (2012).
  11. Liu, S. J., Vijayendran, D., Bonning, B. C. Next generation sequencing technologies for insect virus discovery. Viruses-Basel. 3, 1849-1869 (2011).
  12. Cook, S., et al. Novel virus discovery and genome reconstruction from field RNA samples reveals highly divergent viruses in Dipteran hosts. PLoS ONE. 8, e80720 (2013).
  13. Webster, C. L., et al. The discovery, distribution, and evolution of viruses associated with Drosophila melanogaster. PLoS Biol. 13, e1002210 (2015).
  14. Granberg, F., et al. Metagenomic detection of viral pathogens in spanish honeybees: co-infection by aphid lethal paralysis, israel acute paralysis and lake sinai viruses. PLoS ONE. 8, e57459 (2013).
  15. Runckel, C., et al. Temporal analysis of the honey bee microbiome reveals four novel viruses and seasonal prevalence of known viruses, Nosema, and Crithidia. PLoS ONE. 6, 20656 (2011).
  16. Cox-Foster, D. L., et al. A metagenomic survey of microbes in honey bee colony collapse disorder. Science. 318, 283-287 (2007).
  17. Chandler, J. A., Liu, R. M., Bennett, S. N. RNA shotgun metagenomic sequencing of northern California (USA) mosquitoes uncovers viruses, bacteria, and fungi. Front. Microbiol. 6, 185 (2015).
  18. Shi, C. Y., et al. A metagenomic survey of viral abundance and diversity in mosquitoes from Hubei province. PLoS ONE. 10, e0129845 (2015).
  19. Nouri, S., Salem, N., Nigg, J. C., Falk, B. W. Diverse array of new viral sequences identified in worldwide populations of the Asian citrus psyllid (Diaphorina citri) using viral metagenomics. J. Virol. 90, 2434-2445 (2016).
  20. Dayaram, A., et al. Identification of diverse circular single-stranded DNA viruses in adult dragonflies and damselflies (Insecta Odonata) of Arizona and Oklahoma, USA. Infect. Genet. Evol. 30, 278-287 (2015).
  21. Jakubowska, A. K., et al. Simultaneous occurrence of covert infections with small RNA viruses in the lepidopteran Spodoptera exigua. J.Invert. Pathol. 121, 56-63 (2014).
  22. Roossinck, M. J. Move over, Bacteria! Viruses make their mark as mutualistic microbial symbionts. J. Virol. 89, 6532-6535 (2015).
  23. Ryabov, E. V., Keane, G., Naish, N., Evered, C., Winstanley, D. Densovirus induces winged morphs in asexual clones of the rosy apple aphid, Dysaphis plantaginea. Proc. Natl. Acad. Sci. USA. 106, 8465-8470 (2009).
  24. Roossinck, M. J. The good viruses: viral mutualistic symbioses. Nat. Rev. Microbiol. 9, 99-108 (2011).
  25. Venkataraman, S., et al. Structure of seneca valley virus-001: an oncolytic picornavirus representing a new genus. Structure. 16, 1555-1561 (2008).
  26. Deterding, K., et al. Hepatitis a virus infection suppresses hepatitis c virus replication and may lead to clearance of hcv. J. Hepatol. 45, 770-778 (2007).
  27. Barton, E. S., et al. Herpesvirus latency confers symbiotic protection from bacterial infection. Nature. 447, 326-329 (2007).
  28. Ponferrada, V. G., Mauck, B. S., Wooley, D. P. The envelope glycoprotein of human endogenous retrovirus herv-w induces cellular resistance to spleen necrosis virus. Arch. Virol. 148, 659-675 (2003).
  29. Márquez, L. M., Redman, R. S., Rodriguez, R. J., Roossinck, M. J. A virus in a fungus in a plant: three-way symbiosis required for thermal tolerance. Science. 315, 513-515 (2007).
  30. Xu, P. J., et al. Complete genome sequence of a monosense densovirus infecting the cotton bollworm, Helicoverpa armigera. J. Virol. 86, 10909-10909 (2012).
  31. Xu, P. J., Liu, Y. Q., Graham, R. I., Wilson, K., Wu, K. M. Densovirus is a mutualistic symbiont of a global crop pest (Helicoverpa armigera) and protects against a baculovirus and Bt biopesticide. PLoS Pathog. 10, e1004490 (2014).
  32. Liang, G. M., Tan, W. J., Guo, Y. Y. An improvement in the technique of artificial rearing cotton bollworm. Plant Protec. 25, 15-17 (1999).
  33. Zhou, W. G., Rousset, F., O'Neill, S. Phylogeny and PCR-based classification of Wolbachia strains using wsp gene sequences. P. Roy. Soc. B-Biol. Sci. 265, 509-515 (1998).
  34. Mondet, F., de Miranda, J. R., Kretzschmar, A., Le Conte, Y., Mercer, A. R. On the front line: quantitative virus dynamics in honeybee (Apis mellifera L.) colonies along a new expansion front of the parasite Varroa destructor. PLoS Pathog. 10, e1004323 (2014).
  35. Chen, Y. P., et al. Israeli acute paralysis virus: epidemiology, pathogenesis and implications for honey bee health. PLoS Pathog. 10, e1004261 (2014).
  36. Hunter, W., et al. Large-scale field application of RNAi technology reducing israeli acute paralysis virus disease in honey bees (Apis mellifera, Hymenoptera: Apidae). PLoS Pathog. 6, e1001160 (2010).
  37. Halstead, S. B. Dengue virus - mosquito interactions. Annu. Rev. Entomol. 53, 273-291 (2008).
  38. Whitfield, A. E., Falk, B. W., Rotenberg, D. Insect vector-mediated transmission of plant viruses. Virology. 479-480, 278-289 (2015).
  39. Moscardi, F. Assessment of the application of baculoviruses for control of Lepidoptera. Annu. Rev. Entomol. 44, 257-289 (1999).
  40. Szelei, J., et al. Susceptibility of North-American and European crickets to Acheta domesticus densovirus (AdDNV) and associated epizootics. J. Invert. Pathol. 106, 394-399 (2011).
Protocollen voor het onderzoeken van de host-weefsel Distribution, transmissie-mode, en het effect op de Host Geschiktheid van een Densovirus in de katoenkever
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Yang, X., Xu, P., Graham, R. I., Yuan, H., Wu, K. Protocols for Investigating the Host-tissue Distribution, Transmission-mode, and Effect on the Host Fitness of a Densovirus in the Cotton Bollworm. J. Vis. Exp. (122), e55534, doi:10.3791/55534 (2017).More

Yang, X., Xu, P., Graham, R. I., Yuan, H., Wu, K. Protocols for Investigating the Host-tissue Distribution, Transmission-mode, and Effect on the Host Fitness of a Densovirus in the Cotton Bollworm. J. Vis. Exp. (122), e55534, doi:10.3791/55534 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter