Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Protocoles pour étudier l'hôte d'un tissu de distribution, en mode de transmission, et l'effet sur la remise en forme de l'hôte d'un Densovirus dans le coton Heliothis

doi: 10.3791/55534 Published: April 12, 2017

Summary

Nous présentons ici un protocole pour étudier la distribution hôte tissus, mode de transmission, et l'effet sur l'aptitude hôte d'un densovirus au sein d'une espèce lépidoptères, le ver de la capsule. Ce protocole peut être utilisé pour étudier l'interaction entre autres virus transmis oralement et leurs hôtes d'insectes.

Abstract

De nombreux nouveaux virus ont été découverts chez des hôtes animaux en utilisant des technologies de séquençage de nouvelle génération. Auparavant, nous avons signalé un virus mutualisme, Helicoverpa armigera densovirus (HaDV2), dans une espèce lépidoptères, le ver de la capsule, Helicoverpa armigera (Hubner). Ici, nous décrivons les protocoles qui sont actuellement utilisés pour étudier l'effet de HaDV2 sur son hôte. Tout d'abord, nous établissons un ver de la capsule sans HaDV2 colonie à partir d'une seule paire d'élevage. Ensuite, nous inocule par voie orale une progéniture avec des larves HaDV2-nouveau-né contenant du liquide filtré pour produire deux colonies avec le même fond génétique: une infection HaDV2, l'autre non infectées. Un protocole pour comparer les paramètres du tableau de vie (par exemple, des larves, des pupes et les périodes d'adulte et de la fécondité) entre les individus infectés par le HaDV2 et -uninfected est également présentée, ainsi que les protocoles de détermination de la distribution hôte tissu et l' efficacité de transmission de HaDV2. Ces protocoles woULD également adapté pour étudier les effets d'autres virus transmis oralement sur leurs hôtes d'insectes hôtes, en particulier lépidoptères.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Au cours des dernières décennies, a facilité la découverte de nombreux virus d'ADN et d' ARN nouveaux, les virus en particulier non pathogènes, mais aussi des isolats nouveaux de virus connus précédemment 1, 2, 3 le développement de la technologie de séquençage telles que le séquençage de prochaine génération (NGS), 4, 5, 6, 7, 8, 9, 10, 11, 12. Dans l'organisme modèle Drosophila melanogaster, plus de 20 nouveaux génomes viraux partiels ont été détectés en utilisant des techniques métagénomiques 13. De nombreuses séquences virales, y compris de nouveaux virus, ont également été identifiés dans d'autres insectes, comme les abeilles, mosquitoes, les psylles d'agrumes asiatiques, libellules, et plusieurs espèces de lépidoptères 14, 15, 16, 17, 18, 19, 20, 21.

À l'avenir, on peut penser que les virus plus de nouveaux seront découverts chez les insectes à l'aide de ces technologies de pointe; Par conséquent, notre compréhension de l'interaction virus-hôte peut changer en conséquence 6, 9. Par exemple, les interactions virus-hôte sont considérées comme plus compliquée qu'on ne le pensait, parce que beaucoup de nouveaux virus sont définis comme des partenaires plutôt que des agents pathogènes mutualisme stricts 22. Par exemple, le DplDNV mutualisme de densovirus dans Dysaphis plantaginea induit ailé Morph et augmente la mobilité, ce qui facilite la dispersion de l'hôte ainsi que le virus 23. De plus, les virus mutualisme ont été décrits en ce qui concerne la santé des mammifères, la sécheresse et la tolérance au froid des plantes, et l'impact des infections bactériennes 24. Vallée Seneca virus-001 est montré à la médiation cytotoxicité sélective vers les cellules tumorales avec le cancer neuroendocrine comporte 25. L' hépatite A infections virales répriment la réplication du virus de l' hépatite C et peut conduire à la récupération de l' hépatite C 26. Temps d' attente herpèsvirus confère une protection contre l' infection bactérienne symbiotique 27. La glycoprotéine d'enveloppe du rétrovirus endogène humain HERV-W induit une résistance cellulaire au virus de la nécrose de la rate 28. le virus de la tolérance thermique Curvularia (CThTV) à partir d'un champignon endophyte est impliqué dans l'interaction mutualisme entre ce champignon et une panic tropicaleref "> 29. Par conséquent, la connaissance des interactions entre les virus nouvellement trouvés et leurs hôtes devrait générer de nouvelles perspectives sur leur biologie et de gestion. Cependant, les nouveaux virus, en particulier les virus cachés présentant aucun signe typique d' une infection aiguë, ont rarement été étudié, et nous avons besoin d'un pipeline et des protocoles pour étudier les impacts des nouveaux virus trouvés sur leurs hôtes.

Auparavant, nous avons rapporté la prévalence d' une nouvelle monosense densovirus Helicoverpa armigera densovirus (HaDV2) dans le ver de la capsule, Helicoverpa armigera, et présenté la preuve d'une relation de mutualisme entre HaDV2 et la noctuelle 30 de coton, 31. Dans cet article, nous allons décrire le protocole de laboratoire pour étudier en détail l'interaction entre HaDV2 et son hôte ver de la capsule. Le protocole présenté ici peut également être très utile pour les chercheurs qui examinent la role d'autres virus transmis par voie orale, en particulier dans les lépidoptères nuisibles.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. La construction de la libre HaDV2-Cotton Colony Heliothis

  1. Coton arrière larves de noctuelle (H. armigera) sur un régime artificiel 32 dans une chambre de croissance contrôlée ou une chambre climatique artificielle à 25 ± 1 ° C, avec 14 h de lumière / 10 h d' obscurité et 60% d' humidité relative.
  2. Faciliter l'accouplement unique paire de papillons nouvellement éclos à l'aide d'une cage en matière plastique par paire (hauteur 10 cm, diamètre 5 cm) recouvert d'une gaze de coton pour assurer une bonne ventilation et de servir en tant que substrat d'oviposition. Pour augmenter la probabilité d'obtenir une colonie exempte de virus, d'utiliser au moins 30 paires de saillies seule paire. Alimentation papillons adultes avec 10% de sucre et 2% de solution de vitamine 32 imbibés sur une boule de coton et rempli tous les jours.
  3. Comme les adultes femelles pondent leurs œufs sur la gaze de coton environ 2 jours après l'accouplement, changer la gaze par jour. Recueillir et maintenir gaze contenant des œufs dans la même pièce de croissance (ou artificielle climat ChamsTEB) que les papillons adultes jusqu'à l'éclosion des oeufs.
  4. transférer immédiatement les larves nouvellement éclos de nouvelles plaques à 24 puits, avec un individu par puits.
  5. Cinq jours après la première date de ponte, recueillir les papillons de nuit de parents et de les stocker dans de l'azote liquide.
    NOTE: La collecte des papillons de nuit 5 jours après la première date de ponte assure que les parents sont en vie au moment de la collecte et évite donc les impacts possibles de l'utilisation des papillons morts sur la précision d'extraction d'ADN.
  6. Isoler l'ADN génomique à partir de ces échantillons en utilisant un kit d'extraction d'ADN selon les instructions du fabricant.
    1. Amplifier un fragment de 574 pb du gène de l'actine actine avec des amorces F / R d'actine (actine F: 5-CATCTACGAGGGTTACGC-3 et de l'actine R: 5-CATCTGTTGGAAGGTGGA-3). Visualiser la réaction en chaîne par polymérase produits (PCR) en utilisant une électrophorèse sur gel d'agarose selon des protocoles standards; l'amplification réussie du gène d'actine assure que l'ADN est de bonne qualité.
    2. évaluer til présence d'HaDV2 dans les papillons mères en utilisant la PCR avec des amorces spécifiques: DVVPF (GGATTGGCCTGGGAAATGAC) et DVVPR (CGTTGTTTTTATATCCGAGG) 31.
  7. Une fois une paire propre a été identifiée, progéniture arrière à partir de cette seule paire d'élevage séronégatifs pour HaDV2 pendant au moins cinq générations et maintenir ce que la colonie libre HaDV2 (NONINF-souche); la colonie infectée par HaDV2 est définie comme la INF-souche.
  8. Pour confirmer l'état d'infection HaDV2 dans la NONINF-souche (et d'exclure l'effet des bactéries connues ou virus sur le développement hôte), d' évaluer l'état d'infection pour HaDV2, Wolbachia et H. armigera nucleopolyhedrovirus (HaNPV) dans huit individus larves choisies au hasard du NONINF-déformation en utilisant la PCR (avec des amorces spécifiques: DVVPF / DVVPR pour HaDV2, NPVF / NPVR pour HaNPV et 81F / 691R pour Wolbachia 31, 33).
    NOTE: Il est connu que certains virus pourraient être en retardnt dans l'hôte infecté, avec un niveau indétectable, même en utilisant une technique basée sur la PCR. technologies NGS pourraient être utilisées pour confirmer qu'aucune séquence virale sont présentes dans les échantillons d'ADN génomique.

2. Préparation des fluides liquides contenant HaDV2

NOTE: Nous avons montré que la purification tentative des particules virales HaDV2 inhibe leur infectiosité et l' activité 31; Par conséquent, le protocole suivant est effectué pour parvenir à la solution HaDV2 infectieux en filtrant les individus infectés par le HaDV2.

  1. Recueillir les papillons adultes individuellement et les stocker immédiatement dans de l'azote liquide.
  2. broyer complètement les mites individuelles collectées dans de l'azote liquide en utilisant un mortier et un pilon stérilisé. Transférer environ 10 pg de débris à un propre tube de 1,5 ml. Transférer les débris restant dans un nouveau tube et les stocker immédiatement à -80 ° C.
  3. Extraire l'ADN à partir du 10 pg de débris, folloaile les protocoles fournis par le fabricant. Une fois que l'ADN a été isolé papillon, vérifier HaDV2 en utilisant le protocole tel que décrit à l'étape 1.6.
  4. Selon les résultats obtenus à l'étape 2.3, diviser les débris restants en deux groupes: HaDV2 positif et HaDV2 négatif, en fonction de leur statut d'infection. Ajouter 1 ml de solution saline tamponnée au phosphate (PBS; 137 mM NaCl, 2,7 mM de KCl, 8 mM de Na 2 HPO 4, et 1,5 mM KH 2 PO 4; pH 7,5) à chaque individu pour dissoudre complètement les débris restant des larves.
  5. Centrifugeuse de l'homogénat (de l'étape 2.4) à 6.500 x g pendant 15 min à 4 ° C. On filtre le liquide surnageant avec un filtre à membrane de 0,22 um. Recueillir les liquides filtrés (200 pl par tube) et les stocker immédiatement à -80 ° C.
    REMARQUE: Le filtre à membrane de 0,22 um filtrera la plupart des particules indésirables, les bactéries et les champignons. Tout d'abord pré-refroidir la centrifugeuse à 4 ° C. Effectuer tous les protocoles involving le fonctionnement du liquide filtré sur de la glace pour empêcher l'homogénat de brunir et coaguler.

3. La construction du coton colonie infectée par Heliothis HaDV2

  1. capacité de transmission horizontale de HaDV2
    1. Générer une courbe standard HaDV2.
      1. Amplifier les fragments contenant des amorces (VPF: CTGGTGAGGCGATGGACATG; VPR: TGACAAGATCCAGCGTAGACATC) et la sonde (VP-sonde: GCCACCACTAGAGGACCCACCAGATG), qui sont utilisés pour la quantification du virus HaDV2, avec les amorces de novo (PF: GGACAATGCTGGTGAGGC; PR: AATCCTCTTTGTCCGTTATCTATG). Utiliser le programme suivant: 30 s à 94 ° C, 30 s à 53 ° C et 60 s à 72 ° C pendant 40 cycles de PCR sur une machine 31. Ajouter 1 pi de l'ADN génomique contenant le génome HaDV2 (étape 2.3) pour la réaction de PCR de 25 ul comme matrice d'ADN. Cloner les fragments amplifiés dans un vecteur de clonage selon les protocoles du fabricant.
      2. Calculer le nombre de copiesdes plasmides avec l'équation suivante: copies / ul = (N A x C) / (n × M × 10 9),N A est le nombre d'Avogadro (6,02 × 10 23 molécules / mol); C est la concentration en masse de plasmides (ng / ul), qui peuvent être mesurés en utilisant microspectrophotométrie; n est la longueur du plasmide recombinant contenant le produit de PCR (5195 bp); et M est le poids moléculaire d'une paire de base moyen de l' ADN double brin (660 g / mol).
      3. Préparer six 10 fois des dilutions en série dans des tubes de microcentrifugation de 1,5 ml, avec des concentrations de 1,5 x 10 9 à 1,5 × 10 8 à 1,5 x 10 7 à 1,5 x 10 6, 1,5 x 10 5 et 1,5 x 10 4 nombre de copies / ul.
      4. Effectuer en temps réel une réaction en chaîne par polymérase quantitative (qPCR) en utilisant des amorces spécifiques (VPF / VPR) et une sonde (VP-sondes) pour générer des cycles threShold valeurs (CT) des plasmides décrits dans l'étape 3.1.1.3. Effectuer trois répétitions techniques indépendantes et les en moyenne pour des calculs ultérieurs.
      5. En utilisant les résultats ci-dessus, générer une courbe d'étalonnage en corrélation des concentrations HaDV2 transformé log2-aux valeurs moyennes CT connexes.
    2. Quantifier HaDV2 dans les fluides liquides filtrés.
      1. Pipeter un échantillon d'essai de 100 pi de fluide de liquide filtré (étape 2.6) contenant HaDV2 pour l'extraction d'ADN.
      2. Utiliser le temps réel qPCR pour obtenir les valeurs CT pour les fluides liquides et calculer le nombre de copies en utilisant la courbe d'étalonnage dans l'étape 3.1.1.
    3. Déterminer l'efficacité de l'infection par voie orale avec des liquides filtrés infectés par HaDV2 de différentes concentrations.
      1. On dilue le fluide liquide contenant HaDV2 aux concentrations suivantes: 10 8, 10 7, 10 6, 10 5, 10 4, 0 et le nombre de copies / pL.
      2. Etaler la di artificielleet uniformément sur une boîte de Pétri de 9 cm de diamètre avant la solidification. Répartir liquide contenant HaDV2 filtré (200 ul) pour chaque concentration à la surface du régime alimentaire artificiel solide. Pour ce faire, dans une hotte.
      3. Transfert 100 larves fraîchement éclos à l'alimentation artificielle contenant HaDV2 dans une boîte de Petri. frapper doucement la gaze de coton (y compris les larves fraîchement éclos) pour transférer les larves de la gaze à une feuille de papier blanc. Battre doucement le papier afin que la soie de spin larves et « ballon » le papier. Utilisez des pinces stérilisées pour toucher la soie et déplacer les larves dans une boîte de Petri.
      4. Après 48 h, transférer les larves sur le régime artificiel des plaques 24 puits (une personne par puits).
      5. Arrière les larves inoculées avec HaDV2 aux concentrations supérieures au stade adulte.
      6. Recueillir les papillons adultes, extraire l'ADN, et détecter HaDV2 par PCR, comme décrit à l'étape 1.5.
        REMARQUE: Ici, obtenir un taux d'infection HaDV2 100% de la cobollworms de tton en utilisant la 10 copie 8 nombre / pl et établir ainsi la colonie infectée par HaDV2 (INF-déformation).
  2. Verticale capacité de transmission de HaDV2
    1. Sélectionnez les papillons adultes des NONINF et INF-souches pour générer des paires uniques de ♀- / ♂-, ♀ + / ♂-, ♀- / ♂ + et + ♀ / ♂ + (+: positif pour l'infection HaDV2; -: négatif pour infection HaDV2).
    2. Transférer la descendance des paires ci-dessus à sans virus plaques à 24 puits; élever les larves au troisième stade larvaire.
    3. Extraire l'ADN à partir des larves de troisième stade larvaire ont été recueillies à utiliser comme matrice pour déterminer la présence de HaDV2, tel que décrit à l'étape 1.5.

4. Distribution tissulaire de HaDV2

  1. Pour éviter la contamination par des virus et des bactéries, stériliser les pinces et ciseaux dans 75% d'éthanol trois fois, puis les chauffer dans la flamme d'une lampe à alcool.
    REMARQUE: Forceps sterilization est nécessaire en cas de contamination.
  2. En utilisant une balance analytique, peser les tubes vides qui doivent être utilisés pour stocker les tissus.
  3. Placez les papillons de nuit de larves et adultes de l'INF-pression sur la glace pendant environ 5 min.
  4. Disséquer les tissus suivants sous un stéréomicroscope chez les larves, les femelles adultes et les hommes adultes dans une boîte de Petri contenant un tampon propre PBS.
    1. Pour les larves, hémolymphe de Pipet et disséquer l'intestin antérieur, l' intestin moyen, gros intestin, corps gras, et malpighien (Figure tubules 1A). Transférer immédiatement chaque tissu sur les tubes dans de l'azote liquide.
      1. Fixer les larves congelés sur cystosepiment en utilisant deux broches d' insectes (200 um de diamètre, 20 mm de longueur), l' insertion dans les membranes intersegmentaires près de la tête et du dernier segment de l' abdomen (figure 1A).
      2. Couper la fausse patte dans l'abdomen postérieur des larves de telle sorte que les flux de l'hémolymphe des larves sur. Pipeter l'hémolymphe de larves dans les 10 s en utilisant un microPipette pour éviter le brunissement et coagulant de l'hémolymphe.
        NOTE: phénylthiourée (50 ug / ml) peut être mélangé à un rapport de 1:20 vol / vol avec hémolymphe pour empêcher la mélanisation.
      3. En utilisant une paire de ciseaux, faire une incision dans la cuticule allant de la dernière membrane intersegmental à la tête. Disséquer tous les autres tissus sous une loupe binoculaire à l'aide de deux pinces; l'image pour chaque tissu est représenté sur la figure 1A.
      4. Mélanger des échantillons de tissus provenant de trois individus ensemble comme une réplique.
      5. Pour éviter la contamination des tissus restants avec l'hémolymphe lors de la dissection, se laver les tissus disséqués en trois fois tampon PBS. Ensuite, testez l'état HaDV2-infection du PBS utilisé pour le lavage. Si le tampon de lavage final est HaDV2-libre, le tissu doit être propre de la contamination par hémolymphe.
    2. Chez les femmes adultes, disséquer la tête (cerveau), les muscles, la graisse du corps, de l'intestin, tubules malpighiens, et de l'ovaire (Figure 1B) sous un stéréomicroscope dans du tampon PBS. Pour les hommes adultes, disséquer la tête (cerveau), les muscles, la graisse du corps, de l' intestin, tubules malpighiens, et les testicules (figure 1C) sous un stéréomicroscope dans un tampon PBS. Transférer immédiatement chaque tissu sur les tubes dans de l'azote liquide.
      1. En utilisant des pinces et ciseaux, enlever les ailes des papillons adultes et laver le corps restant trois fois pour effacer les échelles.
      2. Séparer la tête, le thorax et l'abdomen à l'aide de ciseaux.
      3. Retirez le endosquelette du thorax et de recueillir le muscle.
      4. En utilisant des pinces, retirer la cuticule de l'abdomen et disséquer les autres tissus suivants figures 1B et 1C.
      5. Mélanger les échantillons de tissus provenant de trois individus ensemble comme une réplique. Laver les tissus disséqués dans du PBS trois fois le tampon.
  5. Peser les tubes et les tissus ci-dessus quand ils ont été gelés et veiller à ce que le mânes des différents tissus sont presque égaux.
    Masse (tissus) = masse (tubes / échantillon de tissu) - masse (tubes uniquement)
  6. Extraire l'ADN de ces tissus et effectuer qPCR, comme décrit à l'étape 3.1.2.
  7. Calculer le nombre de copies par mg de chaque tissu en utilisant la courbe d'étalonnage générée à l'étape 3.1.1. Utiliser le titre de virus par unité de masse pour corriger le biais de l'échantillon provoqué par une différence dans la quantité de tissu utilisé pour l'extraction d'ADN.
  8. Calculer le pourcentage de HaDV2 dans le tissu spécifique comme suit: pourcentage de HaDV2 pour chaque tissu = HaDV2 nombre de copies par mg de tissu testé / (somme du nombre de copies par mg de tous les tissus).

5. Bioassays tester l'effet de HaDV2 sur le développement de l'hôte

  1. Placez au moins 100 pupes ou les papillons adultes qui viennent d'émerger dérivées de la souche NONINF dans un couvert de gaze en coton, 5-L, cage grillagée. Après 2 jours, les femelles adultes fécondées commencent à pondre des œufs sur la gaze de coton. Recueillir et maintenirla gaze de coton contenant les oeufs; les œufs éclosent dans environ trois jours.
  2. Ensemencement des larves avec HaDV2 nouveau-né.
    1. Transfert des larves de la NONINF de nouveau - né-souche à l'alimentation artificielle contenant HaDV2 (10 8 nombre de copies / ul) pour établir la INF-souche.
    2. De même, le transfert de larves nouveau-né à l'alimentation artificielle recouverte de liquide filtré HaDV2 libres (étape 2.4) pour établir les groupes de contrôle (NONINF-déformation). Inclure au moins 240 larves dans chaque traitement (figure 2A).
      REMARQUE: Larves qui sont utilisés pour construire le NONINF- et les souches INF-sont dérivés de la même cohorte mère et éclosent en même temps, en assurant le même fond génétique. Assurez-vous que les souches INF-NONINF- et sont maintenus dans la même chambre climatique (à 25 ± 1 ° C, avec 14 h de lumière / 10 h d'obscurité et 60% d'humidité relative) pour une vitesse synchrone de développement; le taux peut varier en fonction de la température et de l'humidité. Manipulez le Delicmangé des larves doucement.
  3. Après 48 h, transférer les larves individuellement sur des plaques 24 puits (une personne par puits) (figure 2B).
    1. nombre chaque larve Séquentiellement dans chaque puits et enregistrer le stade larvaire et l'état de survie quotidienne.
    2. 5 jours plus tard, lorsque le régime alimentaire artificiel se détériore, en même temps transférer ces personnes à une nouvelle plaque de 24 puits contenant l' alimentation artificielle frais (figure 2C).
    3. Peser les larves de 7 à 11 jours après l'éclosion en utilisant une balance analytique avec une précision de 0,0001 g. Après la pesée, de retour individuellement les larves à la plaque 24 puits.
  4. Après la mue au cinquième stade larvaire après la quatrième mue (une dizaine de jours après l' éclosion), transférer les larves dans des tubes de verre (hauteur 10 cm, diamètre 2 cm) (figure 2D); cinquième stade larvaire peut également être identifié par la largeur de la capsule de tête (environ 2,6 mm).
    REMARQUE: Transférer les personnessur le tube de verre à la même heure chaque jour.
    1. Code de chaque larve avec son numéro de référence d'origine sur le tube de verre avec de la peinture ou des marqueurs. Enregistrez l'état larvaire par jour; dans les tubes de verre, les larves nymphoser après environ cinq jours, l'étape de chrysalides dure environ 11 jours.
    2. Notez la date de pupes et eclosion pour chaque individu dans le tube en verre. Noter la masse de 3 jours âgé pupes.
  5. Après l' éclosion, mettre une femelle et d' un mâle en une seule cage avec du saccharose à 10% et 2% de solution de vitamines (Figure 2E). Reconstituer la solution de saccharose tous les jours. Notez la date du décès pour chaque papillon.
  6. Lorsque les œufs sont pondus, changer la gaze de coton par jour. Comptez le nombre d'oeufs immédiatement. Nombre de descendants nouvellement éclos alors qu'ils éclosent.
  7. Pendant les essais biologiques, choisir au hasard huit personnes pour chaque traitement pour confirmer l'état d'infection de HaDV2. Extraire l'ARN total de ces échantillons en utilisant le réactif de trypsine commercialesuivant le protocole du fabricant. Synthétiser l'ADNc premier brin suivant le protocole du fabricant et de l'utiliser comme modèle pour vérifier si les virus sont transcrites avec succès.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Descendances des parents qui ont été HaDV2 libres (figure 3A) ont été élevés comme la NONINF souche. Nous avons amplifié avec succès le gène d'actine en utilisant les mêmes modèles d'ADN, ce qui suggère que les modèles d'ADN étaient de bonne qualité (figure 3B). De plus, les huit étaient également libres descendances sélectionnés au hasard de HaDV2 (figure 3C), HaNPV (figure 3D), et Wolbachia (Figure 3E). Encore une fois, nous avons conclu que les échantillons d' ADN des descendances étaient de bonne qualité, car une partie du gène de l' actine a été amplifié avec succès pour tous les échantillons testés (Figure 3F).

Une courbe d' étalonnage définissant la relation entre le log de la qualité de la matière de départ et les valeurs CT acquises a été généré, comme sur la figure 4. Une forte corrélation linéaire (R (figure 4).

Fraîchement larves écloses ont été inoculés avec un point courbe standard de fluides liquides HaDV2 en utilisant des dilutions en série de 10 fois entre 10 4 et 10 8 numéro / uL copie. Nous avons obtenu une corrélation linéaire entre la fréquence de l'infection et les concentrations des fluides liquides HaDV2; 10 8 nombre de copies / ul a donné une infection de 100% pour le ver de la capsule, mais d' autres concentrations n'a pas (voir aussi Xu et al. 31). Les fréquences d'infection HaDV2 des descendances des parents avec différents statuts d'infection HaDV2 sont les suivantes: 100% pour ♀ + / ♂-, 78% pour les ♀- / ♂ +, et 100% pour ♀ + / ♂ + (voir aussi Xu et al. 31).

à correct des différences individuelles dans le titre HaDV2, nous avons calculé le nombre de copies HaDV2 par mg de chaque tissu et le pourcentage du titre total de HaDV2 pour le tissu spécifique. Les résultats ont révélé que HaDV2 a été principalement distribué dans le corps gras (figure 5, voir aussi Xu et al 31.). La comparaison des paramètres de la table de la vie, y compris les périodes larvaires, les périodes de pupes, longueur des adultes et la fécondité, ont été présentés dans le tableau 1 (voir aussi Xu et al. 31). Les masses des larves et des pupes ont été publiées par Xu et al. 31. Les statuts d'infection HaDV2 tant dans la NONINF-souche et la souche INF-ont été déterminées par PCR (résultats publiés par Xu et al. 31).

Figure 1
Figure 1. Les tissus disséqués pour (A) Les larves, (B) unFemelle adulte, et (C) un homme adulte. H, la tête (cerveau); Il, hémolymphe; FB, corps gras; Mt, tubules de Malpighi; G, tube digestif; FG, foregut; MG, mésentéron; HG, hindgut; Mu, les muscles; O, de l'ovaire; T, testiculaire. S'il vous plaît cliquer ici pour voir une version plus grande de ce chiffre.

Figure 2
Figure 2. Procédure d' essais biologiques pour déterminer les effets de HaDV2 sur le coton Heliothis. (A) Inoculation des larves nouvellement écloses avec HaDV2. (B) Le transfert des individus libres HaDV2 HaDV2 infectées et aux plaques 24 puits après 48 h. (C) Les différentes tailles des individus infectés par HaDV2 et sans gluten. (D) Transfert de larves au cinquième stade larvaire dans de nouveaux tubes en verre (10 cm de hauteur, 2 cm de diamètre). (E) La mise en place d'unefemelle et un papillon mâle dans la même cage pour déterminer la longévité adulte, la production d'œufs, et le taux d'éclosion. S'il vous plaît cliquer ici pour voir une version plus grande de ce chiffre.

figure 3
Figure 3. Statut des infections pour HaDV2, HaNPV ou Wolbachia dans les colonies infectées par HaDV2 et libres HaDV2. HaDV2 état d'infection chez les parents féminins et masculins (A). Le statut de l' infection de HaDV2 (C), HaNPV (D), et Wolbachia (E) dans les descendances choisis au hasard. Pour vérifier la qualité de l' ADN génomique, l'actine gène de ménage a également été amplifié pour les parents (B) et descendances (F). Lane M représente le marqueur de DL2000 (2000 pb, 1000 pb, 750 pb, 500 pb, 250 pb, und 100 pb). Lane 1: parent femelle. Lane 2: parent mâle. Lane 3 - 10: descendances. S'il vous plaît cliquer ici pour voir une version plus grande de ce chiffre.

Figure 4
Figure 4. La courbe standard corrélant Log 2 transformées HaDV2 concentrations de seuil de cycle (CT) Valeurs. S'il vous plaît cliquer ici pour voir une version plus grande de ce chiffre.

Figure 5
Figure 5. Hôte de tissu Répartition de HaDV2 chez les larves (A), Adulte femelle (B), et hommes adultes (C) coton vers de la capsule. Pourcentage (%) = le rapport de HaDV2 dans différents tissus (par mg), comme décrit in étape 4.7 Les données ont été analysées statistiquement par analyse de variance (Anova) et le test de Tukey (larves: n = 7; mâles adultes: n = 6; femelles adultes: n = 6). Moyennes ± SE. Les résultats ont été publiés par Xu et al. 31. S'il vous plaît cliquer ici pour voir une version plus grande de ce chiffre.

paramètres d'histoire de vie HaDV2 + HaDV2- valeur t df La valeur de P
période larvaire (jours) Mâle 16,51 (± 0,72) 16,93 (± 1,21) 4,147 379 <0,001
Femelle 16,51 (± 0,79) 16,80 (± 1,05) 2,732 312 0,0067
nymphose (jours) Mâle 13,02 (± 0,68) 13,31 (± 0,69) 4,057 379 <0,001
Femelle 11,62 (± 0,67) 12.00 (± 0,63) 5.1 312 <0,001
La longévité des adultes (jours) Mâle 10,69 (± 1,98) 10,93 (± 2,46) 0,915 367 0,36
Femelle 9,07 (± 1,98) 8,51 (± 1,58) 2,992 367 0,003
Nombre d'œufs par femelle 482 (± 174) 403 (± 180) 2,172 93 0,032
Nombre de hachures par femme 207 (± 108) 143 (± 99) 3,026 93 0,0032

Tableau 1. Paramètres de vie historique pour HaDV2 + et bollworms HaDV2-coton. test t de Student est utilisé pour déterminer le niveau d'importance. Moyennes ± SE sont affichés. Les données présentées dans ce tableau ont été publiés par Xu et al. 31.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Au cours des dernières décennies, la plupart des études sur les interactions virus d' insectes ont mis l' accent sur la santé des abeilles 34, 35, 36, vecteurs de maladies humaines 37, virus des plantes 38, et certains virus pathogènes d' insectes qui ont un grand potentiel comme agents de lutte biologique 39. Peu d'attention a été accordée à des virus cachés chez les insectes, en particulier dans les lépidoptères nuisibles. Nous présentons ici un protocole pour l'étude des interactions entre un virus caché et son insecte hôte. Une comparaison des paramètres de table de vie pour les personnes infectées par le virus de l'hôte et sans virus devrait idéalement exclure tout effet des différences de fond génétique de l'hôte. Pour étudier le phénotype viral, de nombreuses études antérieures ont comparé les paramètres de la table de la vie des deux individus naturellement infectés ou non infectés dans la même colonie ou individus inoculéspar microinjection, mais cet effort est temps 23, 40. L'inoculation par voie orale de bollworms de coton avec HaDV2, décrits ici, sert de moyen simple et efficace pour analyser les phénotypes virales. Cette procédure garantit également le même fond génétique pour des colonies non infectées HaDV2 HaDV2 infectées et.

inoculum viral peut être préparé de plusieurs façons. La purification des particules virales en utilisant une centrifugation à grande vitesse inhibe l'infectivité du virus, résultant en une faible infectivité; par conséquent, le virus contenant un liquide filtré a été utilisé pour infecter les larves noctuelle du coton 31. Le fait que la membrane de 0,22 um peut filtrer la plupart des particules fongiques et bactériennes de liquide contenant HaDV2 filtré et que le liquide filtré HaDV2-libre a été utilisé comme témoin pourrait exclure l'effet d'autres virus sur nos résultats. Cependant, nous ne pouvons pas exclure la possibilité que les résultats des essais biologiques pourrait unLSO être biaisée par des virus non découvertes. Par conséquent, les particules HaDV2 à forte infectivité devraient idéalement être purifiés à l'avenir pour obtenir des résultats robustes.

La concentration de virus en corrélation positive avec l'infectiosité du virus; Par conséquent, nous étions intéressés à déterminer la concentration HaDV2 qui donnera 100% l'infection. Nos résultats ont montré que le nombre pourrait être utilisé 10 8 copies / ul pour l'inoculation du virus pour obtenir ce taux d'infection. Sans aucun doute, la corrélation entre le titre du virus et le taux d'infection doit être étudiée pour d'autres interactions virus-hôte étudiés à l'avenir. En outre, le titre du virus de chaque individu dans le domaine devrait également être explorée. Par conséquent, nous pourrions alors simuler l'effet des virus sur les individus dans le domaine.

La manipulation douce des larves pendant les premières délicates quelques jours après leur éclosion est très important, car ils sont facilement mortellement endommagés. Par ailleurs, le col séronégatifs HaDV2ony doivent être conservés séparément dans la serre afin d' éviter la contamination HaDV2 le taux d'infection de HaDV2 a été jugé très élevé, aussi bien sur le terrain et au laboratoire 31.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs déclarent qu'ils ont pas d'intérêts financiers concurrents.

Acknowledgments

Ce travail a été soutenu par le Programme national de recherche sur la clé de base de la Chine (n ° 2013CB127602) et le Fonds des sciences pour les groupes de recherche Creative de la National Science Foundation de Chine (n ° 31321004).

Materials

Name Company Catalog Number Comments
24-well plate Corning 07-200-740 Multiple suppliers available.
DNA extraction kit TIANGEN DP304-03 Multiple suppliers available.
thermal cycler Veriti; Applied Biosystems 4375786
PBS Corning 21-040-CV
0.22 µm membrane filter Millipore SLGS025NB
pEASY-T Cloning Vector TransGen, Beijing, China CT301-02
Tweezers IDEAL-TEK 2.SA
Premix Ex Taq (Probe qPCR) Takara RR390A
Probes Invitrogen Custom order
Primers Invitrogen Custom order
microspectrophotometry NanoDrop 2000c  Thermo scientific  not available
7500 Real-Time PCR system Applied Biosystems not available
stereomicroscope SZX-16 Olympus not available
sucrose Multiple suppliers available.
vitamin complex Multiple suppliers available.

DOWNLOAD MATERIALS LIST

References

  1. Tang, P., Chiu, C. Metagenomics for the discovery of novel human viruses. Future Microbiol. 5, 177-189 (2010).
  2. Rosario, K., Breitbart, M. Exploring the viral world through metagenomics. Curr. Opin. Virol. 1, 289-297 (2011).
  3. Hugenholtz, P., Tyson, G. W. Microbiology - metagenomics. Nature. 455, 481-483 (2008).
  4. Kristensen, D. M., Mushegian, A. R., Dolja, V. V., Koonin, E. V. New dimensions of the virus world discovered through metagenomics. Trends Microbiol. 18, 11-19 (2010).
  5. Kleiner, M., Hooper, L. V., Duerkop, B. A. Evaluation of methods to purify virus-like particles for metagenomic sequencing of intestinal viromes. BMC Genomics. 16, 7 (2015).
  6. Ho, T., Tzanetakis, I. E. Development of a virus detection and discovery pipeline using next generation sequencing. Virology. 471, 54-60 (2014).
  7. Marx, C. J. Can you sequence ecology? Metagenomics of adaptive diversification. PLoS Biol. 11, e1001487 (2013).
  8. Radford, A. D., et al. Application of next-generation sequencing technologies in virology. J. Gen. Virol. 93, 1853-1868 (2012).
  9. Liu, S. J., Chen, Y. T., Bonning, B. C. RNA virus discovery in insects. Curr. Opin. Insect Sci. 8, 54-61 (2015).
  10. Mokili, J. L., Rohwer, F., Dutilh, B. E. Metagenomics and future perspectives in virus discovery. Curr. Opin. Virol. 2, 63-77 (2012).
  11. Liu, S. J., Vijayendran, D., Bonning, B. C. Next generation sequencing technologies for insect virus discovery. Viruses-Basel. 3, 1849-1869 (2011).
  12. Cook, S., et al. Novel virus discovery and genome reconstruction from field RNA samples reveals highly divergent viruses in Dipteran hosts. PLoS ONE. 8, e80720 (2013).
  13. Webster, C. L., et al. The discovery, distribution, and evolution of viruses associated with Drosophila melanogaster. PLoS Biol. 13, e1002210 (2015).
  14. Granberg, F., et al. Metagenomic detection of viral pathogens in spanish honeybees: co-infection by aphid lethal paralysis, israel acute paralysis and lake sinai viruses. PLoS ONE. 8, e57459 (2013).
  15. Runckel, C., et al. Temporal analysis of the honey bee microbiome reveals four novel viruses and seasonal prevalence of known viruses, Nosema, and Crithidia. PLoS ONE. 6, 20656 (2011).
  16. Cox-Foster, D. L., et al. A metagenomic survey of microbes in honey bee colony collapse disorder. Science. 318, 283-287 (2007).
  17. Chandler, J. A., Liu, R. M., Bennett, S. N. RNA shotgun metagenomic sequencing of northern California (USA) mosquitoes uncovers viruses, bacteria, and fungi. Front. Microbiol. 6, 185 (2015).
  18. Shi, C. Y., et al. A metagenomic survey of viral abundance and diversity in mosquitoes from Hubei province. PLoS ONE. 10, e0129845 (2015).
  19. Nouri, S., Salem, N., Nigg, J. C., Falk, B. W. Diverse array of new viral sequences identified in worldwide populations of the Asian citrus psyllid (Diaphorina citri) using viral metagenomics. J. Virol. 90, 2434-2445 (2016).
  20. Dayaram, A., et al. Identification of diverse circular single-stranded DNA viruses in adult dragonflies and damselflies (Insecta Odonata) of Arizona and Oklahoma, USA. Infect. Genet. Evol. 30, 278-287 (2015).
  21. Jakubowska, A. K., et al. Simultaneous occurrence of covert infections with small RNA viruses in the lepidopteran Spodoptera exigua. J.Invert. Pathol. 121, 56-63 (2014).
  22. Roossinck, M. J. Move over, Bacteria! Viruses make their mark as mutualistic microbial symbionts. J. Virol. 89, 6532-6535 (2015).
  23. Ryabov, E. V., Keane, G., Naish, N., Evered, C., Winstanley, D. Densovirus induces winged morphs in asexual clones of the rosy apple aphid, Dysaphis plantaginea. Proc. Natl. Acad. Sci. USA. 106, 8465-8470 (2009).
  24. Roossinck, M. J. The good viruses: viral mutualistic symbioses. Nat. Rev. Microbiol. 9, 99-108 (2011).
  25. Venkataraman, S., et al. Structure of seneca valley virus-001: an oncolytic picornavirus representing a new genus. Structure. 16, 1555-1561 (2008).
  26. Deterding, K., et al. Hepatitis a virus infection suppresses hepatitis c virus replication and may lead to clearance of hcv. J. Hepatol. 45, 770-778 (2007).
  27. Barton, E. S., et al. Herpesvirus latency confers symbiotic protection from bacterial infection. Nature. 447, 326-329 (2007).
  28. Ponferrada, V. G., Mauck, B. S., Wooley, D. P. The envelope glycoprotein of human endogenous retrovirus herv-w induces cellular resistance to spleen necrosis virus. Arch. Virol. 148, 659-675 (2003).
  29. Márquez, L. M., Redman, R. S., Rodriguez, R. J., Roossinck, M. J. A virus in a fungus in a plant: three-way symbiosis required for thermal tolerance. Science. 315, 513-515 (2007).
  30. Xu, P. J., et al. Complete genome sequence of a monosense densovirus infecting the cotton bollworm, Helicoverpa armigera. J. Virol. 86, 10909-10909 (2012).
  31. Xu, P. J., Liu, Y. Q., Graham, R. I., Wilson, K., Wu, K. M. Densovirus is a mutualistic symbiont of a global crop pest (Helicoverpa armigera) and protects against a baculovirus and Bt biopesticide. PLoS Pathog. 10, e1004490 (2014).
  32. Liang, G. M., Tan, W. J., Guo, Y. Y. An improvement in the technique of artificial rearing cotton bollworm. Plant Protec. 25, 15-17 (1999).
  33. Zhou, W. G., Rousset, F., O'Neill, S. Phylogeny and PCR-based classification of Wolbachia strains using wsp gene sequences. P. Roy. Soc. B-Biol. Sci. 265, 509-515 (1998).
  34. Mondet, F., de Miranda, J. R., Kretzschmar, A., Le Conte, Y., Mercer, A. R. On the front line: quantitative virus dynamics in honeybee (Apis mellifera L.) colonies along a new expansion front of the parasite Varroa destructor. PLoS Pathog. 10, e1004323 (2014).
  35. Chen, Y. P., et al. Israeli acute paralysis virus: epidemiology, pathogenesis and implications for honey bee health. PLoS Pathog. 10, e1004261 (2014).
  36. Hunter, W., et al. Large-scale field application of RNAi technology reducing israeli acute paralysis virus disease in honey bees (Apis mellifera, Hymenoptera: Apidae). PLoS Pathog. 6, e1001160 (2010).
  37. Halstead, S. B. Dengue virus - mosquito interactions. Annu. Rev. Entomol. 53, 273-291 (2008).
  38. Whitfield, A. E., Falk, B. W., Rotenberg, D. Insect vector-mediated transmission of plant viruses. Virology. 479-480, 278-289 (2015).
  39. Moscardi, F. Assessment of the application of baculoviruses for control of Lepidoptera. Annu. Rev. Entomol. 44, 257-289 (1999).
  40. Szelei, J., et al. Susceptibility of North-American and European crickets to Acheta domesticus densovirus (AdDNV) and associated epizootics. J. Invert. Pathol. 106, 394-399 (2011).
Protocoles pour étudier l&#39;hôte d&#39;un tissu de distribution, en mode de transmission, et l&#39;effet sur la remise en forme de l&#39;hôte d&#39;un Densovirus dans le coton Heliothis
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Yang, X., Xu, P., Graham, R. I., Yuan, H., Wu, K. Protocols for Investigating the Host-tissue Distribution, Transmission-mode, and Effect on the Host Fitness of a Densovirus in the Cotton Bollworm. J. Vis. Exp. (122), e55534, doi:10.3791/55534 (2017).More

Yang, X., Xu, P., Graham, R. I., Yuan, H., Wu, K. Protocols for Investigating the Host-tissue Distribution, Transmission-mode, and Effect on the Host Fitness of a Densovirus in the Cotton Bollworm. J. Vis. Exp. (122), e55534, doi:10.3791/55534 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter