Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Protokolle für die Untersuchung die Host-Gewebeverteilung, Transmission-Modus und Effekt auf der Host-Fitness eines Densovirus im Cotton Bollworm

doi: 10.3791/55534 Published: April 12, 2017

Summary

Hier präsentieren wir ein Protokoll der Host-Gewebeverteilung, Übertragungsmodus und Wirkung auf den Wirt Eignung eines densovirus innerhalb Lepidoptera-Spezies zu untersuchen, die Baumwollkapselwurm. Dieses Protokoll kann auch für die Untersuchung der Wechselwirkung zwischen anderen oral übertragenen Viren und ihren Insekten Wirten verwendet werden.

Abstract

Viele neue Viren wurden in Tierwirten unter Verwendung der nächsten Generation Sequenzierungstechnologien entdeckt. Zuvor berichteten wir ein mutualistic Virus, Helicoverpa armigera densovirus (HaDV2), in einer Lepidoptera - Spezies der Baumwollkapselwurm, Helicoverpa armigera (Hubner). Hier beschreiben wir die Protokolle, die derzeit verwendet werden, um die Wirkung von HaDV2 auf seinem Wirt zu studieren. Erstens haben wir eine HaDV2 freie Baumwollkapselwurm Kolonie aus einem einzigen Zuchtpaar etablieren. Dann wir mündlich einige Neugeborener Larven Nachkommen mit impfen filtrierte Flüssigkeit HaDV2 haltigen zwei Kolonien mit dem gleichen genetischen Hintergrund zu produzieren: ein HaDV2-infiziert ist, der andere nicht infizieren. Ein Protokoll zum Leben Tabellenparameter (zB Larven, Puppen und Erwachsener Zeiten und Fruchtbarkeit) zwischen den HaDV2-infizierten und -uninfected Individuen vergleichen wird ebenfalls vorgestellt, wie die Protokolle sind für die Host-Gewebeverteilung und Übertragungseffizienz von HaDV2 bestimmen. Diese Protokolle WOuld auch geeignet sein, die Wirkung anderer mündlich übertragene Viren auf ihren Insekten Gastgeber, Lepidoptera-Hosts insbesondere zu untersuchen.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

In den letzten Jahrzehnten hat sich die Entwicklung der Sequenzierungstechnologie wie Next-Generation - Sequencing (NGS) die Entdeckung vieler neuer DNA und RNA - Viren, vor allem nicht - pathogenen Viren erleichtert, sondern auch neue Isolate von bisher bekannten Viren 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12. In dem Modellorganismus Drosophila melanogaster, mehr als 20 neue Teilvirusgenomen wurden unter Verwendung von 13 metagenomic Techniken nachgewiesen. Viele virale Sequenzen, einschließlich neuer Viren, wurden auch in anderen Insekten, wie Bienen, m identifiziertosquitoes, Asian citrus Psylliden, Libellen und mehrere Lepidoptera - Spezies 14, 15, 16, 17, 18, 19, 20, 21.

In Zukunft kann es, dass mehr neue Viren in Insekten entdeckt wird erwartet, dass diese erweiterten Technologien; damit unser Verständnis der Virus-Wirt - Interaktion kann entsprechend 6 ändern, 9. Zum Beispiel sind Virus-Wirt - Interaktionen als komplizierter sein als bisher angenommen, weil viele neue Viren als mutualistic Partner definiert werden , anstatt strenge Erreger 22. Zum Beispiel induziert der mutualistic densovirus DplDNV in Dysaphis plantaginea den geflügelten Morph und erhöht die Mobilität, die Zerstreuung des Wirtes sowie das Virus 23 zu erleichtern. Darüber hinaus wurden im Hinblick auf die Säugetier-Gesundheit, die Trockenheit und Kältetoleranz von Pflanzen, und die Auswirkungen von bakteriellen Infektionen 24 mutualistic Viren beschrieben. Seneca Tal - Virus-001 gezeigt selektive Zytotoxizität gegenüber Tumorzellen vermitteln mit neuroendokrinen Krebs 25 kennzeichnet. Hepatitis A - Virusinfektionen unterdrücken die Replikation von Hepatitis C Virus und können bis zur Erholung von Hepatitis - C - 26 führen. Herpes - Virus - Latenz verleiht symbiotischen Schutz vor bakterieller Infektion 27. Das Hüllglykoprotein von humanen endogenen Retrovirus HERV-W induziert zelluläre Resistenz gegen Milznekrosevirus 28. Curvularia Thermotoleranz-Virus (CThTV) aus einer Pilz Endophyt ist in der mutualistic Wechselwirkung zwischen diesem Pilze und einem tropischen panic Gras beteiligt"ref> 29. Daher Kenntnis der Wechselwirkungen zwischen den neu gefundenen Viren und ihren Wirten sollten neue Perspektiven auf ihre Biologie und Management generieren. Allerdings sind die neuen Viren, vor allem die versteckten Viren keine offensichtlichen Anzeichen typisch für eine akute Infektion anzeigt, haben selten wurden untersucht, und wir brauchen eine Pipeline und Protokolle, die Auswirkungen der neu gefundenen Viren auf ihren Wirten zu untersuchen.

Bisher haben wir die Prävalenz einen neuen monosense densovirus Helicoverpa armigera densovirus (HaDV2) in dem Baumwollkapselwurm, Helicoverpa armigera berichteten, und präsentierten Beweise für eine mutualistic Beziehung zwischen HaDV2 und dem Baumwollkapselwurm 30, 31. In diesem Beitrag werden wir das Laborprotokoll zu untersuchen im Detail die Interaktion zwischen HaDV2 und seinen Baumwolleule Host beschreiben. Das Protokoll hier vorgestellten kann auch von großer Bedeutung für Forscher, die r Prüfungole anderer Viren oral übertragen, vor allem in Lepidoptera-Schädlinge.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Aufbau des HaDV2 freien Cotton Bollworm Colony

  1. Hintere Baumwolleule Larven (H. armigera) auf einer künstliche Ernährung 32 in einem kontrollierten Wachstumsraum oder eine künstliche Klimakammer bei 25 ± 1 ° C mit 14 h Licht / 10 h Dunkelheit und 60% relativer Luftfeuchtigkeit.
  2. Beihilfe einpaarigen Paarung von neu eclosed Motten durch einen Kunststoffkäfig pro Paar unter Verwendung von (10 cm Höhe, 5 cm Durchmesser) mit Baumwollgaze bedeckt guter Belüftung zu gewährleisten und als Eiablage Substrat zu dienen. Um die Wahrscheinlichkeit zu erhöhen, zur Herstellung einer virenfreien Kolonie zu erhalten, verwendet mindestens 30 Paare von einpaarigen Paarungen. Feed Falter mit einer 10% Zucker und 2% Vitaminlösung 32 getränkt auf einem Wattebausch und täglich aufgefüllt.
  3. Als weibliche Erwachsene ihre Eier auf dem Baumwollgaze ca. 2 Tage nach der Paarung legen, täglich die Gaze ändern. Sammeln und Gaze enthält Eier in dem gleichen Wachstumsraum (oder künstliches Klima cham haltenber) als die Falter, bis die Eier schlüpfen.
  4. Transfer sofort frisch geschlüpften Larven auf neue 24-Well-Platten, mit einer einzelnen pro Vertiefung.
  5. Fünf Tage nach dem ersten Eierlegedatum, sammeln die Eltern Motten und speichern sie in flüssigem Stickstoff.
    HINWEIS: Das Sammeln der Motten 5 Tage nach dem ersten Eierlegedatum wird sichergestellt, dass die Eltern bei der Sammelstelle am Leben sind und daher vermeidet mögliche Auswirkungen der Verwendung von toten Motten auf DNA-Extraktionsgenauigkeit.
  6. Isolieren genomischer DNA aus diesen Proben eine DNA Extraction Kit nach den Anweisungen des Herstellers.
    1. Amplifizieren ein 574 bp-Fragment des Actin-Gens mit Primern, Actin F / Aktin-R (Actin F: 5-CATCTACGAGGGTTACGC-3 und R-Actin: 5-CATCTGTTGGAAGGTGGA-3). Visualisieren der Polymerasekettenreaktion (PCR) Produkte unter Verwendung von Agarose-Gelelektrophorese nach Standardprotokollen; Die erfolgreiche Amplifikation des Actin-Gens stellt sicher, dass die DNA von guter Qualität ist.
    2. beurteilen ter Anwesenheit von HaDV2 in den Muttermotten mittels PCR mit spezifischen Primern: DVVPF (GGATTGGCCTGGGAAATGAC) und DVVPR (CGTTGTTTTTATATCCGAGG) 31.
  7. Sobald ein sauberes Paar identifiziert wurde, hintere Nachkommen aus diesem einzigen HaDV2-nicht infizierte Zuchtpaar für mindestens fünf Generationen und hält dies als HaDV2 freie Kolonie (NONINF-Stamm); die HaDV2-infizierten Kolonie als INF-Stamm definiert.
  8. Zur Bestätigung des HaDV2 Infektionsstatus in dem NONINF-Stamm (und die Wirkung von bekannten Bakterien oder Viren auf dem Host - Entwicklung auszuschließen), bewerten den Infektionsstatus für HaDV2, Wolbachia und H. armigera Nucleopolyhedrovirus (HaNPV) in acht zufällig ausgewählten Individuen Larven des NONINF-Stamm unter Verwendung von PCR (mit spezifischen Primern: DVVPF / DVVPR für HaDV2, NPVF / NPVR für HaNPV und 81F / 691R für Wolbachia 31, 33).
    HINWEIS: Es ist bekannt, dass einige Viren spät sein könntennt im infizierten Wirt, mit einem Pegel nicht nachweisbar, auch wenn eine PCR-basierte Technik. NGS-Technologien könnten verwendet werden, um zu bestätigen, dass keine viralen Sequenzen in den genomischen DNA-Proben vorhanden sind.

2. Herstellung von HaDV2 haltigen flüssigen Fluiden

HINWEIS: Wir haben gezeigt , dass die versuchte Reinigung des HaDV2 Viruspartikels ihre Infektiosität und Aktivität hemmt 31; Daher wird das folgende Protokoll der infektiöse HaDV2 Lösung zu erreichen, durch Filtern der HaDV2-infizierten Personen durchgeführt.

  1. Sammeln Falter einzeln und sofort speichern sie in flüssigem Stickstoff.
  2. Völlig mahlt die gesammelten einzelnen Motten in flüssigem Stickstoff ein sterilisiertes Mörser und Stößel. Etwa 10 ug Schutt ein sauberes 1,5-ml-Röhrchen. Übertragen Sie die restlichen Trümmer in ein neues Röhrchen und sofort lagern bei -80 ° C.
  3. Extrahieren von DNA aus dem 10 & mgr; g von Schutt, folloFlügel der vom Hersteller bereitgestellten Protokolle. Sobald die moth DNA isoliert worden ist, überprüft HaDV2 unter Verwendung des Protokolls, wie 1.6 in Schritt beschrieben.
  4. Gemäß den erhaltenen Ergebnisse in Schritt 2.3, teilt die verbleibenden Trümmer in zwei Gruppen: HaDV2-positive und HaDV2-negativ, je nach ihrer Infektionsstatus. 1 ml phosphatgepufferter Kochsalzlösung (PBS; 137 mM NaCl, 2,7 mM KCl, 8 mM Na 2 HPO 4 und 1,5 mM KH 2 PO 4; pH 7,5) zu jeder einzelnen vollständig die verbleibende larvalen Schutt zu lösen.
  5. Zentrifuge des Homogenat (aus Schritt 2.4) bei 6.500 × g für 15 min bei 4 ° C. Filtern des flüssigen Überstand mit einem 0,22-um-Membranfilter. Sammeln der gefilterten Flüssigkeiten (200 & mgr; l pro Röhrchen) und sofort im Kühlschrank bei -80 ° C.
    HINWEIS: Die 0,22-um-Membranfilter filtert die meisten der unerwünschten Partikel, Bakterien aus und Pilz. Erste Vorkühlung die Zentrifuge auf 4 ° C. Führen Sie alle Protokolle involving den Betrieb der filtrierten Flüssigkeit auf Eis des Homogenats von Bräunung und Koagulieren zu verhindern.

3. Aufbau des HaDV2-infizierten Cotton Bollworm Colony

  1. Horizontale Übertragungsfähigkeit von HaDV2
    1. Generieren Sie eine HaDV2 Standardkurve.
      1. Amplifizieren, die Fragmente enthalten Primer (VPF: CTGGTGAGGCGATGGACATG; VPR: TGACAAGATCCAGCGTAGACATC) und Sonde (VP-Sonde: GCCACCACTAGAGGACCCACCAGATG), die für die Quantifizierung von HaDV2 Virus verwendet werden, wobei die de novo-Primern (PF: GGACAATGCTGGTGAGGC; PR: AATCCTCTTTGTCCGTTATCTATG). Verwenden Sie das folgende Programm: 30 s bei 94 ° C, 30 s bei 53 ° C und 60 s bei 72 ° C für 40 Zyklen auf einer PCR - Maschine 31. 1 & mgr; l genomischer DNA, enthaltend das HaDV2 Genom (Schritt 2,3) zu der 25 & mgr; l PCR-Reaktion als Matrizen-DNA. Klonen der amplifizierten Fragmente in einen Klonierungsvektor nach Protokollen des Herstellers.
      2. Berechnen Sie die KopienzahlPlasmide mit der folgenden Gleichung: Kopien / & mgr; L = (N A × C) / (n × M × 10 9), wobei N A die Avogadro-Zahl (6,02 × 10 23 Moleküle / mol) ist; C ist die Massenkonzentration von Plasmiden (ng / & mgr; l), die Mikrospektrophotometrie gemessen werden kann unter Verwendung von ; n ist die Länge des rekombinanten Plasmids , das das PCR - Produkt (5195 bp) enthält; und M das Molekulargewicht einer durchschnittlichen Basenpaare doppelsträngiger DNA (660 g / mol).
      3. Vorbereiten sechs 10fache Reihenverdünnungen in 1,5 ml - Mikrozentrifugenröhrchen mit Konzentrationen von 1,5 × 10 9 1,5 × 10 8 1,5 × 10 7, 1,5 × 10 6, 1,5 × 10 5 und 1,5 x 10 4 Kopienzahl / ul.
      4. Führen quantitative Echtzeit-Polymerase-Kettenreaktion (qPCR) unter Verwendung spezifischer Primer (VPF / VPR) und eine Sonde (VP-Sonde) Zyklus zu erzeugen dreSHOLD (CT) Werte der in Schritt 3.1.1.3 beschriebenen Plasmide. Führen Sie drei unabhängige technische Replikate und durchschnittlich sie für weitere Berechnungen.
      5. Unter Verwendung der obigen Ergebnisse, um eine Standardkurve erzeugen Korrelieren log2-transformierten HaDV2 Konzentrationen auf die zugehörigen gemittelten CT-Werte.
    2. Quantifizieren HaDV2 in den gefilterten flüssigen Fluiden.
      1. Pipettieren eine 100 & mgr; l Testprobe, des gefilterten flüssigen Fluids (Schritt 2.6), enthaltenden HaDV2 zur DNA-Extraktion.
      2. Verwenden Echtzeit-qPCR der CT-Werte für die flüssigen Fluide zu erhalten, und die Kopienzahl zu berechnen, unter Verwendung der Standardkurve in Schritt 3.1.1.
    3. Bestimmen Sie die orale Infektionseffizienz mit HaDV2-infizierten gefilterten Flüssigkeiten unterschiedlicher Konzentrationen.
      1. Verdünne das flüssige Fluid enthält HaDV2 zu den folgenden Konzentrationen: 10 8, 10 7, 10 6, 10 5, 10 4, 0 und Kopienzahl / & mgr; L.
      2. Verbreiten Sie die künstliche diet gleichmäßig auf ein 9 cm-Durchmesser-Petrischalen vor dem Erstarren. für jede Konzentration filtrierte Flüssigkeit (200 ul) auf der Oberfläche des festen Kunstfutters gleichmäßig HaDV2-enthalten. Tun Sie dies in einer Abzugshaube.
      3. Übertragen Sie 100 frisch geschlüpften Larven in die HaDV2, künstliche Ernährung in einer Petrischale. Klopfen Sie leicht die Baumwollgaze (mit frisch geschlüpften Larven), um die Larven aus der Gaze zu einem weißen Blatt Papier zu übertragen. Schlagen Sie das Papier vorsichtig, so dass die Larven Spin Seide und „Ballon“ aus dem Papier. Verwendung sterilisierte Zange die Seide zu berühren, und die Larven in eine Petrischale zu bewegen.
      4. Nach 48 h, übertragen die Larven auf die künstliche Ernährung zu 24-Well-Platten (eine einzelne pro Vertiefung).
      5. Hinten die mit HaDV2 beimpft Larven bei den oben genannten Konzentrationen zum erwachsenen Stadium.
      6. Sammeln die Falter, die DNA extrahieren, und detektieren HaDV2 PCR verwendet, wie in Schritt 1.5 beschrieben.
        HINWEIS: eine 100% HaDV2 Infektionsrate des Co Hier erhaltentton Kapselwurm der 10 8 Kopienzahl / uL verwendet und somit stellt die HaDV2-infizierten Kolonie (INF-Stamm).
  2. Vertikale Übertragungsfähigkeit von HaDV2
    1. Wählen Falter aus den NONINF und INF-Stämme einzelne Paare von ♀- / ♂-, erzeugen ♀ + / ♂-, ♀- / ♂ und ♀ + + / + ♂ (+: positiv für HaDV2 Infektion; -: negativ HaDV2 Infektion).
    2. Übertragen der Nachkommen aus den oben genannten Paaren virusfreien 24-Well-Platten; hinten die Larven in den dritten Häutungsstadium.
    3. Extrahieren der DNA aus den gesammelten dritten Larvenstadium als Matrize zu verwenden, um die Anwesenheit von HaDV2, um zu bestimmen, wie in Schritt 1.5 beschrieben.

4. Gewebeverteilung von HaDV2

  1. Um eine Kontamination durch Viren und Bakterien zu verhindern, Sterilisieren der Zange und Schere in 75% -igem Ethanol drei Mal und dann in der Flamme eines Alkohols Lampe aufzuheizen.
    HINWEIS: Pinzetten sterilization ist notwendig, wenn Verschmutzung auftritt.
  2. Unter Verwendung einer Analysenwaage wiegen die leeren Rohre, die verwendet werden sollen, um die Gewebe zu speichern.
  3. Legen Sie die Larven und adulten Motten aus dem INF-Stamm auf Eis für etwa 5 min.
  4. Sezieren die folgenden Gewebe unter einem Stereomikroskop in Larven, erwachsenen Weibchen und Männchen in einem sauberen Petrischale mit PBS-Puffer.
    1. Für Larven, pipet Hämolymphe und seziert die Vorder-, Mittel-, Enddarm, Fettkörper und Malpighischen Gefäße (Abbildung 1A). überträgt sofort jedes Gewebe in die Röhrchen in flüssigem Stickstoff.
      1. Fixiert die gefrorenen Larven auf cystosepiment mit zwei Insektenstiften (200 & mgr; m im Durchmesser, 20 mm in der Länge), Einsetzen in die intersegmentalen Membranen in der Nähe des Kopfes und der Bauch letztes Segment (1A).
      2. Schneiden Sie die proleg im hinteren Bauchraum der Larven, so dass die Larven Hämolymphe ausströmt. Pipette, um die Larven Hämolymphe innerhalb von 10 s eine microP mitipette Bräunung und Koagulieren der Hämolymphe zu verhindern.
        HINWEIS: Phenylthioharnstoff (50 ug / ml) kann bei 1:20 Vol / Vol-Verhältnis mit Hämolymphe gemischt wird Melanisierung zu verhindern.
      3. Unter Verwendung einer Schere, einen Einschnitt in die Kutikula machen von der letzten intersegmentalen Membran zum Kopf hin. Sezieren alle verbleibenden Gewebe unter einem Stereomikroskop mit zwei Zangen; das Bild für jedes Gewebe wird in 1A gezeigt.
      4. Mischen Sie Gewebeproben aus drei Personen zusammen als eine Replikation.
      5. Um die Verunreinigung der übrigen Gewebe mit der Hämolymphe während der Präparation zu verhindern, wasche die sezierten Gewebe in PBS dreimal puffern. Dann testen Sie den HaDV2-Infektion Status des zum Waschen verwendeten PBS. Wenn der letzte Waschpuffer HaDV2 frei ist, sollte das Gewebe vor einer Kontamination mit Hämolymphe sauber sein.
    2. Für erwachsene Frauen, sezieren den Kopf (Gehirn), Muskeln, Fett-Körper, gut, Malpighischen Gefäße und Ovar (1B) unter einem Stereomikroskop in PBS - Puffer. Für erwachsene Männer, sezieren den Kopf (Gehirn), Muskeln, Fett-Körper, gut, Malpighischen Gefäße und Hoden (1C) unter einem Stereomikroskop in PBS - Puffer. überträgt sofort jedes Gewebe in die Röhrchen in flüssigem Stickstoff.
      1. Mit einer Pinzette und Schere, entfernen Sie die Flügel des Falters und waschen Sie die verbleibende Körper dreimal an die Waage zu löschen.
      2. Trennt den Kopf, Brust, Bauch und Schere.
      3. Entfernen Sie die endoskeleton des Thorax und den Muskel sammeln.
      4. Mit einer Pinzette, entfernen die Kutikula des Bauches und seziert die anderen Gewebe folgenden Figuren 1B und 1C.
      5. Mischen Sie die Gewebeproben aus drei Personen zusammen als eine Replikation. Waschen Sie die sezierten Gewebe in PBS dreimal puffern.
  5. Wiegen Sie die Rohre und die oben genannten Gewebe, wenn sie eingefroren sind und dafür sorgen, dass der mEsel von den verschiedenen Geweben sind fast gleich.
    Masse (Gewebe) = Masse (Röhren / Gewebeprobe) - Masse (Rohr nur)
  6. Extrahieren der DNA aus diesen Geweben und führen qPCR, wie es in Schritt 3.1.2 beschrieben.
  7. Berechnen der Kopienzahl pro mg jeder der Standardkurve in Schritt erzeugt wird unter Verwendung von Gewebe 3.1.1. Verwenden des Virustiters pro Masseneinheit für die Probenspannung von jedem Unterschied in der Menge an Gewebe verwendet für die DNA-Extraktion verursacht zu korrigieren.
  8. Berechnen des Prozentsatzes der HaDV2 in dem spezifischen Gewebe wie folgt: Anzahl von für jedes Gewebe HaDV2 = HaDV2 Kopienzahl pro mg getesteten Gewebe / (Summe der Kopienzahl pro mg aller Gewebe).

5. Biotests Testen der Wirkung von HaDV2 auf Host-Entwicklung

  1. Ort mindestens 100 Puppen oder frisch geschlüpfte Falter abgeleitet von dem NONINF-Stamm in einem Baumwoll-Gaze ​​bedeckte, 5-L, Drahtgitterkäfig. Nach 2 Tagen beginnen verpaart erwachsene Weibchen Eier auf dem Baumwollgewebe zu legen. Sammeln und pflegendie Baumwollgaze, die Eier enthalten; Die Eier werden in etwa drei Tagen schlüpfen.
  2. Beimpfung des Neugeborenen Larven mit HaDV2.
    1. Übertragen Sie die Neugeborenen Larven des NONINF-Stammes zur künstlichen Ernährung mit HaDV2 (10 8 Kopienzahl / ul) , um den INF-Stamm zu etablieren.
    2. In ähnlicher Weise überträgt neonate Larven zur künstlichen Ernährung bedeckt mit HaDV2 frei filtrierte Flüssigkeit (Schritt 2.4), um die Kontrollgruppen (NONINF-Stamm) zu etablieren. Umfasst mindestens 240 Larven in jeder Behandlung (2A).
      HINWEIS: Die Larven, die die NONINF- und INF-Stämme verwendet werden, zu konstruieren, wird aus derselben Mutter Kohorte und Luken zugleich abgeleitet ist, den gleichen genetischen Hintergrund zu gewährleisten. Stellen Sie sicher, dass die NONINF- und INF-Stämme in derselben Klimakammer (bei 25 ± 1 ° C mit 14 h Licht / 10 h Dunkelheit und 60% relative Luftfeuchtigkeit) für eine synchrone Geschwindigkeit der Entwicklung gehalten werden; Die Geschwindigkeit kann in Abhängigkeit von Temperatur und Feuchtigkeit variiert. Behandeln Sie die delicsanft aß Larven.
  3. Nach 48 h, übertragen die Larven einzeln auf 24-Well - Platten (eine einzelne pro Vertiefung) (2B).
    1. Sequenziell Anzahl jeder Larve in jeder Vertiefung und die instar Bühne und das Überleben Status täglich aufzuzeichnen.
    2. Etwa 5 Tage später, als die künstliche Ernährung verschlechtert, überträgt gleichzeitig diese Personen zu einer neuen 24-Well - Platte mit frischer künstlicher Ernährung (2C).
    3. Wiegen Sie die Larven von Tag 7 bis 11 nach dem Schlüpfen einer Analysenwaage mit einer Genauigkeit von 0,0001 g verwendet wird. Einzeln gibt die Larven an die 24-Well-Platte nach dem Wiegen.
  4. Nach der Häutung zu dem fünften Instar nach dem vierten ecdysis (etwa zehn Tage nach dem Schlüpfen), übertragen die Larven Glasröhren (10 cm Höhe, Durchmesser 2 cm) (2D); fünftes Larvenstadium kann auch durch die Breite der Kopfkapsel (etwa 2,6 mm), identifiziert werden.
    HINWEIS: Übertragen Sie die Personenauf das Glasrohr jeden Tag zur gleichen Zeit.
    1. Code jede Larve mit seinen ursprünglichen Referenznummer auf dem Rohrglas mit Farbe oder Marker. Notieren Sie sich den Larvenstatus täglich; in den Glasröhren, werden die Larven Verpuppung nach etwa fünf Tagen-Stadium der Puppen etwa 11 Tage dauert.
    2. Notieren Sie sich die Puppen und das Schlüpfen Datum für jeden einzelnen in der Glasröhre. Notieren Sie sich die Masse von 3 Tage alten Puppen.
  5. Nach dem Schlüpfen, legte eine weibliche und eine männlichen in einen einzigen Käfig mit 10% Saccharose und 2% Vitaminlösung (Abbildung 2E). Füllt die jeden Tag Saccharoselösung. Notieren Sie sich den Zeitpunkt des Todes für jede Motte.
  6. Wenn Eier gelegt werden, ändern sich täglich die Baumwollgaze. Zähle die Anzahl der Eier sofort. Graf frisch geschlüpften Nachwuchs, während sie schlüpfen.
  7. Während der Biotests, wählen Sie zufällig acht Personen für jede Behandlung des Infektionsstatus von HaDV2 zu bestätigen. Extrahieren Sie die Gesamt-RNA dieser Proben unter Verwendung handelsüblicher Trypsin-Reagensgemäß dem Protokoll des Herstellers. Synthese der cDNA des ersten Stranges nach dem Protokoll des Herstellers und verwenden Sie es als Vorlage zu testen, ob die Viren erfolgreich transkribiert werden.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Nachkommen von den Eltern , die HaDV2 frei (3A) waren , wurden als NONINF-Dehnungs aufgezogen. Wir amplifizierten erfolgreich die Actin - Gen der gleichen DNA - Vorlagen verwendet wird , was darauf hindeutet , dass die DNA - Matrizen waren von guter Qualität (3B). Darüber hinaus waren die zufällig ausgewählten acht Nachkommen auch frei von HaDV2 (3C), HaNPV (3D) und Wolbachia (3E). Schlossen wir wieder, daß die DNA - Proben der Nachkommen waren von guter Qualität, weil ein Teil des Actin - Gens erfolgreich für alle untersuchten Proben (Abbildung 3F) amplifiziert.

Eine Standardkurve , die die Beziehung zwischen dem Logarithmus der Qualität des Ausgangsmaterials und den gewonnenen CT - Werte definiert , erzeugt wurde, wie in der 4. Eine starke lineare Korrelation (R (Abbildung 4).

Unter Verwendung von 10-fach - Reihenverdünnungen zwischen 10 4 und 10 8 Kopienzahl / ul frisch geschlüpften Larven wurden mit einer Punkt - Standardkurve von HaDV2 flüssigen Fluiden beimpft. Wir erhielten eine lineare Korrelation zwischen der Infektion Frequenz und die Konzentrationen der HaDV2 flüssigen Fluiden; 10 8 Kopienzahl / ul ergab 100% Infektion für den Baumwollkapselwurm, aber auch andere Konzentrationen nicht (siehe auch Xu et al. 31). Die HaDV2 Infektion Frequenzen der Nachkommen von den Eltern mit unterschiedlichem Status HaDV2 Infektion waren wie folgt: 100% für ♀ + / ♂-, 78% für ♀- / ♂ +, und 100% für ♀ + / + ♂ (siehe auch Xu et al. 31).

zu cie ordnungsgemäße für individuelle Unterschiede in der HaDV2 Titer wir die HaDV2 Kopienzahl pro mg jeden Gewebe und den Prozentsatz des gesamten HaDV2 Titer für das spezifische Gewebe berechnet. Die Ergebnisse zeigten , dass HaDV2 hauptsächlich im Fettkörper verteilt wurde (Abbildung 5; siehe auch Xu et al . 31). Vergleiche der Lebenstabellenparameter, einschließlich der larvalen Perioden, Puppen Perioden, adult Länge und fecundity, wurden die in Tabelle 1 (siehe auch Xu et al. 31) gezeigt. Die Larven und Puppen Massen waren wie von Xu et al. 31. Der HaDV2 Infektionsstatus sowohl im NONINF-Stamms und der INF-Stamm wurde durch PCR (Ergebnisse veröffentlicht von Xu et al. 31) bestimmt.

Abbildung 1
Abbildung 1. Dissected Tissues für (A) Larvae, (B) einWeiblich Erwachsener, und (C) Ein männliche Erwachsene. H, Kopf (Gehirn); Er, Hämolymphe; FB, Fettkörper; Mt, Malpighischen Gefäße; G, gut; FG, foregut; MG, midgut; HG, Enddarm; Mu, Muskeln; O, Ovar; T, Hoden. Bitte klicken Sie hier , um eine größere Version dieser Figur zu sehen.

Figur 2
Abbildung 2. Bioassay Vorgehen Um die Auswirkungen von HaDV2 auf dem Baumwollkapselwurm zu bestimmen. (A) Beimpfung der frisch geschlüpften Larven mit HaDV2. (B) Die Übertragung der HaDV2-infizierten und HaDV2 freie Individuen zu 24-Well - Platten nach 48 h. (C) verschiedene Größen von HaDV2-infizierten und -freie Einzelpersonen. (D) Übertragung der fünften Instar - Larven auf neue Glasröhrchen (10 cm Höhe, 2 cm Durchmesser). (E) Die Platzierung einesweiblich und eine männlichen Motten in den gleichen Käfig erwachsene Langlebigkeit, Eiproduktion und Schlupfrate zu bestimmen. Bitte klicken Sie hier , um eine größere Version dieser Figur zu sehen.

Abbildung 3
Abbildung 3. Infektionsstatus für HaDV2, HaNPV oder Wolbachia in HaDV2-infizierten und HaDV2 freie Kolonien. HaDV2 Infektionsstatus in den weiblich und männlich Eltern (A). Infektionsstatus von HaDV2 (C), HaNPV (D) und Wolbachia (E) in den zufällig ausgewählten Nachkommen. Um die Qualität der genomischen DNA zu überprüfen, wurde der Housekeeping - Gene Actin auch für die Eltern verstärkt (B) und Nachkommen (F). Spur M zeigt den DL2000 Marker (2000 bp, 1000 bp, 750 bp, 500 bp, 250 bp, eind 100 bp). Spur 1: weiblicher Elternteil. Spur 2: männlicher Elternteil. Lane 3 bis 10: Nachkommen. Bitte klicken Sie hier , um eine größere Version dieser Figur zu sehen.

Abbildung 4
Abbildung 4. Die Standardkurve Korrelieren Log 2-transformierte HaDV2 Konzentrationen cycle threshold (CT) Werte. Bitte klicken Sie hier , um eine größere Version dieser Figur zu sehen.

Abbildung 5
Abbildung 5. Wirt-Gewebeverteilung von HaDV2 in Larven (A), erwachsene Frau (B) und Adult Male (C) Baumwollkapselwurm. Prozent (%) = das Verhältnis von HaDV2 in verschiedenen Geweben (pro mg), wie ich beschriebenn Schritt 4.7 Die Daten wurden statistisch durch eine Varianzanalyse analysiert (ANOVA) und Tukey-Test (Larven: n = 7; adulte Männchen: n = 6; adulten Weibchen: n = 6). Mittelwert ± SE. Die Ergebnisse wurden von Xu et al. 31. Bitte klicken Sie hier , um eine größere Version dieser Figur zu sehen.

Lebensgeschichte Parameter HaDV2 + HaDV2- t-Wert df P-Wert
Larvenzeit (Tage) Männlich 16,51 (± 0,72) 16,93 (± 1,21) 4,147 379 <0,001
Weiblich 16,51 (± 0,79) 16.80 (± 1,05) 2,732 312 0,0067
Pupal Zeit (Tage) Männlich 13,02 (± 0,68) 13,31 (± 0,69) 4,057 379 <0,001
Weiblich 11,62 (± 0,67) 12,00 (± 0,63) 5.1 312 <0,001
Langlebigkeit von Erwachsenen (Tage) Männlich 10,69 (± 1,98) 10,93 (± 2,46) 0,915 367 0,36
Weiblich 9,07 (± 1,98) 8,51 (± 1,58) 2,992 367 0,003
Anzahl der Eier pro Weibchen produziert 482 (± 174) 403 (± 180) 2,172 93 0,032
Anzahl der Schraffur pro Weibchen 207 (± 108) 143 (± 99) 3,026 93 0,0032

Tabelle 1 Lebensdaten Parameter für HaDV2 + und HaDV2-Baumwolle Kapselwurm. T-Test wird verwendet, um das Signifikanzniveau zu bestimmen. Mittelwert ± SE dargestellt. Die Daten in dieser Tabelle wurden von Xu et al. 31.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

In den letzten Jahrzehnten sind die meisten Studien über Insekten-Virus - Interaktionen auf die Gesundheit Honigbiene 34 konzentriert haben, 35, 36, Vektoren der Krankheit beim Menschen 37, Viren Anlage 38, und einige insektenpathogenen Viren , die ein großes Potenzial haben als biologische Bekämpfungsmittel 39. Wenig Aufmerksamkeit wurde auf verdeckte Viren in Insekten, vor allem in Lepidoptera-Schädlinge gezahlt worden ist. Hier präsentieren wir ein Protokoll für die Untersuchung der Wechselwirkungen zwischen einem verdeckten Virus und seinem Wirt Insekt. Ein Vergleich der Lebenstabellenparameter für virusinfizierte und virenfrei Host Individuen im Idealfall keine Auswirkungen von Unterschieden in der Host genetischen Hintergrund ausschließen sollte. Um die viralen Phänotyp zu studieren, haben viele frühere Studien die Lebenstabellenparameter entweder von natürlich infizierten oder nicht-infizierten Personen in der gleichen Kolonie oder Individuen verglichen geimpftdurch Mikroinjektion, aber diese Anstrengung ist Zeit 23 aufwendig, 40. Die orale Impfung von Baumwollkapselwurm mit HaDV2, hier beschrieben, dient als einfaches und wirksames Mittel virale Phänotypen zu analysieren. Dieses Verfahren gewährleistet auch den gleichen genetischen Hintergrund für HaDV2-infizierten und nicht infizierten HaDV2-Kolonien.

Virusinokulum kann auf viele Arten hergestellt werden. Die Reinigung von Viruspartikeln Hochgeschwindigkeitszentrifugation Verwendung hemmt Virusinfektiosität, in geringer Infektiosität führt; Daher wurde virushaltiger filtrierte Flüssigkeit verwendet , um die Baumwollkapselwurm - Larven 31 zu infizieren. Die Tatsache, dass der 0,22-um-Membran meist Pilz- und Bakterienpartikel aus HaDV2-enthaltenden ausfiltern kann gefilterte Flüssigkeit, und daß die HaDV2 frei filtrierte Flüssigkeit als Kontrolle verwendet wurde, konnte die Wirkung von anderen Viren auf unseren Ergebnisse auszuschließen. Wir können jedoch die Möglichkeit nicht ausschließen, dass die Bioassay-Ergebnisse könnte einlso von unentdeckten Viren vorgespannt werden. Daher sollte HaDV2 Partikel mit hohen Infektiosität ideal in Zukunft gereinigt wird robuste Ergebnisse zu erzielen.

Die Viruskonzentration positiv mit Virusinfektiosität korreliert; daher waren wir daran interessiert, die HaDV2 Konzentration bei der Bestimmung, die 100% Infektion ergeben wird. Unsere Ergebnisse zeigten , dass die 10 8 Kopienzahl / ul für das Virus Impfung verwendet werden könnte , um diese Infektion Rate zu erhalten. Zweifellos sollte die Korrelation zwischen Virustiter und Infektionsrate für andere Virus-Wirt-Interaktionen in der Zukunft untersucht untersucht werden. Darüber hinaus sollte auch der Virustiter jedes einzelnen auf dem Gebiet erkundet werden. Daher konnten wir dann die Wirkung von Viren auf Individuen im Bereich simulieren.

Die schonende Behandlung der empfindlichen Larven während der ersten paar Tage nach dem Schlüpfen ist sehr wichtig, weil sie leicht beschädigt tödlich sind. Darüber hinaus ist der HaDV2-nicht infiziert colony sollte separat im Gewächshaus gehalten werden HaDV2 kontaminations die Infektionsrate von HaDV2 wurde sehr hoch sein , fand sowohl im Feld und im Labor 31 zu verhindern.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren erklären, dass sie keine finanziellen Interessen haben.

Acknowledgments

Diese Arbeit wurde von der National Key Grundlagenforschungsprogramm von China (Nr 2013CB127602) und der Wissenschaftsfond für kreative Forschungsgruppen von der National Science Foundation of China (Nr 31321004) unterstützt.

Materials

Name Company Catalog Number Comments
24-well plate Corning 07-200-740 Multiple suppliers available.
DNA extraction kit TIANGEN DP304-03 Multiple suppliers available.
thermal cycler Veriti; Applied Biosystems 4375786
PBS Corning 21-040-CV
0.22 µm membrane filter Millipore SLGS025NB
pEASY-T Cloning Vector TransGen, Beijing, China CT301-02
Tweezers IDEAL-TEK 2.SA
Premix Ex Taq (Probe qPCR) Takara RR390A
Probes Invitrogen Custom order
Primers Invitrogen Custom order
microspectrophotometry NanoDrop 2000c  Thermo scientific  not available
7500 Real-Time PCR system Applied Biosystems not available
stereomicroscope SZX-16 Olympus not available
sucrose Multiple suppliers available.
vitamin complex Multiple suppliers available.

DOWNLOAD MATERIALS LIST

References

  1. Tang, P., Chiu, C. Metagenomics for the discovery of novel human viruses. Future Microbiol. 5, 177-189 (2010).
  2. Rosario, K., Breitbart, M. Exploring the viral world through metagenomics. Curr. Opin. Virol. 1, 289-297 (2011).
  3. Hugenholtz, P., Tyson, G. W. Microbiology - metagenomics. Nature. 455, 481-483 (2008).
  4. Kristensen, D. M., Mushegian, A. R., Dolja, V. V., Koonin, E. V. New dimensions of the virus world discovered through metagenomics. Trends Microbiol. 18, 11-19 (2010).
  5. Kleiner, M., Hooper, L. V., Duerkop, B. A. Evaluation of methods to purify virus-like particles for metagenomic sequencing of intestinal viromes. BMC Genomics. 16, 7 (2015).
  6. Ho, T., Tzanetakis, I. E. Development of a virus detection and discovery pipeline using next generation sequencing. Virology. 471, 54-60 (2014).
  7. Marx, C. J. Can you sequence ecology? Metagenomics of adaptive diversification. PLoS Biol. 11, e1001487 (2013).
  8. Radford, A. D., et al. Application of next-generation sequencing technologies in virology. J. Gen. Virol. 93, 1853-1868 (2012).
  9. Liu, S. J., Chen, Y. T., Bonning, B. C. RNA virus discovery in insects. Curr. Opin. Insect Sci. 8, 54-61 (2015).
  10. Mokili, J. L., Rohwer, F., Dutilh, B. E. Metagenomics and future perspectives in virus discovery. Curr. Opin. Virol. 2, 63-77 (2012).
  11. Liu, S. J., Vijayendran, D., Bonning, B. C. Next generation sequencing technologies for insect virus discovery. Viruses-Basel. 3, 1849-1869 (2011).
  12. Cook, S., et al. Novel virus discovery and genome reconstruction from field RNA samples reveals highly divergent viruses in Dipteran hosts. PLoS ONE. 8, e80720 (2013).
  13. Webster, C. L., et al. The discovery, distribution, and evolution of viruses associated with Drosophila melanogaster. PLoS Biol. 13, e1002210 (2015).
  14. Granberg, F., et al. Metagenomic detection of viral pathogens in spanish honeybees: co-infection by aphid lethal paralysis, israel acute paralysis and lake sinai viruses. PLoS ONE. 8, e57459 (2013).
  15. Runckel, C., et al. Temporal analysis of the honey bee microbiome reveals four novel viruses and seasonal prevalence of known viruses, Nosema, and Crithidia. PLoS ONE. 6, 20656 (2011).
  16. Cox-Foster, D. L., et al. A metagenomic survey of microbes in honey bee colony collapse disorder. Science. 318, 283-287 (2007).
  17. Chandler, J. A., Liu, R. M., Bennett, S. N. RNA shotgun metagenomic sequencing of northern California (USA) mosquitoes uncovers viruses, bacteria, and fungi. Front. Microbiol. 6, 185 (2015).
  18. Shi, C. Y., et al. A metagenomic survey of viral abundance and diversity in mosquitoes from Hubei province. PLoS ONE. 10, e0129845 (2015).
  19. Nouri, S., Salem, N., Nigg, J. C., Falk, B. W. Diverse array of new viral sequences identified in worldwide populations of the Asian citrus psyllid (Diaphorina citri) using viral metagenomics. J. Virol. 90, 2434-2445 (2016).
  20. Dayaram, A., et al. Identification of diverse circular single-stranded DNA viruses in adult dragonflies and damselflies (Insecta Odonata) of Arizona and Oklahoma, USA. Infect. Genet. Evol. 30, 278-287 (2015).
  21. Jakubowska, A. K., et al. Simultaneous occurrence of covert infections with small RNA viruses in the lepidopteran Spodoptera exigua. J.Invert. Pathol. 121, 56-63 (2014).
  22. Roossinck, M. J. Move over, Bacteria! Viruses make their mark as mutualistic microbial symbionts. J. Virol. 89, 6532-6535 (2015).
  23. Ryabov, E. V., Keane, G., Naish, N., Evered, C., Winstanley, D. Densovirus induces winged morphs in asexual clones of the rosy apple aphid, Dysaphis plantaginea. Proc. Natl. Acad. Sci. USA. 106, 8465-8470 (2009).
  24. Roossinck, M. J. The good viruses: viral mutualistic symbioses. Nat. Rev. Microbiol. 9, 99-108 (2011).
  25. Venkataraman, S., et al. Structure of seneca valley virus-001: an oncolytic picornavirus representing a new genus. Structure. 16, 1555-1561 (2008).
  26. Deterding, K., et al. Hepatitis a virus infection suppresses hepatitis c virus replication and may lead to clearance of hcv. J. Hepatol. 45, 770-778 (2007).
  27. Barton, E. S., et al. Herpesvirus latency confers symbiotic protection from bacterial infection. Nature. 447, 326-329 (2007).
  28. Ponferrada, V. G., Mauck, B. S., Wooley, D. P. The envelope glycoprotein of human endogenous retrovirus herv-w induces cellular resistance to spleen necrosis virus. Arch. Virol. 148, 659-675 (2003).
  29. Márquez, L. M., Redman, R. S., Rodriguez, R. J., Roossinck, M. J. A virus in a fungus in a plant: three-way symbiosis required for thermal tolerance. Science. 315, 513-515 (2007).
  30. Xu, P. J., et al. Complete genome sequence of a monosense densovirus infecting the cotton bollworm, Helicoverpa armigera. J. Virol. 86, 10909-10909 (2012).
  31. Xu, P. J., Liu, Y. Q., Graham, R. I., Wilson, K., Wu, K. M. Densovirus is a mutualistic symbiont of a global crop pest (Helicoverpa armigera) and protects against a baculovirus and Bt biopesticide. PLoS Pathog. 10, e1004490 (2014).
  32. Liang, G. M., Tan, W. J., Guo, Y. Y. An improvement in the technique of artificial rearing cotton bollworm. Plant Protec. 25, 15-17 (1999).
  33. Zhou, W. G., Rousset, F., O'Neill, S. Phylogeny and PCR-based classification of Wolbachia strains using wsp gene sequences. P. Roy. Soc. B-Biol. Sci. 265, 509-515 (1998).
  34. Mondet, F., de Miranda, J. R., Kretzschmar, A., Le Conte, Y., Mercer, A. R. On the front line: quantitative virus dynamics in honeybee (Apis mellifera L.) colonies along a new expansion front of the parasite Varroa destructor. PLoS Pathog. 10, e1004323 (2014).
  35. Chen, Y. P., et al. Israeli acute paralysis virus: epidemiology, pathogenesis and implications for honey bee health. PLoS Pathog. 10, e1004261 (2014).
  36. Hunter, W., et al. Large-scale field application of RNAi technology reducing israeli acute paralysis virus disease in honey bees (Apis mellifera, Hymenoptera: Apidae). PLoS Pathog. 6, e1001160 (2010).
  37. Halstead, S. B. Dengue virus - mosquito interactions. Annu. Rev. Entomol. 53, 273-291 (2008).
  38. Whitfield, A. E., Falk, B. W., Rotenberg, D. Insect vector-mediated transmission of plant viruses. Virology. 479-480, 278-289 (2015).
  39. Moscardi, F. Assessment of the application of baculoviruses for control of Lepidoptera. Annu. Rev. Entomol. 44, 257-289 (1999).
  40. Szelei, J., et al. Susceptibility of North-American and European crickets to Acheta domesticus densovirus (AdDNV) and associated epizootics. J. Invert. Pathol. 106, 394-399 (2011).
Protokolle für die Untersuchung die Host-Gewebeverteilung, Transmission-Modus und Effekt auf der Host-Fitness eines Densovirus im Cotton Bollworm
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Yang, X., Xu, P., Graham, R. I., Yuan, H., Wu, K. Protocols for Investigating the Host-tissue Distribution, Transmission-mode, and Effect on the Host Fitness of a Densovirus in the Cotton Bollworm. J. Vis. Exp. (122), e55534, doi:10.3791/55534 (2017).More

Yang, X., Xu, P., Graham, R. I., Yuan, H., Wu, K. Protocols for Investigating the Host-tissue Distribution, Transmission-mode, and Effect on the Host Fitness of a Densovirus in the Cotton Bollworm. J. Vis. Exp. (122), e55534, doi:10.3791/55534 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter