Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

코튼 면화씨 벌레의 Densovirus의 호스트 피트니스에 호스트 조직 배포, 전송 모드 및 효과 조사를위한 프로토콜

doi: 10.3791/55534 Published: April 12, 2017

Summary

여기, 우리는 나비목 종 내에서 densovirus의 호스트 피트니스에 호스트 조직 분포, 전송 모드, 효과, 면화 면화씨 벌레를 조사하기 위해 프로토콜을 제시한다. 이 프로토콜은 다른 구두로 전송 된 바이러스 및 그들의 곤충 호스트 사이의 상호 작용을 연구에 사용할 수 있습니다.

Abstract

많은 새로운 바이러스는 차세대 시퀀싱 기술을 사용하여 동물 호스트에서 발견되었다. 이전에, 우리는 나비목 종에서하는 의존형 바이러스, Helicoverpa의 armigera의 densovirus (HaDV2)를보고, 면화 면화씨 벌레, Helicoverpa의 armigera (Hubner). 여기서 우리는 현재 호스트에 HaDV2의 효과를 연구하는 데 사용되는 프로토콜을 설명합니다. 첫째, 우리는 하나의 번식 쌍에서 HaDV2없는면 면화씨 벌레의 식민지를 설정합니다. 하나 HaDV2 감염, 다른 감염되지 않은 : 그럼, 우리는 구두 같은 유전 적 배경이 개 식민지를 생산하기 위해 여과 된 액체를 HaDV2 함유 일부 신생아 애벌레 자손을 접종. HaDV2의 호스트 조직 분포 및 전송 효율을 결정하는 프로토콜이 같이 프로토콜은 또한 제공되는 HaDV2 감염 및 -uninfected 개인 사이에 생명 테이블 매개 변수 (예를 들어, 애벌레, 번데기 및 성인 기간과 생산력을) 비교. 이러한 프로토콜 하시다자민련은 또한 곤충 호스트, 특히 나비목 호스트에서 다른 구전 바이러스의 영향을 조사하기에 적합합니다.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

지난 몇 년간, 이러한 차세대 염기 서열로 시퀀싱 기술의 개발 (NGS)는 많은 새로운 DNA 및 RNA 바이러스, 특히 비병원성 바이러스뿐만 아니라 이전에 알려진 바이러스 1, 2, 3의 새로운 균주의 발견을 촉진했다 4, 5, 6, 7, 8, 9, 10, 11, 12. 모델 유기체 노랑 초파리에서, 20 개 이상의 새로운 부분 바이러스 게놈 군 유전체학 기술 (13)을 이용하여 검출 하였다. 새로운 바이러스를 포함한 많은 바이러스 성 시퀀스, 또한 꿀벌, m와 같은 다른 곤충에 확인 된osquitoes, 아시안 시트러스 psyllids 잠자리, 복수 종 나비목 14, 15, 16, 17, 18, 19, 20, 21.

향후, 더 새로운 바이러스는 이러한 고급 기술을 사용하여 곤충에서 발견 될 것으로 예상 할 수있다; 따라서, 바이러스 - 호스트 상호 작용에 대한 우리의 이해는 9 따라 6 변경 될 수 있습니다. 많은 새로운 바이러스가 의존형 파트너보다는 엄격한 병원체 (22)로 정의되기 때문에 예를 들어, 바이러스 - 호스트 상호 작용은 이전에 생각했던 것보다 더 복잡한 것으로 간주됩니다. 예를 들어, Dysaphis의 plantaginea에서 의존형 densovirus의 DplDNV는 날개 달린 모프를 유도하고 바이러스 (23)뿐만 아니라 호스트의 분산을 촉진, 이동성을 증가시킨다. 또한, 의존형 바이러스는 포유 동물의 건강, 가뭄과 식물의 내한성 및 세균 감염 (24)의 영향에 관해서 설명하고있다. 세네카 밸리 바이러스 001 신경 내분비 암 (25) 기능을 종양 세포를 선택적으로 세포 독성을 매개하는 것으로 도시되어있다. A 형 간염 바이러스 감염은 C 형 간염 바이러스의 복제를 억제하고 간염 C (26)로부터 회복 될 수 있습니다. 헤르페스 바이러스의 대기 시간은 세균 감염 27 공생 보호를 부여한다. 인간 내인성 레트로 바이러스 HERV-W의 엔벨로프 당 단백질이 비장 괴사 바이러스 28 세포 내성을 유도한다. 곰팡이 내생에서 Curvularia 열 내성 바이러스 (CThTV)은이 곰팡이와 열대 공황 잔디 사이 의존형의 상호 작용에 관여심판 "> 29. 따라서, 새로 발견 바이러스 및 그들의 호스트 간의 상호 작용에 대한 지식은 생물학 및 관리에 신선한 관점을 생성해야합니다. 그러나, 새로운 바이러스, 급성 감염의 전형적인 명백한 징후를 표시하지 특히 비밀 바이러스가 거의 없다 하고 조사, 우리는 자신의 호스트에 새로 발견 바이러스의 영향을 조사하기 위해 파이프 라인 및 프로토콜이 필요합니다.

이전에, 우리는면 면화씨 벌레, Helicoverpa의 armigera의 유병률 새로운 monosense densovirus Helicoverpa armigera densovirus (HaDV2)을보고하고, HaDV2과면 면화씨 벌레 (30), (31) 사이 의존형 관계의 증거를 제시 하였다. 본 논문에서는 자세히 HaDV2과면 면화씨 벌레 호스트 사이의 상호 작용을 연구하는 실험실 프로토콜을 설명합니다. 여기에 제시된 프로토콜은 또한 연구를 조사 연구에 매우 관련이있을 수특히 나비목 해충에, 다른 구두로 전송 된 바이러스의 OLE.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

HaDV2없는면 면화씨 벌레 식민지 1. 건설

  1. 뒤쪽면 면화씨 벌레 유충을 14 시간의 광 / 10 시간 다크 60 % 상대 습도 25 ± 1 ℃로 조절 된 성장 실 또는 인공 기후 실에서 인공식이 32 (H.의 armigera).
  2. 통풍이 잘되도록하고 산란 기판으로서 역할을 거즈로 피복 쌍당 ​​플라스틱 케이지 (10cm 높이 5cm 직경)를 사용하여 새로 eclosed 나방의 단일 쌍의 결합을 돕기. 바이러스 무료 식민지를 획득의 가능성을 높이기 위해 단일 쌍 교배의 최소 30 쌍을 사용합니다. 10 %, 설탕 2 % 비타민 솔루션 (32)와 피드 성인 나방은 목화 공에 담가 매일 보충.
  3. 여성 성인은 약 이일에게면 거즈에 후 짝짓기를 자신의 알을 낳기로, 매일 거즈를 변경합니다. 수집과 같은 성장 방에 거즈 포함 계란 (또는 인공 기후 참를 유지BER)을 알이 부화 할 때까지 성인 나방 등.
  4. 바로 한 개인으로, 새로운 24 웰 플레이트에 부화 된 유충을 전송 당 잘.
  5. 다섯 일 첫 번째 알을 낳는 일 이후, 부모 나방를 수집하고 액체 질소에 보관하십시오.
    참고 : 5 일 첫 알을 낳는 일 이후 나방 수집은 부모가 수집의 시점에서 살아 보장하기 때문에 DNA 추출 정확도에 죽은 나방을 사용 가능한 영향을 피할 수 있습니다.
  6. 제조업체의 지침에 따라 DNA 추출 키트를 사용하여 이러한 샘플에서 게놈 DNA를 분리합니다.
    1. 액틴 프라이머 F / R과 액틴 액틴 유전자의 574 bp의 단편을 증폭 (액틴 F : 5-CATCTACGAGGGTTACGC -3- 액틴 R : 5-CATCTGTTGGAAGGTGGA-3). 중합 효소 연쇄 반응 (PCR) 표준 프로토콜에 따라 아가로 스겔 전기 영동을 사용하여 제품을 시각화; 액틴 유전자의 성공적인 증폭 DNA가 좋은 품질의 것을 보장한다.
    2. t 평가특이 적 프라이머로 PCR을 사용하여 상위 나방 HaDV2에서의 그 존재 : DVVPF (GGATTGGCCTGGGAAATGAC) 및 DVVPR (CGTTGTTTTTATATCCGAGG) 31.
  7. 깨끗한 쌍은 적어도 다섯 세대가 하나의 HaDV2 - 감염되지 않은 번식 쌍에서, 후면 자손을 확인하고 HaDV2없는 식민지 (NONINF-주)로이 유지되면; HaDV2 감염은 콜로니 INF-균주로 정의된다.
  8. NONINF - 변형의 HaDV2 감염 상태를 확인하려면 (알려진 세균이나 호스트 개발에 대한 바이러스의 영향을 제외), 팔 개 무작위로 선택된 유충 개인의 HaDV2, WolbachiaH.의 armigera의 nucleopolyhedrovirus (HaNPV)의 감염 상태를 평가 (: HaNPV위한 HaDV2, NPVF / NPVR위한 DVVPF / DVVPR 및 Wolbachia 31 81F / 691R (33)과 특이 적 프라이머)를 사용하여 PCR NONINF-균주.
    참고 : 일부 바이러스는 후반이 될 수 있다고 알려져있다NT PCR의 기반 기술을 사용하여 탐지도 수준 감염된 호스트한다. NGS 기술은 더 바이러스 시퀀스는 게놈 DNA 샘플에 존재하지 않는 것을 확인하는 데 사용할 수 있습니다.

HaDV2 함유 액 유체 2. 제조

참고 : 우리는 HaDV2 바이러스 입자의 정제 시도가 감염 및 활동 (31)을 억제하는 것으로 나타났습니다; 따라서, 다음의 프로토콜 HaDV2 감염자를 필터링함으로써 감염성 HaDV2 용액을 달성하기 위해 수행된다.

  1. 개별적으로 성인 나방을 수집하고 즉시 액체 질소에 보관하십시오.
  2. 완전히 멸균 몰탈 및 유봉을 이용하여 액체 질소에서 수집 된 개별 나방 갈기. 깨끗한 1.5 ML 튜브에 약 10 μg의 파편을 전송합니다. 새로운 튜브에 남아있는 파편을 전송하고 즉시 -80 ° C에서 보관하십시오.
  3. 파편의 μg의 10에서 DNA를 추출, FOLLO날개 제조업체가 제공하는 프로토콜. 나방의 DNA가 분리되면 단계 1.6에 기재된 바와 같이, 상기 프로토콜을 사용하여 확인 HaDV2.
  4. 단계 230에서 얻어진 결과에 따르면, 두 그룹으로 분할 잔여 파편 : HaDV2 양성 및 음성을 HaDV2 그 감염 상태에 따라. 포스페이트 완충 식염수 1 ㎖를 추가 (PBS; 137 mM의 염화나트륨, 2.7 mM의 KCl을 8 밀리미터 나 2 HPO 4, 1.5 mM의 KH 2 PO 4, pH를 7.5) 각 행은 완전히 남아 유충 파편을 용해.
  5. 원심 4 ° C에서 15 분 동안 6,500 × g에서 (단계 2.4)에서 균질. 0.22 ㎛ 멤브레인 필터로 액체 상등액 필터. 여과 액 (튜브 당 200 μL)을 모으고 즉시 -80 ℃에서 보관.
    주 : 0.22 ㎛ 멤브레인 필터는 바람직하지 않은 미립자, 박테리아, 곰팡이의 대부분을 필터링한다. 처음 4 ℃로 원심 분리를 사전 냉각. 모든 프로토콜을 수행 involvi얼음상에서 여과 액의 동작을하는 겨 갈색 닝 및 응고의 파쇄를 방지한다.

HaDV2에 감염된면 면화씨 벌레 식민지 3. 건설

  1. HaDV2의 수평 전송 능력
    1. HaDV2 표준 곡선을 생성합니다.
      1. 드 노보 프라이머 HaDV2 바이러스의 정량화를 위해 사용된다 : 프로브 (GCCACCACTAGAGGACCCACCAGATG VP 프로브); (TGACAAGATCCAGCGTAGACATC VPR CTGGTGAGGCGATGGACATG VPF) 프라이머를 포함하는 단편을 증폭 (PF : GGACAATGCTGGTGAGGC를, PR : AATCCTCTTTGTCCGTTATCTATG 참조). PCR의 시스템 (31)에서 40 사이클 동안 72 ° C에서 94 ° C에서 30 초, 53 ℃에서 30 초, 60 초 및 다음 프로그램을 사용한다. 주형 DNA로 25 μL PCR 반응 게놈 DNA HaDV2 게놈을 포함한다 (단계 2.3) 1 μL를 추가한다. 제조 업체의 프로토콜에 따라 클로닝 벡터로 증폭 된 조각을 복제.
      2. 사본의 수를 계산하기 식으로 플라스미드 : N, A는 아보가드로 수 (6.02 × 1023 분자 / 몰)은 복사 / μL가 = (C × N의 A) / (N × M × 10 9); C는 microspectrophotometry을 사용하여 측정 될 수 플라스미드 (NG / μL)의 질량 농도이고; n은 PCR 생성물 (5,195 BP)를 함유하는 재조합 플라스미드의 길이이고; 및 M은 이중 가닥 DNA (660g / mol)의 평균 염기쌍의 분자량이다.
      3. 1.5 × 109의 농도로, 1.5mL 용량의 마이크로 원심 튜브에 1.5 × 108, 1.5 × 107, 1.5 × 106, 1.5 × 105, 1.5 × 104 카피 수를 여섯 10 배 희석액을 준비 / μL.
      4. THRE주기를 생성하기 위해 특이 적 프라이머 (VPF / VPR)과 프로브 (VP 프로브)를 이용하여 실시간 정량적 폴리머 라제 연쇄 반응 (qPCR에)을 수행단계 3.1.1.3에 기재된 플라스미드 마땅한 (CT) 값. 3 개 개의 독립적 인 기술 복제를 수행하고 추가 계산을 위해 그들을 평균.
      5. 상기의 결과를 사용하여, 종래 평균 CT 값으로 변환 된 LOG2 HaDV2 농도를 대응시킨 표준 곡선을 생성한다.
    2. 여과 액 체액 HaDV2 정량화.
      1. 피펫 DNA 추출에 HaDV2 함유 여과 액 유체 (단계 2.6)를 100 μL의 시험 샘플.
      2. 액상 유체에 대한 CT 값을 구하는 단계 3.1.1의 표준 곡선을 사용하여 카피 수를 계산하기 위해 실시간-qPCR을 사용.
    3. 상이한 농도의 HaDV2 감염된 여과 액체 경구 감염 효율을 결정한다.
      1. 다음 농도 HaDV2를 함유하는 액체 희석 유체 : 108, 107, 106, 105, 104, 0 카피 수 / μL.
      2. 인공 디 확산등 균일 고화 전에 9cm 직경의 페트리 접시. 균등 고체 인공식이의 표면에 각 농도 HaDV2 함유하는 여과 액 (200 μL)을 확산. 흄 후드에서이 작업을 수행합니다.
      3. 페트리 접시에 HaDV2 함유 인공 다이어트에 100 갓 부화 유충을 전송합니다. 부드럽게 흰 종이에 거즈에서 유충을 전송 (갓 부화 유충 포함)면 거즈를 넣었습니다. 부드럽게 용지를 이길 있도록 종이 오프 애벌레 스핀 실크와 "풍선". 실크를 터치 페트리 접시에 유충을 이동 살균 집게를 사용합니다.
      4. 48 시간 후, 24 웰 플레이트에 인공 다이어트 (물론 당 하나의 개인)에 유충을 전송합니다.
      5. 후면 성인 무대 위의 농도에서 HaDV2 접종 유충.
      6. 상기 성인 나방 수집 DNA를 추출하고, 단계 1.5에 기재된 바와 같이, PCR을 이용하여 검출 HaDV2.
        여기서 공동의 100 % HaDV2 감염 속도를 얻을 : 참고HaDV2 감염된 콜로니 (INF-균주)를 설정하므로 108 카피 수 / μL를 사용 tton의 bollworms.
  2. HaDV2의 수직 전송 능력
    1. 부정적인 : -; HaDV2 감염에 대한 긍정적 인 다음 NONINF 및 INF-균주에서 선택 성인 나방은 ♀- / ♂-, ♀ + / ♂-, ♀- / ♂ + 및 ♀ + / ♂ + (+의 단일 쌍을 생성하는 HaDV2 감염).
    2. 바이러스없는 24 웰 플레이트에 위 쌍의 자손을 이동; 후방 제 령의 유충.
    3. 단계 1.5에 기재된 바와 같이, HaDV2의 존재를 결정하기 위해 주형으로 사용하기 위해 수집 된 제 령 유충으로부터 DNA를 추출한다.

HaDV2 4. 조직 분포

  1. 바이러스 및 박테리아 오염을 방지 75 % 에탄올 겸자 가위를 세 번 소독하고 알코올 램프의 불꽃들을 가열하기.
    참고 : 집게 sterilizatio오염이 발생하면, N이 필요하다.
  2. 분석 균형을 사용하여 조직을 저장하는 데 사용되어야하는 빈 튜브의 무게.
  3. 약 5 분 동안 얼음에 INF - 변형의 유충과 성인 나방를 놓습니다.
  4. PBS 버퍼를 포함하는 깨끗한 페트리 접시에 애벌레, 성인 여성, 성인 남성의 실체 현미경 아래에 다음과 같은 조직을 해부하다.
    1. 유충, 피펫의 혈액 림프와 foregut, 중장, hindgut, 지방 시체를 해부하고, malpighian 세관 (그림 1A)를 참조하십시오. 즉시 액체 질소에서 튜브 각 조직을 옮긴다.
      1. 헤드 근처 마디 사이 막 마지막 복부 세그먼트 (도 1A)에 삽입하는 두 곤충 핀 (직경이 200㎛, 길이 20mm)을 사용 cystosepiment에 고정 유충 수정.
      2. 유충의 체액이 유출되도록 유충의 후부 복부 proleg 잘라. microp를 사용하여 10 초 이내 애벌레 혈액 림프을 피펫ipette는 혈액 림프의 갈변 및 응집을 방지합니다.
        주 : 페닐 티오 (50 ㎍ / ㎖) melanization 않도록 체액으로 1:20 부피 / 부피 비율로 혼합 될 수있다.
      3. 가위를 사용하여 헤드의 마지막 마디 사이에서부터 멤브레인 표피에 절개. 두 개의 집게를 사용하여 실체 현미경 나머지 모든 조직을 절개; 각 조직에 대한 사진이도 1a에 도시된다.
      4. 하나 개의 복제로 함께 세 개인에서 조직 샘플을 섞는다.
      5. 해부시 체액과 나머지 조직의 오염을 방지하기 위해, PBS의 해부 조직을 세 번 세척 버퍼. 이어서, 세척에 사용 된 PBS HaDV2의 감염 상태를 테스트한다. 최종 세척 버퍼가 HaDV2없는 경우, 조직은 혈액 림프 오염 깨끗해야합니다.
    2. 성인 여성의 경우, 머리 (뇌), 근육, 지방 몸, 창자, malpighian 세관 및 난소 (해부PBS 완충액에서 실체 현미경도 1b). 성인 남성의 경우, PBS 버퍼의 실체 현미경 아래 머리 (뇌), 근육, 지방 몸, 창자, malpighian 세관 및 고환 (그림 1C)를 해부. 즉시 액체 질소에서 튜브 각 조직을 옮긴다.
      1. 집게와 가위를 사용하여, 성인 나방의 날개를 제거하고 비늘을 취소 한 나머지 몸을 세 번 씻는다.
      2. 가위를 이용하여 머리, 가슴 및 복부 별개.
      3. 흉부의 내골격을 제거하고 근육을 수집합니다.
      4. 집게를 사용하여 복부의 표피를 제거하고 그림의 1B1C 다음과 같은 다른 조직을 해부하다.
      5. 하나 개의 복제로 함께 세 개인에서 조직 샘플을 섞는다. PBS의 해부 조직을 세 번 버퍼 씻으십시오.
  5. 그들이 동결되었을 때 튜브 및 상기 조직의 무게를 측정하고 확인 m상이한 조직의 엉덩이가 거의 동일하다.
    질량 (조직) = 질량 (튜브 / 조직 샘플) - 질량 (튜브 만)
  6. 이들 조직으로부터 DNA를 추출하고, 단계 3.1.2에서 설명 된 바와 같이, qPCR을 수행.
  7. 단계 3.1.1에서 생성 된 표준 곡선을 사용하여 각 조직 당 mg 카피 수를 계산한다. DNA 추출에 사용 된 조직의 양의 차이에 의한 시료의 바이어스를 보정하는 단위 질량 당 바이러스 역가를 사용한다.
  8. 다음과 같은 특정 조직에 HaDV2의 비율을 계산한다 HaDV2의 비율을 각 조직에 대해 = HaDV2 시험 조직 / (전체 조직 당 mg 카피 수의 총합)의 당 mg 수를 복사한다.

5. 생물학적 정량 시험 HaDV2 효과 호스트 발전

  1. 찾는 적어도 100 번데기 또는면 거즈 덮여, 5-L, 와이어 메쉬 케이지 NONINF-균주로부터 유래 새롭게 등장 성인 나방. 이일 후, 성관계 성인 여성은 거즈에 알을 낳기 시작합니다. 수집 및 유지 보수계란을 포함하는면 거즈; 계란은 약 3 일 만에 부화한다.
  2. HaDV2와 신생아 유충의 접종.
    1. INF-변형을 설정하는 HaDV2 (10 8 사본 번호 / μL)를 포함하는 인공 다이어트에 NONINF - 변형의 신생아 유충을 전송합니다.
    2. 유사하게, 대조군 (NONINF 변형률)을 확립 HaDV2없는 여과 액 (단계 2.4)으로 덮여 인공 다이어트 신생아 유충 옮긴다. 각 처리 (도 2A)에서 적어도 240의 유충을 포함한다.
      주 : 유충 NONINF- 및 INF-균주를 생성하는 데 사용되는 동일한 유전 적 배경을 보장하는 동시에 동일한 상위 집단 창구로부터 유도된다. NONINF- 및 INF-균주 개발 동기 율 (14 시간의 광 / 10 시간 다크 60 % 상대 습도, 25 ± 1 ℃에서) 동일한 기후 실에 보존되어 있는지 확인; 속도는 온도 및 습도에 따라 달라질 수있다. 델 리치를 처리부드럽게 애벌레를 먹었다.
  3. 48 시간 후, 24 웰 플레이트 (웰 당 개별) (도 2b)에 개별적으로 유충을 전송.
    1. 순차적으로 번호를 각 각 웰의 유충과 매일 령 단계 및 생존 상태를 기록한다.
    2. 인공식이 요법이 저하되면 약 5 일 후, 동시에 신선한 인공 다이어트 (그림 2C)를 포함하는 새로운 24 웰 플레이트에이 개인을 전송합니다.
    3. 0.0001 g의 정밀도로 분석 저울을 사용하여 11 부화 후에 7 일에서 유충의 무게를. 무게 후, 개별적으로 24 웰 플레이트에 유충을 반환합니다.
  4. 네번째 탈피 한 후 제 령을 탈피시 (열 주위 일간 부화 한 후), 유리관 (10cm 높이 2cm 직경) (도 2D)에 전송 유충; 다섯째 령 유충은 헤드 캡슐 (약 2.6 mm)의 폭에 의해 식별 될 수있다.
    참고 : 개인 이동동시에 유리관 하루에.
    1. 코드 페인트 나 마커를 이용하여 유리관에 원래의 참조 번호와 함께 애벌레. 매일 애벌레 상태를 기록; 5 일 - 번데기 단계는 약 십일일 지속 한 후 유리관에, 유충이 번데기가되다됩니다.
    2. 유리관에 각각의 번데기와 우화 날짜를 기록합니다. 3 일짜리 번데기의 질량을 기록합니다.
  5. 우화 후, 10 %의 자당과 2 %의 비타민 용액 (도 2E) 단일 케이지 한 여성 및 남성 하나 넣어. 매일 자당 솔루션을 보충. 각 나방에 대한 죽음의 날짜를 기록합니다.
  6. 계란이 마련되면, 매일면 거즈를 변경합니다. 바로 계란의 수를 계산합니다. 그들이 부화 동안 새로 부화 된 새끼를 계산합니다.
  7. 각 치료 HaDV2의 감염 상태를 확인하기위한 생물 검정 동안 무작위로 여덟 개인을 선택합니다. 트립신 상업적 시약을 사용하여이 샘플의 총 RNA를 추출제조 업체의 프로토콜을 다음과 같습니다. 제조 업체의 프로토콜 다음 첫 번째 가닥의 cDNA를 합성하고, 바이러스가 성공적으로 전사 여부를 테스트하기 위해 템플릿으로 사용할 수 있습니다.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

HaDV2없는 (그림 3A)이었다 부모로부터 자손은 NONINF - 변형으로 사육되었다. 우리는 성공적으로 DNA 템플릿 좋은 품질 (그림 3B)의 있다고 제안, 같은 DNA 템플릿을 사용하여 액틴 유전자를 증폭. 또한, 무작위로 선택된 자손은 여덟 HaDV2 (도 3c) HaNPV (도 3D),Wolbachia (도 3E)에 자유로웠다. 다시,이 액틴 유전자의 일부가 성공적으로 테스트 된 모든 샘플 (도 3f)에 대해 증폭 되었기 때문에 자손의 DNA 샘플, 양질의 결론을 내렸다.

출발 물질의 품질 및 얻은 CT 값의 로그 사이의 관계를 정의하는 표준 곡선은도 4와 같이 생성 하였다. 강한 선형 상관 관계 (R (도 4) 사이에서 발견되었다.

갓 부화 된 유충은 카피 수 / μL 8 4 10 ~ 10 10 배 희석액을 이용하여 액체 HaDV2 유체 점 표준 곡선을 접종 하였다. 우리는 감염 주파수와 HaDV2 액체 유체의 농도 간의 선형 상관 관계를 수득; 108은 카피 수 / μL 솜 면화씨 벌레 100 % 감염을 수득하지만, 다른 농도 (또한 슈 외. 31 참조)하지 않았다. 다음과 같이 다른 HaDV2 감염 상태와 부모로부터 자손의 HaDV2 감염 주파수 하였다 : 100 % ♀ 대해 + / ♂- 78 %를 ♀- + / ♂ + (참고 쑤 ♀ 대 / ♂ +, 100 % 등의 알. 31).

C까지orrect HaDV2 역가 개인차 우리는 각 조직의 밀리그램 당 HaDV2 사본 번호 및 특정 조직에 대한 총 HaDV2 역가의 비율을 계산 하였다. (; 참고 슈 (31) 등,도 5). 그 결과 HaDV2 주로 체지방 분포한다고 밝혀졌다. 애벌레 기간, 번데기 기간 성인 길이 및 번식력 포함 수명 테이블 매개 변수의 비교를 표 1에 나타내었다 (도 쑤 외. 31 참조).등이 발표 한 애벌레와 번데기 대중이었다. (31). NONINF 변형률 및 INF-균주 모두에서 HaDV2 감염 상태는 PCR (슈 외. (31)에 의해 번역 결과)에 의해 결정 하였다.

그림 1
도 1 해부 조직에 대한 (A) 유충 (B)를여성 성인 및 (C) 남성 성인. H, 헤드 (뇌); 그는, 혈액 림프; FB, 뚱뚱한 몸; 산, Malpighian 세관; G, 장; , foregut FG; MG, 중장; HG, hindgut; 뮤, 근육; 난소 O; T, 고환. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 2
코튼 면화씨 벌레에 HaDV2의 효과를 파악하기 위해 2 생물학적 검정 절차도. HaDV2와 갓 부화 유충의 (A) 접종. (B) 48 시간 후 24 웰 플레이트에 HaDV2 감염 및 HaDV2없는 개인의 전사. (C) HaDV2-감염 - 무료 개인의 다른 크기. 새로운 유리관 (10cm 높이 2cm 직경) 내지 다섯 번째 령 유충의 (D) 이동. (E) 하나의 배치성인 장수, 계란 생산 및 해치 속도를 결정하는 여성과 같은 케이지에 한 남성 나방. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 3
HaDV2 감염 및 HaDV2없는 식민지에서 HaDV2, HaNPV, 또는 Wolbachia 그림 3. 감염 상태. 여성과 남성의 부모에 HaDV2 감염 상태 (A). 임의로 선택된 자손에서 HaDV2 (C) HaNPV (D),Wolbachia (E)의 감염 상태. 게놈 DNA의 품질을 확인하기 위해 하우스 키핑 유전자 액틴 또한 부모 (B) 및 자손 (F)에 대한 증폭 하였다. 레인 M은 마커 DL2000 (BP 2,000, 1,000 염기쌍, 750 염기쌍, 500 염기쌍, 250 염기쌍을 보여준다D 100 염기쌍). 레인 1 : 여성 부모. 레인 2 : 남성의 부모입니다. 레인 3-10 : 자손. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 4
사이클 역치 (CT) 값도 4 표준 곡선 상관 로그 -2- 변환 HaDV2 농도. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 5
그림 애벌레 (A)에서 HaDV2 5. 호스트 조직 분포, 성인 여성 (B), 그리고 성인 남성 (C)면 Bollworms. 백분율 (%) = (당 mg) 다른 조직 HaDV2의 비율로 난 바와N 단계 4.7 데이터는 변동 (ANOVA) 및 Tukey에의 테스트 분석을 이용하여 통계적으로 분석 하였다 (애벌레 : N = 7; 성인 남성 : N = 6; 성인 여성 : N = 6). ± SE는 것을 의미한다. 결과는 쑤 외 알에 의해 출판되었다. (31). 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

생명의 역사 매개 변수 HaDV2 + HaDV2- t 값 DF P 값
애벌레 기간 (일) 남성 16.51 (± 0.72) 16.93 (± 1.21) 4.147 379 <0.001
여자 16.51 (± 0.79) 16.80 (± 1.05) 2.732 (312) 0.0067
번데기 기간 (일) 남성 13.02 (± 0.68) 13.31 (± 0.69) 4.057 379 <0.001
여자 11.62 (± 0.67) 12.00 (± 0.63) 5.1 (312) <0.001
성인의 장수 (일) 남성 10.69 (± 1.98) 10.93 (± 2.46) 0.915 367 0.36
여자 9.07 (± 1.98) 8.51 (± 1.58) 2.992 367 0.003
계란의 수는 여성 당 생산 482 (174 ±) 403 (180 ±) 2.172 93 0.032
여성 당 선영의 수 207 (108 ±) 143 (± 99) 3.026 93 0.0032

HaDV2 +와 HaDV2-면 Bollworms 표 1. 생명의 역사 매개 변수. 학생의 t- 검정은 유의 수준을 결정하는 데 사용됩니다. ± SE가 표시됩니다 의미합니다. 이 표에 제시된 데이터는 쑤 외 알에 의해 출판되었다. (31).

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

지난 몇 십 년간, 곤충 바이러스의 상호 작용에 대한 대부분의 연구는 꿀벌 건강 34, 35, 36, 인간의 질병 (37)의 벡터에 집중 한 공장은 38 바이러스 및 생물학적 조절제 (39)와 같은 큰 잠재력을 가지고 몇 가지 곤충 병원성 바이러스. 작은 관심이 특히 나비목 해충에 곤충의 비밀 바이러스에 지불하고있다. 여기, 우리는 비밀 바이러스 및 호스트 곤충 사이의 상호 작용의 연구에 대한 프로토콜을 제시한다. 바이러스에 감염된 바이러스가없는 호스트 개인 생활 테이블 매개 변수의 비교는 이상적으로 호스트 유전 적 배경의 차이의 영향을 제외해야합니다. 바이러스 표현형을 연구하기 위해 많은 선행 연구는 접종 같은 식민지 또는 개인의 자연적 감염 또는 감염되지 않은 개인의 생명 테이블 매개 변수를 비교 한미세 주입법에 의해, 그러나이 노력은 시간, 23 (40)이 소요됩니다. 여기서 설명 HaDV2 코튼 bollworms의 경구 접종, 바이러스 표현형을 분석하기위한 간단하고 효과적인 수단을 구성한다. 이 절차는 또한 HaDV2 감염 및 HaDV2-감염되지 않은 식민지에 대해 동일한 유전 적 배경을 보장합니다.

바이러스 접종은 여러 가지 방법으로 제조 할 수있다. 고속 원심 분리하여 바이러스 입자의 정제는 낮은 감염의 결과로, 바이러스 감염을 억제; 따라서, 바이러스 - 함유 여과 액을 솜 면화씨 벌레 유충 (31)를 감염하는데 사용 하였다. 0.22 ㎛ 멤브레인은 HaDV2 - 함유 여과 액으로부터 상기 HaDV2없는 여과 액이 연구 결과에 다른 바이러스의 영향을 배제 할 수 제어로 사용하는 것을 가장 진균 및 세균 입자를 걸러 낼 수 있다는 사실. 그러나, 우리는 가능성을 배제 할 수 없다는 생물 검정 결과 수있는LSO는 알려지지 않은 바이러스에 의해 바이어스된다. 따라서, 높은 감염과 HaDV2 입자는 이상적으로 견고한 결과를 얻기 위해 앞으로 정제한다.

바이러스 농도는 긍정적 인 바이러스 감염과의 상관 관계; 따라서, 우리는 100 % 감염을 얻을 것이다 HaDV2 농도를 결정하는 데 관심이 있었다. 우리의 결과는 10 (8) 사본 번호 / μL이 감염 속도를 얻기 위해 바이러스 접종에 사용될 수 있음을 보여 주었다. 의심 할 여지없이, 바이러스 역가와 감염 속도 사이의 상관 관계는 향후 연구 다른 바이러스 - 호스트 상호 작용에 대해 연구해야한다. 또한, 현장에서 각 개인의 바이러스 역가도 모색해야한다. 따라서, 우리는 그 분야에서 개인에 따라 바이러스의 효과를 시뮬레이션 할 수 있습니다.

그들은 쉽게 치명적으로 손상 때문에 부화 후 처음 몇 일 동안 섬세한 유충의 부드러운 핸들링은 매우 중요하다. 또한, 감염되지 않은 HaDV2-COLONY가 HaDV2을 방지하기 위해 온실에 별도로 보관한다 오염 - 더 HaDV2의 감염률은 필드 및 기관 (31) 모두에서 높은 것으로 밝혀졌다.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

저자는 더 경쟁 재정적 이해 관계가 없음을 선언합니다.

Acknowledgments

이 작품은 중국의 국가 중점 기초 연구 프로그램 (제 2013CB127602)과 중국의 국립 과학 재단 (National Science Foundation) (번호 31321004)의 창조적 인 연구 그룹에 대한 과학 기금에 의해 지원되었다.

Materials

Name Company Catalog Number Comments
24-well plate Corning 07-200-740 Multiple suppliers available.
DNA extraction kit TIANGEN DP304-03 Multiple suppliers available.
thermal cycler Veriti; Applied Biosystems 4375786
PBS Corning 21-040-CV
0.22 µm membrane filter Millipore SLGS025NB
pEASY-T Cloning Vector TransGen, Beijing, China CT301-02
Tweezers IDEAL-TEK 2.SA
Premix Ex Taq (Probe qPCR) Takara RR390A
Probes Invitrogen Custom order
Primers Invitrogen Custom order
microspectrophotometry NanoDrop 2000c  Thermo scientific  not available
7500 Real-Time PCR system Applied Biosystems not available
stereomicroscope SZX-16 Olympus not available
sucrose Multiple suppliers available.
vitamin complex Multiple suppliers available.

DOWNLOAD MATERIALS LIST

References

  1. Tang, P., Chiu, C. Metagenomics for the discovery of novel human viruses. Future Microbiol. 5, 177-189 (2010).
  2. Rosario, K., Breitbart, M. Exploring the viral world through metagenomics. Curr. Opin. Virol. 1, 289-297 (2011).
  3. Hugenholtz, P., Tyson, G. W. Microbiology - metagenomics. Nature. 455, 481-483 (2008).
  4. Kristensen, D. M., Mushegian, A. R., Dolja, V. V., Koonin, E. V. New dimensions of the virus world discovered through metagenomics. Trends Microbiol. 18, 11-19 (2010).
  5. Kleiner, M., Hooper, L. V., Duerkop, B. A. Evaluation of methods to purify virus-like particles for metagenomic sequencing of intestinal viromes. BMC Genomics. 16, 7 (2015).
  6. Ho, T., Tzanetakis, I. E. Development of a virus detection and discovery pipeline using next generation sequencing. Virology. 471, 54-60 (2014).
  7. Marx, C. J. Can you sequence ecology? Metagenomics of adaptive diversification. PLoS Biol. 11, e1001487 (2013).
  8. Radford, A. D., et al. Application of next-generation sequencing technologies in virology. J. Gen. Virol. 93, 1853-1868 (2012).
  9. Liu, S. J., Chen, Y. T., Bonning, B. C. RNA virus discovery in insects. Curr. Opin. Insect Sci. 8, 54-61 (2015).
  10. Mokili, J. L., Rohwer, F., Dutilh, B. E. Metagenomics and future perspectives in virus discovery. Curr. Opin. Virol. 2, 63-77 (2012).
  11. Liu, S. J., Vijayendran, D., Bonning, B. C. Next generation sequencing technologies for insect virus discovery. Viruses-Basel. 3, 1849-1869 (2011).
  12. Cook, S., et al. Novel virus discovery and genome reconstruction from field RNA samples reveals highly divergent viruses in Dipteran hosts. PLoS ONE. 8, e80720 (2013).
  13. Webster, C. L., et al. The discovery, distribution, and evolution of viruses associated with Drosophila melanogaster. PLoS Biol. 13, e1002210 (2015).
  14. Granberg, F., et al. Metagenomic detection of viral pathogens in spanish honeybees: co-infection by aphid lethal paralysis, israel acute paralysis and lake sinai viruses. PLoS ONE. 8, e57459 (2013).
  15. Runckel, C., et al. Temporal analysis of the honey bee microbiome reveals four novel viruses and seasonal prevalence of known viruses, Nosema, and Crithidia. PLoS ONE. 6, 20656 (2011).
  16. Cox-Foster, D. L., et al. A metagenomic survey of microbes in honey bee colony collapse disorder. Science. 318, 283-287 (2007).
  17. Chandler, J. A., Liu, R. M., Bennett, S. N. RNA shotgun metagenomic sequencing of northern California (USA) mosquitoes uncovers viruses, bacteria, and fungi. Front. Microbiol. 6, 185 (2015).
  18. Shi, C. Y., et al. A metagenomic survey of viral abundance and diversity in mosquitoes from Hubei province. PLoS ONE. 10, e0129845 (2015).
  19. Nouri, S., Salem, N., Nigg, J. C., Falk, B. W. Diverse array of new viral sequences identified in worldwide populations of the Asian citrus psyllid (Diaphorina citri) using viral metagenomics. J. Virol. 90, 2434-2445 (2016).
  20. Dayaram, A., et al. Identification of diverse circular single-stranded DNA viruses in adult dragonflies and damselflies (Insecta Odonata) of Arizona and Oklahoma, USA. Infect. Genet. Evol. 30, 278-287 (2015).
  21. Jakubowska, A. K., et al. Simultaneous occurrence of covert infections with small RNA viruses in the lepidopteran Spodoptera exigua. J.Invert. Pathol. 121, 56-63 (2014).
  22. Roossinck, M. J. Move over, Bacteria! Viruses make their mark as mutualistic microbial symbionts. J. Virol. 89, 6532-6535 (2015).
  23. Ryabov, E. V., Keane, G., Naish, N., Evered, C., Winstanley, D. Densovirus induces winged morphs in asexual clones of the rosy apple aphid, Dysaphis plantaginea. Proc. Natl. Acad. Sci. USA. 106, 8465-8470 (2009).
  24. Roossinck, M. J. The good viruses: viral mutualistic symbioses. Nat. Rev. Microbiol. 9, 99-108 (2011).
  25. Venkataraman, S., et al. Structure of seneca valley virus-001: an oncolytic picornavirus representing a new genus. Structure. 16, 1555-1561 (2008).
  26. Deterding, K., et al. Hepatitis a virus infection suppresses hepatitis c virus replication and may lead to clearance of hcv. J. Hepatol. 45, 770-778 (2007).
  27. Barton, E. S., et al. Herpesvirus latency confers symbiotic protection from bacterial infection. Nature. 447, 326-329 (2007).
  28. Ponferrada, V. G., Mauck, B. S., Wooley, D. P. The envelope glycoprotein of human endogenous retrovirus herv-w induces cellular resistance to spleen necrosis virus. Arch. Virol. 148, 659-675 (2003).
  29. Márquez, L. M., Redman, R. S., Rodriguez, R. J., Roossinck, M. J. A virus in a fungus in a plant: three-way symbiosis required for thermal tolerance. Science. 315, 513-515 (2007).
  30. Xu, P. J., et al. Complete genome sequence of a monosense densovirus infecting the cotton bollworm, Helicoverpa armigera. J. Virol. 86, 10909-10909 (2012).
  31. Xu, P. J., Liu, Y. Q., Graham, R. I., Wilson, K., Wu, K. M. Densovirus is a mutualistic symbiont of a global crop pest (Helicoverpa armigera) and protects against a baculovirus and Bt biopesticide. PLoS Pathog. 10, e1004490 (2014).
  32. Liang, G. M., Tan, W. J., Guo, Y. Y. An improvement in the technique of artificial rearing cotton bollworm. Plant Protec. 25, 15-17 (1999).
  33. Zhou, W. G., Rousset, F., O'Neill, S. Phylogeny and PCR-based classification of Wolbachia strains using wsp gene sequences. P. Roy. Soc. B-Biol. Sci. 265, 509-515 (1998).
  34. Mondet, F., de Miranda, J. R., Kretzschmar, A., Le Conte, Y., Mercer, A. R. On the front line: quantitative virus dynamics in honeybee (Apis mellifera L.) colonies along a new expansion front of the parasite Varroa destructor. PLoS Pathog. 10, e1004323 (2014).
  35. Chen, Y. P., et al. Israeli acute paralysis virus: epidemiology, pathogenesis and implications for honey bee health. PLoS Pathog. 10, e1004261 (2014).
  36. Hunter, W., et al. Large-scale field application of RNAi technology reducing israeli acute paralysis virus disease in honey bees (Apis mellifera, Hymenoptera: Apidae). PLoS Pathog. 6, e1001160 (2010).
  37. Halstead, S. B. Dengue virus - mosquito interactions. Annu. Rev. Entomol. 53, 273-291 (2008).
  38. Whitfield, A. E., Falk, B. W., Rotenberg, D. Insect vector-mediated transmission of plant viruses. Virology. 479-480, 278-289 (2015).
  39. Moscardi, F. Assessment of the application of baculoviruses for control of Lepidoptera. Annu. Rev. Entomol. 44, 257-289 (1999).
  40. Szelei, J., et al. Susceptibility of North-American and European crickets to Acheta domesticus densovirus (AdDNV) and associated epizootics. J. Invert. Pathol. 106, 394-399 (2011).
코튼 면화씨 벌레의 Densovirus의 호스트 피트니스에 호스트 조직 배포, 전송 모드 및 효과 조사를위한 프로토콜
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Yang, X., Xu, P., Graham, R. I., Yuan, H., Wu, K. Protocols for Investigating the Host-tissue Distribution, Transmission-mode, and Effect on the Host Fitness of a Densovirus in the Cotton Bollworm. J. Vis. Exp. (122), e55534, doi:10.3791/55534 (2017).More

Yang, X., Xu, P., Graham, R. I., Yuan, H., Wu, K. Protocols for Investigating the Host-tissue Distribution, Transmission-mode, and Effect on the Host Fitness of a Densovirus in the Cotton Bollworm. J. Vis. Exp. (122), e55534, doi:10.3791/55534 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter