Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Протоколы для исследования распределения Хоста-ткань, Transmission-режим, и эффекта на хост приспособленности Densovirus в хлопковой совке

doi: 10.3791/55534 Published: April 12, 2017

Summary

Здесь мы приводим протокол для исследования распределения хоста-ткани, режима передачи, и влияния на хозяин пригодности к densovirus в пределах чешуекрылых видов, хлопковую совку. Этот протокол также может быть использован для изучения взаимодействия между другими устно передаваемых вирусов и их хозяев насекомых.

Abstract

Многие новые вирусы были обнаружены в животных-хозяев с использованием технологии секвенирования следующего поколения. Ранее мы сообщали о мутуалистическом вирусе, совок хлопковой densovirus (HaDV2), в течение чешуекрылых видов, хлопковый совок, совок хлопкового (Хюбнер). Здесь мы описываем протоколы, которые в настоящее время используются для изучения влияния HaDV2 на его хозяин. Во-первых, мы устанавливаем HaDV2 свободного хлопка совки колонию из одной пары разведения. Затем мы пероральны инокуляция некоторого Новорожденных личинок потомства с HaDV2 содержащими отфильтрованную жидкостью для получения два колоний с одной и тем же генетическим фоном: один HaDV2-инфицированными, а другой неинфицированных. Протокол для сравнения параметров жизненного таблицы (например, личиночной, куколки и взрослые периоды и плодовитость) между HaDV2-инфицированных и лиц -uninfected также представлен, как и протоколы для определения распределения хост-ткани и эффективность передачи HaDV2. Эти протоколы Woпакетирования также подходит для изучения влияния других устно передаваемых вирусов на своих хозяев насекомых, чешуекрылых хозяев, в частности.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

В последние несколько десятилетий, развитие секвенирования технологий , таких как следующего поколения секвенирования (NGS) способствовал открытию многих новых ДНК и РНК вирусов, особенно непатогенные вирусы, но и новых изолятов ранее известных вирусов 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12. В модели организма дрозофилы, более 20 новых частичные вирусные геномы были обнаружены с помощью методов метагеномных 13. Многие вирусные последовательности, в том числе новых вирусов, также были идентифицированы в других насекомых, такие как пчелы, мosquitoes, азиатские цитрусовые psyllids, стрекозы, а также несколько видов чешуекрылых 14, 15, 16, 17, 18, 19, 20, 21.

В будущем можно ожидать, что более новые вирусы будут обнаружены у насекомых с использованием этих передовых технологий; следовательно, наше понимание взаимодействия вирус-хозяин может измениться соответственно 6, 9. Например, вирус-хозяин взаимодействия считается более сложным , чем считалось ранее, поскольку многие новые вирусы определяется как мутуалистических партнерами , а не строгих патогенов 22. Например, мутуалистический densovirus DplDNV в Dysaphis plantaginea индуцирует крылатый морф и увеличивает подвижность, способствуя рассеиванию хозяина, а также вирусом 23. Кроме того, мутуалистические вирусы были описаны в отношении здоровья млекопитающих, засуху и холод растений, а также влияние бактериальных инфекций 24. Сенека долина вирус-001 показан в качестве посредника селективной цитотоксичности по отношению к опухолевым клеткам с раком нейроэндокринной особенностью 25. Вирусные инфекции гепатита А подавляет репликацию вируса гепатита С и может привести к восстановлению от гепатита С 26. Герпесвирусная задержка дает симбиотические защиту от бактериальной инфекции 27. Гликопротеин оболочки человеческого эндогенного ретровируса HERV-W индуцирует клеточную устойчивость к селезенке некроза вируса 28. Curvularia вирус тепловой толерантности (CThTV) от грибкового эндофита участвуют в мутуалистическом взаимодействии гриба и тропический панический травыисх "> 29. Таким образом, знание взаимодействий между вновь обнаруженных вирусов и их хозяев должны генерировать новые перспективы по их биологии и управления. Тем не менее, новые вирусы, особенно скрытые вирусы не отображающие никаких очевидных признаков , характерных для острой инфекции, редко были исследованы, и нам нужен трубопровод и протоколы для расследования последствий вновь обнаруженных вирусов на своих хозяев.

Ранее мы уже сообщали о распространенности нового monosense densovirus совка хлопковая densovirus (HaDV2) в хлопковой совки, совка хлопковая, и представил доказательства в мутуалистических отношений между HaDV2 и хлопковой совки 30, 31. В этой статье мы опишем лабораторный протокол подробно изучить взаимодействие между HaDV2 и его хлопком совкой хозяином. Протокол, представленные здесь, также может быть весьма актуальным для исследователей, изучающих голе других устно передаваемых вирусов, особенно в чешуекрылых вредителей.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Строительство HaDV2 свободной хлопковой совки колонии

  1. Личинки совка сзади хлопок (Х. armigera) на искусственной диете 32 в контролируемой комнате роста или искусственной климатической камере при температуре 25 ± 1 ° С, с 14 ч света / 10 ч темными и 60% относительной влажностью.
  2. Aid одной пары спаривание вновь eclosed моли с помощью пластиковой клетке на пару (высота 10 см, диаметр 5 см), покрытый хлопчатобумажной марли, чтобы обеспечить хорошую вентиляцию и служить в качестве подложки яйцекладки. Для того, чтобы увеличить вероятность получения вируса свободной колонии, используют по меньшей мере, 30 пар одной пары спариваний. Питание для взрослых моли с 10% сахара и 2% -ным раствором 32 витаминной замачивают на ватный тампон и пополняется ежедневно.
  3. Как взрослые самки откладывают яйца на хлопковой марле примерно на 2-е дня после спаривания, менять марлю ежедневно. Собрать и сохранить марля, содержащие яйца в одной комнате роста (или искусственный климат ЧБер), как взрослые мотыльки, пока высиживают яйца.
  4. Немедленно передать только что вылупившихся личинок на новые 24-луночные планшеты, с одного человека на лунку.
  5. Через пять дней после первой яйцекладки даты, собирать родительскую моль и хранить их в жидком азоте.
    Примечание: Сбор моли 5 дней после первой яйцекладки даты гарантирует, что родители живы в момент сбора и, следовательно, позволяет избежать любых возможных последствий использования мертвых мотыльков на точности экстракции ДНК.
  6. Изолировать геномную ДНК из этих образцов с использованием набора для экстракции ДНК, в соответствии с инструкциями изготовителя.
    1. Амплифицировать 574 п.н. фрагмент гена актина с праймерами актина F / R актин (актин F: 5-CATCTACGAGGGTTACGC-3 и актина R: 5-CATCTGTTGGAAGGTGGA-3). Визуализируйте полимеразной цепной реакции (ПЦР) продуктов с использованием электрофореза в агарозном геле в соответствии со стандартными протоколами; успешное усиление гена актина гарантирует, что ДНК хорошего качества.
    2. Оценка тон наличие HaDV2 в родительских моли с помощью ПЦР с использованием специфических праймеров: DVVPF (GGATTGGCCTGGGAAATGAC) и DVVPR (CGTTGTTTTTATATCCGAGG) 31.
  7. После того, как чистый пар был идентифицирован, заднее потомство от этой единственного HaDV2-неинфицированного разведение пары, по крайней мере, пяти поколений и поддерживать это как HaDV2 свободной колонию (NONINF-штамм); HaDV2-инфицированные колонии определяются как INF-штамм.
  8. Для того, чтобы подтвердить статус HaDV2 инфекции в NONINF-штамме (и исключить влияние известных бактерий или вирусов на развитии хозяина), оценить состояние зараженности HaDV2, Wolbachia и Х. armigera нуклеополигедровирус (HaNPV) в восьми случайно выбранных личинках лиц из NONINF-штамма с помощью PCR (со специфическими праймерами: DVVPF / DVVPR для HaDV2, NPVF / NPVR для HaNPV и 81F / 691R для Wolbachia 31, 33).
    Примечание: Известно, что некоторые вирусы могут быть позднонт в инфицированной хозяина, с уровнем невозможно обнаружить даже при использовании методики ПЦР на основе. технологии NGS могут быть использованы для подтверждения того, что отсутствуют вирусные последовательности не присутствуют в образцах геномной ДНК.

2. Получение HaDV2-содержащих жидкие жидкости

Примечание: Мы показали , что попытка очистки вирусных частиц HaDV2 ингибирует их инфекционность и активность 31; Таким образом, следующий протокол выполняется для достижения инфекционного раствора HaDV2 пути фильтрации HaDV2-инфицированных людей.

  1. Сбор взрослых моли индивидуально и сразу же хранить их в жидком азоте.
  2. Полностью собранная измельчить отдельную моль в жидком азоте с использованием стерилизованной ступки и пестика. Передача около 10 мкг мусора на чистую 1,5-мл пробирку. Передача оставшегося мусора в новую пробирку и сразу же их хранить при -80 ° С.
  3. Извлечение ДНК из 10 мкг мусора, FolloКрыло протоколы, предусмотренные изготовителем. После того, как ДНК-Моль был выделен, проверьте HaDV2 с использованием протокола, как описано на стадии 1.6.
  4. В соответствии с результатами, полученными на шаге 2.3, разделить оставшиеся твердые частицы на две группы: HaDV2-положительных и HaDV2-отрицательными, в зависимости от их статуса инфекции. Добавить 1 мл фосфатно-солевого буферного раствора (PBS, 137 мМ NaCl, 2,7 мМ KCl, 8 мМ Na 2 HPO 4 и 1,5 мМ КН 2 РО 4, рН 7,5) для каждого человека , чтобы полностью растворить оставшийся личиночной мусора.
  5. Центрифуга гомогената (со стадии 2.4) при 6500 × г в течение 15 мин при 4 ° С. Фильтр жидкого супернатанта с мембранным фильтром с размером пор 0,22 мкм. Сбор отфильтрованных жидкостей (200 мкл на пробирку) и сразу же их хранить при -80 ° С.
    Примечание: Мембранный фильтр 0,22 мкм будет отфильтровывать большую часть нежелательных твердых частиц, бактерий и грибков. Во-первых предварительное охлаждение центрифуги до 4 ° С. Выполните все протоколы involviнг операции отфильтрованной жидкости на лед, чтобы предотвратить гомогенато от потемнения и коагулянтов.

3. Строительство HaDV2-инфицированной хлопковой совки колонии

  1. Горизонтальная способность передачи HaDV2
    1. Генерация стандартной кривой HaDV2.
      1. Amplify фрагменты, содержащие праймеров (VPF: CTGGTGAGGCGATGGACATG; ВПР: TGACAAGATCCAGCGTAGACATC) и зонд (VP-зонд: GCCACCACTAGAGGACCCACCAGATG), которые используются для количественного определения вируса HaDV2 с De Novo праймеров (PF: GGACAATGCTGGTGAGGC; PR: AATCCTCTTTGTCCGTTATCTATG). Используйте следующую программу: 30 сек при 94 ° С, 30 с при 53 ° С и 60 с при 72 ° С в течение 40 циклов на машине ПЦР 31. Добавить 1 мкл геномной ДНК, содержащей геном HaDV2 (этап 2.3) по отношению к реакции 25-мкл ПЦР в качестве матричной ДНК. Клон усиленных фрагментов в вектор клонирования в соответствии с протоколами производителя.
      2. Подсчитать количество копийПлазмиды с помощью следующего уравнения: копий / мкл = (N A × C) / (N × M × 10 9), где N A число Авогадро (6,02 × 10 23 молекул / моль); С является массовая концентрация плазмид (нг / мкл), которые могут быть измерены с помощью микроспектрофотометрия; п длина рекомбинантной плазмиды , содержащей продукт ПЦР (5195 пар оснований ); и М представляет собой молекулярную массу средней пары оснований двухцепочечной ДНК (660 г / моль).
      3. Подготовьте шесть 10-кратные серийные разведения в микропробирок 1,5 мл, с концентрацией 1,5 × 10 9, 1,5 × 10 8, 1,5 × 10 7, 1,5 × 10 6, 1,5 × 10 5 и 1,5 × 10 4 число копий / мкл.
      4. Выполнение в реальном масштабе времени количественной полимеразной цепной реакции (КПЦР) с использованием специфических праймеров (VPF / ВПР) и зонд (VP-зонд), чтобы генерировать цикл THREshold (КТ) значение плазмид, описанных в шаге 3.1.1.3. Выполните три независимые технические повторы и усреднить их для дальнейших расчетов.
      5. Используя приведенные выше результаты, генерировать стандартную кривую, коррелирующий log2-трансформированных концентрации HaDV2 в соответствующих усредненных значений КТ.
    2. Количественно HaDV2 в отфильтрованных жидких средах.
      1. Пипетируйте испытательный образец 100-мкл отфильтрованной жидкой среды (этап 2.6), содержащего HaDV2 для выделения ДНК.
      2. Использование в режиме реального времени-КПЦР для получения значений CT для жидких текучих сред и вычислить число копий, используя стандартную кривую на шаге 3.1.1.
    3. Определить эффективность инфекции полости рта с HaDV2-инфицированных отфильтрованных жидкостей различной концентрации.
      1. Развести жидкой текучей среды , содержащей HaDV2 до следующих концентраций: 10 8, 10 7, 10 6, 10 номер 5, 10 4, и 0 копий / мкл.
      2. Спред искусственный дии др равномерно на 9 см диаметра чашки Петри до затвердевания. Равномерно распространить HaDV2-содержащие отфильтрованной жидкости (200 мкл) для каждой концентрации на поверхности твердого искусственного рациона. Делайте это в вытяжном шкафу.
      3. Передача 100 свеже-вылупившихся личинок в HaDV2 содержащей искусственный корм в чашке Петри. Осторожно постучать хлопчатобумажную марлю (в том числе свежа-выведенные личинок) для передачи личинок из марли на лист белой бумаги. Взбить бумагу осторожно, так что личинки спина шелка и «воздушный шар» от бумаги. Используйте стерилизованные пинцет, чтобы коснуться шелка и перемещения личинок в чашку Петри.
      4. Через 48 ч, передачи личинок на искусственный рацион до 24-луночных планшетов (одна особи на лунку).
      5. Задние личинки заражают HaDV2 в указанных концентрациях до взрослой стадии.
      6. Сбор взрослых моли, извлечения ДНК, и обнаруживать HaDV2 с помощью ПЦР, как описано на стадии 1.5.
        Примечание: Здесь, получить 100% HaDV2 уровень инфицированности в сотрудничествеtton коробочного червя , используя 10 8 число копий / мкл , и , таким образом , установить HaDV2-инфицированного колонии (INF-штамм).
  2. Вертикальная способность передачи HaDV2
    1. Выберите взрослые мотылек из NONINF и INF-штаммов для создания одиночного пара ♀- / ♂-, ♀ + / ♂-, ♀- / ♂ + и + ♀ / ♂ + (+: положительный для HaDV2 инфекции; -: отрицательные для HaDV2 инфекция).
    2. Перенести потомство от указанных пар к безвирусных 24-луночные планшеты; задние личинки на третью возрастную стадию.
    3. Извлечение ДНК из собранных личинок третьей возрастной стадии, чтобы использовать в качестве шаблона, чтобы определить наличие HaDV2, как описано в пункте 1.5.

4. Ткань Распределение HaDV2

  1. Для того, чтобы предотвратить загрязнение от вирусов и бактерий, стерилизуют щипцы и ножницы в 75% этаноле в три раза, а затем нагревают их в пламени спиртовки.
    Примечание: Щипцы sterilizatioп необходимо, когда происходит загрязнение.
  2. Используя аналитические весы, взвешивать пустые трубы, которые должны быть использованы для хранения тканей.
  3. Поместите личинки и взрослые моли из INF-штамма на льду в течение примерно 5 мин.
  4. Проанализируйте следующие ткани под стереоскопическим у личинок, взрослых самок и взрослых самцов в чистую чашку Петри, содержащую PBS буфер.
    1. Для личинок, гемолимфы и пипеток рассекают, переднюю кишку, кишка кишка, обезжиренное тело, и мальпигиевых каналец (рис 1А). Сразу передачи каждой ткани в трубки в жидком азоте.
      1. Закрепить замороженные личинка на cystosepiment с помощью двух штифтов насекомых (200 мкм в диаметре, 20 мм в длине), вставляя в межсегментные мембраны вблизи головы и последний сегмент брюшка (фиг.1А).
      2. Вырезать proleg в задней части живота личинок, так что личинки лимфа вытекает. Пипетировать личиночную гемолимфу в течение 10 с с использованием micropipette, чтобы предотвратить потемнение и коагулянта, в гемолимфе.
        Примечание: фенилтиомочевины (50 мкг / мл) может быть смешанно при соотношении / объема в 1:20 по объему с гемолимфой, чтобы предотвратить меланизации.
      3. Используя пару ножниц, сделать надрез в кутикулу, начиная от последней межсегментной мембраны к голове. Рассеките все оставшиеся ткани под стереомикроскопом с помощью два щипцов; картина для каждой ткани показана на рисунке 1А.
      4. Смешайте образцы ткани из трех людей, как один повторность.
      5. Для того, чтобы предотвратить загрязнение оставшихся тканей с гемолимфой во время вскрытия, моет рассеченные ткани в PBS буфер три раза. Затем проверьте состояние HaDV2-инфекции в PBS используется для промывки. Если последний промывочный буфер является HaDV2 свободным, ткань должна быть чистой от загрязнения гемолимфы.
    2. Для взрослых самок, рассекает голова (мозг), мышцы, жир тело, кишечник, мальпигиевы и яичник (Фигура 1В) под стереомикроскопом в буфере PBS. Для взрослых мужчин, рассечь голова (мозг), мышцы, жир-тело, кишечник, мальпигиев и семенники (рис 1C) под стереоскопическим в буфере PBS. Сразу передачи каждой ткани в трубки в жидком азоте.
      1. С помощью пинцета и ножниц, удалить крылья взрослых моли и мыть Оставшееся тело три раза, чтобы очистить чашу весов.
      2. Отделить голову, грудную клетку и живот с помощью ножниц.
      3. Удалите эндосколют грудную клетку и собирать мышцы.
      4. Использование щипцов, удалить кутикулу живота и анализировать другие ткани следующих фигурах 1В и 1С.
      5. Смешайте образцы ткани из трех людей, как один повторность. Промыть рассеченные ткани в PBS буфер три раза.
  5. Взвесьте трубы и вышеуказанные ткани, когда они были заморожены и гарантировать, что в мослы разных тканей почти равны.
    Масс-спектр (ткань) = масса (трубки / образец ткани) - масса (только труба)
  6. Извлечение ДНК из этих тканей и выполняет КПЦР, как описано в шаге 3.1.2.
  7. Расчет числа копий на мг каждой ткани с использованием стандартной кривой, полученной на этапе 3.1.1. Используйте титр вируса на единицу массы для коррекции смещения образца, вызванным какой-либо разница в количестве ткани, используемое для выделения ДНК.
  8. Рассчитываю процент HaDV2 в конкретной ткани следующим образом: процент HaDV2 для каждой ткани = HaDV2 числа копий на мг испытуемой ткани / (сумма числа копий на мг всех тканей).

5. Биопробы Тестирование Влияние HaDV2 на развитие принимающей страны

  1. Место по крайней мере, 100 куколок или вновь появившиеся взрослые моли, полученные из NONINF-штамма в хлопок-марлевой покрытые, 5-Л, проволочной сетки клетки. После 2-х дней, вязка взрослые самки начинают откладывать яйца на хлопковой марли. Сбор и поддержаниехлопковая марля, содержащие яйца; яйца вылупляются примерно через три дня.
  2. Прививка личинок новорожденных с HaDV2.
    1. Переносят личинки новорожденному из NONINF-штамма к искусственной диете , содержащей HaDV2 (10 8 числа копий / мкл) , чтобы установить INF-напряжение.
    2. Аналогичным образом, личинки передач новорожденного к искусственной диете, покрытая HaDV2-свободной отфильтрованная жидкость (этап 2.4) для установления контрольных групп (NONINF-деформация). Включите по крайней мере 240 личинок в каждой обработки (фиг.2А).
      Примечание: Личинки, которые используются для построения NONINF- и INF-штаммов получены из одной и той же родительской когорты и люка в то же время, обеспечивая такой же генетический фон. Убедитесь, что штаммы-INF NONINF- и содержатся в одной и той же климатической камере (при температуре 25 ± 1 ° С, с 14 ч света / 10 ч темного и 60% относительной влажности) для синхронной скорости развития; скорость может изменяться в зависимости от температуры и влажности. Ручка Деличпитались личинками мягко.
  3. Через 48 ч, передачи личинок индивидуально к 24-луночные планшеты (один отдельных на лунку) (рис 2В).
    1. Последовательный номер каждый личинка в каждой лунке и записывать этап INSTAR и статус выживания ежедневно.
    2. Около 5 дней, когда искусственный рацион ухудшается, одновременно передавать эти лицо на новый 24-луночный планшет , содержащий свежую искусственную диету (рис 2С).
    3. Взвесить личинка от 7 до 11 дней после люка с помощью аналитических весов с точностью до 0,0001 г. После взвешивания, по отдельности вернуть личинка в 24-луночный планшет.
  4. После линьки к пятой возрастной стадии после четвертого шелушения (около десяти дней после вылупления), передачи личинок в стеклянных пробирках (высота 10 см, диаметр 2 см) (рис 2D); личинки пятой возрастной стадии также могут быть идентифицированы по ширине головной капсулы (примерно 2,6 мм).
    Примечание: Передача лицк стеклянной трубке, в то же время каждый день.
    1. Код каждая личинка с оригинальным ссылочным номером на стеклянной трубке с помощью краски или маркеры. Запишите личиночной состояние ежедневно; в стеклянных трубках, личинки окукливаются будут примерно через пять дней, стадия куколки длится около 11 дней.
    2. Запись куколки и вылупления дату для каждого человека в стеклянной трубке. Записывает массу 3-дневных куколок.
  5. После вылупления, положить одну самку и один мужчина в одну клетку с 10% сахарозы и 2% раствора витамина (рис 2Е). Пополнять раствор сахарозы каждый день. Запишите дату смерти каждого мотылька.
  6. Когда яйца откладываются, изменить хлопчатобумажную марлю ежедневно. Подсчитайте количество яиц сразу. Граф вновь вылупившихся потомство, пока они люк.
  7. В биопроб, случайным образом выбрать восемь человек для каждого лечения, чтобы подтвердить статус Заражение HaDV2. Извлечение общей РНК из этих образцов с использованием коммерческого реагента трипсинав соответствии с протоколом производителя. Синтезировать первую нить кДНКа в соответствии с протоколом производителя и использовать его в качестве шаблона для проверки, являются ли успешно расшифрованы вирусы.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Потомство от родителей , которые были HaDV2 свободной (Фигура 3А) были выращены в качестве NONINF-штамма. Мы успешно амплифицировали ген актина , используя те же шаблоны ДНК, предполагая , что шаблоны ДНК были хорошего качества (рис 3B). Кроме того, случайным образом выбранных восьми также были потомства свободны от HaDV2 (рис 3C), HaNPV (рис 3D), и Wolbachia (рис 3Е). Опять же , мы пришли к выводу , что образцы ДНК потомств были хорошего качества, потому что часть гена актина была успешно амплифицировали для всех испытанных образцов (рис 3F).

Стандартные кривое определение взаимосвязи между логарифмом качества исходного материала и полученных значениями КТ была сгенерирован, как показано на рисунке 4. Сильная линейная корреляция (R (Рисунок 4).

Свеже вылупились личинки были привиты с точки стандартной кривой HaDV2 жидких текучих сред с использованием 10-кратные серийные разведения в диапазоне от 10 4 до 10 8 число копий / мкл. Мы получили линейную зависимость между частотой инфекции и концентрацией жидких сред HaDV2; 10 8 число копий / мкл дали 100% инфекции для хлопка совки, но другие концентрации не (также см Xu и др. 31). Инфекция частоты HaDV2 из потомств от родителей с различными инфекционными состояниями HaDV2 были следующими: 100% для ♀ + / ♂-, 78% для ♀- / ♂ + и 100% для ♀ + ♂ / + (смотрите также Xu и др. 31).

Чтобы сдое правильный для индивидуальных различий в титре HaDV2, мы рассчитали HaDV2 числа копий на мг каждой ткани и процент от общего титра HaDV2 для конкретной ткани. Результаты показали , что HaDV2 в основном распределены в жировом теле (рис 5; также см Сю и др . 31). Сравнение параметров жизни таблицы, в том числе личиночных периодов, периодов куколок, длина взрослого и плодовитостью, были приведены в таблице 1 (смотрите также Xu и др. 31). Личинки и куколки массы были опубликованы в Xu и др. 31. Инфекция статусы HaDV2 в обоих NONINF-штамма и штамма INF-определяли с помощью ПЦР (результаты , опубликованные Xu и др. 31).

Рисунок 1
Рисунок 1. рассеченных тканей для (А) Личинки, (В)Женщина для взрослых, и (C) взрослого мужчины. Н, головы (головной мозг); Он, лимфа; FB, жира; Мт, мальпигиевы канальцы; G, кишка; FG, передняя кишка; MG, кишка; HG, задняя кишка; Mu, мышцы; О, яичников; Т, семенники. Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

фигура 2
Рисунок 2. Процедура биоанализа для определения влияния HaDV2 на хлопковой совке. (А) Прививка свежа выведенных личинок с HaDV2. (B) передача HaDV2-инфицированных и HaDV2-свободных индивидов с 24-луночные планшеты , после 48 ч. (C) Различные размеры HaDV2-инфицированных и -свободных лиц. (D) Передача личинок пятого возраста в новых стеклянных трубок (10 см в высоту, диаметр 2 см). (Е) Размещение одногоженщина и один мужчина моли в ту же клетку, чтобы определить, для взрослого долголетия, производства яиц, и скорость штриховки. Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

Рисунок 3
Рисунок 3. Заражение состояния для HaDV2, HaNPV или Wolbachia в HaDV2-инфицированных и HaDV2 свободных колоний. HaDV2 статус инфекции в женских и мужских родителей (A). Статус Заражения HaDV2 (C), HaNPV (D) и Wolbachia (Е) в случайно выбранных потомствах. Для того, чтобы проверить качество геномной ДНК, ген актин уборки также усиливается для родителей (B) и потомств (F). Полоса M показывает DL2000 маркер (2000 п.о., 1 000 п.н., 750 п.н., 500 п.н., 250 п.н.,д 100 п.н.). Дорожка 1: женский родитель. Дорожка 2: мужской родитель. Дорожка 3 - 10: потомство. Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

Рисунок 4
Рисунок 4. стандартный кривой коррелирующий Вход 2-трансформированные HaDV2 концентраций , чтобы цикл порог (CT) Значение. Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

Рисунок 5
Рисунок 5. Хост-ткани Распределение в HaDV2 Личинки (A), для взрослых женщин (В), а также взрослых мужчин (С) Хлопок коробочного червя. Процент (%) = отношение HaDV2 в различных тканях (в мг), как описано Iп шагом 4.7 Данные были проанализированы статистически с использованием дисперсионного анализа (ANOVA) и тест Тьюки (личинки: п = 7; взрослые самцы: N = 6; взрослые самки: N = 6). Средства ± SE. Результаты были опубликованы Сю и соавт. 31. Пожалуйста , нажмите здесь , чтобы посмотреть увеличенную версию этой фигуры.

параметры жизненного цикла HaDV2 + HaDV2- значение т Д.Ф. значение P
Личинки период (дни) мужчина 16,51 (± 0,72) 16,93 (± 1,21) 4,147 379 <0,001
женский 16,51 (± 0,79) 16,80 (± 1,05) 2,732 312 0,0067
Куколки период (дни) мужчина 13,02 (± 0,68) 13,31 (± 0,69) 4,057 379 <0,001
женский 11,62 (± 0,67) 12.00 (± 0,63) 5,1 312 <0,001
Долговечность взрослых (дней) мужчина 10,69 (± 1,98) 10,93 (± 2,46) 0,915 367 0,36
женский 9,07 (± 1,98) 8,51 (± 1,58) 2,992 367 0,003
Количество яиц производится за самкой 482 (± 174) 403 (± 180) 2,172 93 0,032
Количество штриховки на самку 207 (± 108) 143 (± 99) 3,026 93 0,0032

Таблица 1. Жизненной история Параметры HaDV2 + и HaDV2-хлопок. Коробочный червь т-тест Стьюдента используется для определения уровня значимости. Средства ± SE показаны. Данные , представленные в этой таблице , были опубликованы Xu и др. 31.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

В течение последних нескольких десятилетий, большинство исследований на насекомых-вирусных взаимодействий были сосредоточены на медоносной пчелы здоровья 34, 35, 36, векторы болезни человека 37, растительных вирусов 38, и некоторые насекомые патогенные вирусы , которые имеют большой потенциал в качестве агентов биологического контроля 39. Мало внимания уделяется тайных вирусов насекомых, особенно в чешуекрылых вредителей. Здесь мы приводим протокол для изучения взаимодействия между скрытым вирусом и его хозяином насекомого. Сравнение параметров жизни таблицы для инфицированных вирусом и незараженных принимающих лиц, в идеале должны исключить любое влияние различий в хост-генетического фона. Для изучения вирусного фенотипа, многие предыдущие исследования сравнили параметры жизни таблицы либо естественно инфицированных или неинфицированных лиц, в той же колонии или лиц, привитыхпутем микроинъекции, но это усилие потребляя 23, 40 раз. Устная прививка хлопка коробочного червя с HaDV2, описанным здесь, служит простым и эффективным средством для анализа вирусных фенотипов. Эта процедура также обеспечивает один и тот же генетический фон для HaDV2-инфицированных и неинфицированных HaDV2-колоний.

Вирус инокулят может быть получен разными способами. Очистки вирусных частиц с помощью высокоскоростного центрифугирования ингибирует инфекционность вируса, что приводит к низкой инфекционности; следовательно, вирус , содержащий отфильтрованную жидкость использовали для заражения личинок совки хлопковой 31. Тот факт, что мембраны 0,22 мкм может отфильтровать большинство грибковых и бактериальных частиц из HaDV2-содержащих отфильтрованной жидкости и что HaDV2 свободной отфильтрованную жидкость была использована в качестве контроля может исключить влияние других вирусов на наши результаты. Тем не менее, мы не можем исключить возможность того, что результаты биопроб моглиРБП быть смещен от неоткрытых вирусов. Следовательно, частицы HaDV2 с высокой инфекционностью в идеале должны быть очищены в будущем, чтобы получить надежные результаты.

Концентрация вируса положительно коррелирует с вирусной инфекционности; следовательно, мы были заинтересованы в определении концентрации HaDV2, что будет 100% выход инфекции. Наши результаты показали , что 10 число 8 копии / мкл могут быть использованы для инокуляции вируса , чтобы получить этот уровень инфекции. Несомненно, что корреляция между титром вируса и скоростью инфекции должна быть изучена для других вируса-хозяин взаимодействий, изучаемых в будущем. Кроме того, титр вируса каждого человека в этой области также следует изучить. Таким образом, мы могли бы имитировать эффект вирусов на индивид в этой области.

Мягкое обращение с деликатными личинками в течение первых нескольких дней после того, как они люка очень важно, потому что они легко смертельно повреждены. Кроме того, HaDV2-неинфицированных Colоны должны храниться отдельно в теплице , чтобы предотвратить загрязнение HaDV2-скорость инфекции HaDV2 было обнаружено, что очень высока, как в поле и в лаборатории 31.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторы заявляют, что у них нет конкурирующих финансовых интересов.

Acknowledgments

Эта работа была поддержана Национальным ключ программы фундаментальных исследований Китая (№ 2013CB127602) и научного фонда творческих исследовательских групп Национального научного фонда Китая (№ 31321004).

Materials

Name Company Catalog Number Comments
24-well plate Corning 07-200-740 Multiple suppliers available.
DNA extraction kit TIANGEN DP304-03 Multiple suppliers available.
thermal cycler Veriti; Applied Biosystems 4375786
PBS Corning 21-040-CV
0.22 µm membrane filter Millipore SLGS025NB
pEASY-T Cloning Vector TransGen, Beijing, China CT301-02
Tweezers IDEAL-TEK 2.SA
Premix Ex Taq (Probe qPCR) Takara RR390A
Probes Invitrogen Custom order
Primers Invitrogen Custom order
microspectrophotometry NanoDrop 2000c  Thermo scientific  not available
7500 Real-Time PCR system Applied Biosystems not available
stereomicroscope SZX-16 Olympus not available
sucrose Multiple suppliers available.
vitamin complex Multiple suppliers available.

DOWNLOAD MATERIALS LIST

References

  1. Tang, P., Chiu, C. Metagenomics for the discovery of novel human viruses. Future Microbiol. 5, 177-189 (2010).
  2. Rosario, K., Breitbart, M. Exploring the viral world through metagenomics. Curr. Opin. Virol. 1, 289-297 (2011).
  3. Hugenholtz, P., Tyson, G. W. Microbiology - metagenomics. Nature. 455, 481-483 (2008).
  4. Kristensen, D. M., Mushegian, A. R., Dolja, V. V., Koonin, E. V. New dimensions of the virus world discovered through metagenomics. Trends Microbiol. 18, 11-19 (2010).
  5. Kleiner, M., Hooper, L. V., Duerkop, B. A. Evaluation of methods to purify virus-like particles for metagenomic sequencing of intestinal viromes. BMC Genomics. 16, 7 (2015).
  6. Ho, T., Tzanetakis, I. E. Development of a virus detection and discovery pipeline using next generation sequencing. Virology. 471, 54-60 (2014).
  7. Marx, C. J. Can you sequence ecology? Metagenomics of adaptive diversification. PLoS Biol. 11, e1001487 (2013).
  8. Radford, A. D., et al. Application of next-generation sequencing technologies in virology. J. Gen. Virol. 93, 1853-1868 (2012).
  9. Liu, S. J., Chen, Y. T., Bonning, B. C. RNA virus discovery in insects. Curr. Opin. Insect Sci. 8, 54-61 (2015).
  10. Mokili, J. L., Rohwer, F., Dutilh, B. E. Metagenomics and future perspectives in virus discovery. Curr. Opin. Virol. 2, 63-77 (2012).
  11. Liu, S. J., Vijayendran, D., Bonning, B. C. Next generation sequencing technologies for insect virus discovery. Viruses-Basel. 3, 1849-1869 (2011).
  12. Cook, S., et al. Novel virus discovery and genome reconstruction from field RNA samples reveals highly divergent viruses in Dipteran hosts. PLoS ONE. 8, e80720 (2013).
  13. Webster, C. L., et al. The discovery, distribution, and evolution of viruses associated with Drosophila melanogaster. PLoS Biol. 13, e1002210 (2015).
  14. Granberg, F., et al. Metagenomic detection of viral pathogens in spanish honeybees: co-infection by aphid lethal paralysis, israel acute paralysis and lake sinai viruses. PLoS ONE. 8, e57459 (2013).
  15. Runckel, C., et al. Temporal analysis of the honey bee microbiome reveals four novel viruses and seasonal prevalence of known viruses, Nosema, and Crithidia. PLoS ONE. 6, 20656 (2011).
  16. Cox-Foster, D. L., et al. A metagenomic survey of microbes in honey bee colony collapse disorder. Science. 318, 283-287 (2007).
  17. Chandler, J. A., Liu, R. M., Bennett, S. N. RNA shotgun metagenomic sequencing of northern California (USA) mosquitoes uncovers viruses, bacteria, and fungi. Front. Microbiol. 6, 185 (2015).
  18. Shi, C. Y., et al. A metagenomic survey of viral abundance and diversity in mosquitoes from Hubei province. PLoS ONE. 10, e0129845 (2015).
  19. Nouri, S., Salem, N., Nigg, J. C., Falk, B. W. Diverse array of new viral sequences identified in worldwide populations of the Asian citrus psyllid (Diaphorina citri) using viral metagenomics. J. Virol. 90, 2434-2445 (2016).
  20. Dayaram, A., et al. Identification of diverse circular single-stranded DNA viruses in adult dragonflies and damselflies (Insecta Odonata) of Arizona and Oklahoma, USA. Infect. Genet. Evol. 30, 278-287 (2015).
  21. Jakubowska, A. K., et al. Simultaneous occurrence of covert infections with small RNA viruses in the lepidopteran Spodoptera exigua. J.Invert. Pathol. 121, 56-63 (2014).
  22. Roossinck, M. J. Move over, Bacteria! Viruses make their mark as mutualistic microbial symbionts. J. Virol. 89, 6532-6535 (2015).
  23. Ryabov, E. V., Keane, G., Naish, N., Evered, C., Winstanley, D. Densovirus induces winged morphs in asexual clones of the rosy apple aphid, Dysaphis plantaginea. Proc. Natl. Acad. Sci. USA. 106, 8465-8470 (2009).
  24. Roossinck, M. J. The good viruses: viral mutualistic symbioses. Nat. Rev. Microbiol. 9, 99-108 (2011).
  25. Venkataraman, S., et al. Structure of seneca valley virus-001: an oncolytic picornavirus representing a new genus. Structure. 16, 1555-1561 (2008).
  26. Deterding, K., et al. Hepatitis a virus infection suppresses hepatitis c virus replication and may lead to clearance of hcv. J. Hepatol. 45, 770-778 (2007).
  27. Barton, E. S., et al. Herpesvirus latency confers symbiotic protection from bacterial infection. Nature. 447, 326-329 (2007).
  28. Ponferrada, V. G., Mauck, B. S., Wooley, D. P. The envelope glycoprotein of human endogenous retrovirus herv-w induces cellular resistance to spleen necrosis virus. Arch. Virol. 148, 659-675 (2003).
  29. Márquez, L. M., Redman, R. S., Rodriguez, R. J., Roossinck, M. J. A virus in a fungus in a plant: three-way symbiosis required for thermal tolerance. Science. 315, 513-515 (2007).
  30. Xu, P. J., et al. Complete genome sequence of a monosense densovirus infecting the cotton bollworm, Helicoverpa armigera. J. Virol. 86, 10909-10909 (2012).
  31. Xu, P. J., Liu, Y. Q., Graham, R. I., Wilson, K., Wu, K. M. Densovirus is a mutualistic symbiont of a global crop pest (Helicoverpa armigera) and protects against a baculovirus and Bt biopesticide. PLoS Pathog. 10, e1004490 (2014).
  32. Liang, G. M., Tan, W. J., Guo, Y. Y. An improvement in the technique of artificial rearing cotton bollworm. Plant Protec. 25, 15-17 (1999).
  33. Zhou, W. G., Rousset, F., O'Neill, S. Phylogeny and PCR-based classification of Wolbachia strains using wsp gene sequences. P. Roy. Soc. B-Biol. Sci. 265, 509-515 (1998).
  34. Mondet, F., de Miranda, J. R., Kretzschmar, A., Le Conte, Y., Mercer, A. R. On the front line: quantitative virus dynamics in honeybee (Apis mellifera L.) colonies along a new expansion front of the parasite Varroa destructor. PLoS Pathog. 10, e1004323 (2014).
  35. Chen, Y. P., et al. Israeli acute paralysis virus: epidemiology, pathogenesis and implications for honey bee health. PLoS Pathog. 10, e1004261 (2014).
  36. Hunter, W., et al. Large-scale field application of RNAi technology reducing israeli acute paralysis virus disease in honey bees (Apis mellifera, Hymenoptera: Apidae). PLoS Pathog. 6, e1001160 (2010).
  37. Halstead, S. B. Dengue virus - mosquito interactions. Annu. Rev. Entomol. 53, 273-291 (2008).
  38. Whitfield, A. E., Falk, B. W., Rotenberg, D. Insect vector-mediated transmission of plant viruses. Virology. 479-480, 278-289 (2015).
  39. Moscardi, F. Assessment of the application of baculoviruses for control of Lepidoptera. Annu. Rev. Entomol. 44, 257-289 (1999).
  40. Szelei, J., et al. Susceptibility of North-American and European crickets to Acheta domesticus densovirus (AdDNV) and associated epizootics. J. Invert. Pathol. 106, 394-399 (2011).
Протоколы для исследования распределения Хоста-ткань, Transmission-режим, и эффекта на хост приспособленности Densovirus в хлопковой совке
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Yang, X., Xu, P., Graham, R. I., Yuan, H., Wu, K. Protocols for Investigating the Host-tissue Distribution, Transmission-mode, and Effect on the Host Fitness of a Densovirus in the Cotton Bollworm. J. Vis. Exp. (122), e55534, doi:10.3791/55534 (2017).More

Yang, X., Xu, P., Graham, R. I., Yuan, H., Wu, K. Protocols for Investigating the Host-tissue Distribution, Transmission-mode, and Effect on the Host Fitness of a Densovirus in the Cotton Bollworm. J. Vis. Exp. (122), e55534, doi:10.3791/55534 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter