Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biochemistry

पुनः संयोजक प्रोटीन अभिव्यक्ति, क्रिस्टलीकरण, और बायोफिजिकल स्टडीज ऑफ़ ए doi: 10.3791/55576 Published: May 16, 2017

Summary

बैसिलस एंथ्रेसीज़ घातक इनहेलेशन संबंधी एंथ्रेक्स के बाध्यकारी रोगज़नक है, इसलिए उसके जीनों और प्रोटीनों का अध्ययन कड़ाई से नियंत्रित किया जाता है। एक वैकल्पिक दृष्टिकोण ऑर्थोलॉगस जीनों का अध्ययन करना है हम बी। सीरियस , बीसी 1531 में बी । एन्थ्रेसीस ऑर्थोल के बायोफिजिकल अध्ययनों का वर्णन करते हैं , जिसमें न्यूनतम प्रयोगात्मक उपकरण की आवश्यकता होती है और गंभीर सुरक्षा संबंधी चिंताओं की कमी होती है।

Abstract

सच्चे रोगजनकों से जीन और प्रोटीन का अध्ययन करते समय सुरक्षा प्रतिबंधों और नियमों पर काबू पाने के लिए, उनके homologues का अध्ययन किया जा सकता है। बेसिलस एंथ्रैसिज एक बाध्यकारी रोग है जो घातक इनहेलेशन संबंधी एंथ्रेक्स का कारण होता है। बैसिलस सीरियस को बी के अध्ययन के लिए एक उपयोगी मॉडल माना जाता है क्योंकि उसके करीबी विकासवादी संबंधों के कारण एन्थ्रैसिस। बी ऐन्थ्रासीस की जीन क्लस्टर बीए 1554 - बीए 1558 बी के सीरियस में बीसी 1531 - बीसी 1535 क्लस्टर से बेहद संरक्षित है, साथ ही साथ बीसीटी 1364-बीटी 1, 368 क्लस्टर के साथ बैसिलस थुरिंगिनेसिस में, बैसिलस जीनस में संबंधित जीनों की महत्वपूर्ण भूमिका का संकेत देता है। यह पांडुलिपि, बी। सीरियस , बीसी 1531 में अपने ortholog के पुनः संयोजक प्रोटीन का उपयोग करते हुए बी एन्थ्रेसीस में जीन क्लस्टर से पहले जीन ( बीए 1554 ) के एक प्रोटीन उत्पाद को तैयार करने और चिह्नित करने के तरीकों का वर्णन करता है।

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

रीकॉंबिनेंट प्रोटीन अभिव्यक्ति का व्यापक रूप से प्राकृतिक प्रोटीन स्रोतों जैसे कि सीमित प्रोटीन मात्रा और हानिकारक संदूषण के साथ जुड़ी समस्याओं पर काबू पाने के लिए उपयोग किया जाता है। इसके अलावा, रोगजनक जीन और प्रोटीन के अध्ययन में, एक वैकल्पिक प्रयोगशाला तनाव जिसे अतिरिक्त सुरक्षा सावधानी की आवश्यकता नहीं होती है उसका उपयोग किया जा सकता है। उदाहरण के लिए, बेसिलस सीरिअस उनके करीबी विकासवादी संबंध 1 के कारण बेसिलस एंथ्रेसीस का अध्ययन करने के लिए एक उपयोगी मॉडल है

बी। एन्थ्रैसिज एक बाध्यकारी रोगजनक है जो मनुष्यों और पशुओं में घातक इंहेलेशनल एन्थ्रैक्स का कारण बनता है और संभावित रूप से जीवनी 2 के रूप में इस्तेमाल किया जा सकता है। इस प्रकार, बी। एन्थ्रेसीस पर प्रयोगशाला अध्ययन, कंट्रोल के लिए अमेरिकी नियंत्रण केंद्रों द्वारा कड़ाई से विनियमित होते हैं, जिसमें जैव सुरक्षा स्तर 3 (बीएसएल -3) प्रथाओं की आवश्यकता होती है, जो यह जज करते हैं कि प्रयोगशाला क्षेत्र को नकारात्मक कक्ष दबाव से अलग किया जाए। बी ऐन्थ्रेसीस के विपरीत बी। सीरियस को बीएसएल-1 एजेंट के रूप में वर्गीकृत किया गया है और इस प्रकार कम से कम सुरक्षा संबंधी चिंताओं का है। बी। सीरियस एक अवसरवादी रोगज़नक़ है जो, संक्रमण पर, भोजन के जहर का कारण बनता है जिसे चिकित्सा सहायता के बिना इलाज किया जा सकता है। हालांकि, क्योंकि बी । सीरिजेस बी ए एन्थ्रेसीस के साथ कई महत्वपूर्ण जीन हैं, बी के कार्यों ए। एन्थ्रेसीस प्रोटीन बी के संबंधित होमोलॉजिस्ट का उपयोग करके अध्ययन किया जा सकता है।

बीए 1554 - बीए 1558 जीन क्लस्टर का बी। एन्थ्रेसीस बीसी 1531 - बीसी 1535 क्लस्टर के साथ अत्यधिक संरक्षित है जी के संगठन और अनुक्रम के संदर्भ में, बीसीरिअस के साथ- साथ बीटी 1 364-बीटी 1 , 368 क्लैस्टर ऑफ बैसिलस थुरिंजियन्सिस के साथ । इसके अलावा, संबंधित समूहों की पहली जीन ( बीए 1554 , बीसी 1531 , और बीटी 1 364 ) पूरी तरह से संरक्षित हैं ( यानी, 100% न्यूक्लियोटाइड अनुक्रम पहचान), इप्लीईबैसिलस प्रजातियों में जीन उत्पाद की एक महत्वपूर्ण भूमिका है। इन जीन क्लस्टर्स में अपने स्थान के कारण, बीए 1554 को कैथेटिव ट्रांसक्रिप्शन रेगुलेटर 3 के रूप में गलत पहचान मिली थी। हालांकि, बीए 1554 उत्पाद का अमीनो एसिड अनुक्रम विश्लेषण यह इंगित करता है कि यह माज परिवार के अंतर्गत आता है, जिसमें न्यूक्लियोटाइड पाइरोफॉस्फॉइड डीलीज़ गतिविधि है और ट्रांसक्रिप्शन कारक गतिविधि 4 , 5 के साथ जुड़ा नहीं है। यद्यपि माज़ ग्रा परिवार से सम्बंधित प्रोटीन समग्र अनुक्रम और लंबाई के संबंध में विविधतापूर्ण हैं, हालांकि वे एक सामान्य ~ 100 अवशेषों वाले मेज़ डोमेन को साझा करते हैं, जो कि एक EXXE 12-28 ईएक्सडी आकृति ("एक्स") किसी एमिनो एसिड अवशेष के लिए खड़ा है, और संख्या एक्स अवशेषों की संख्या इंगित करता है)।

MazG डोमेन हमेशा एक विशिष्ट उत्प्रेरक गतिविधि के लिए सीधे खाते नहीं करता है। Escherichia कोली (EcMazG) के एक MazG सदस्य दो MazG डोमेन के पास है, लेकिन परली सी-टर्मिनल MazG डोमेन एंजाइमेटिक रूप से सक्रिय है 6 इसके अलावा, माज एंजाइम्स की सब्सट्रेट की विशिष्टता गैर-विशिष्ट न्यूक्लियोसाइड ट्राइफॉस्फेट्स (एक्कामाज़जी) के लिए विशिष्ट डीसीटीपी / डीएटीपी (इंटीग्रिन से जुड़ी मजदगी के लिए) और डीयूटीपी (डीयूटीपीस के लिए) 6 , 7 , 8 , 9 से भिन्न होती है। इसलिए, बीए 1554 प्रोटीन के बायोफिसायकोकैमिकल विश्लेषण इसकी एनटीपीज़ गतिविधि की पुष्टि करने और इसकी सब्सट्रेट विशिष्टता को समझने के लिए आवश्यक हैं।

यहां, हम एक कदम-दर-चरण प्रोटोकॉल प्रदान करते हैं जो बीएसएल -3 सुविधा के बिना प्रयोगशालाओं को बी। सीरीस बीसी 1531 जीन के प्रोटीन उत्पाद को चिह्नित करने के लिए अनुसरण कर सकते हैं, जो आणविक स्तर पर बी एन्थ्रेसीस बीए 1554 के एक ortholog है। संक्षेप में, पुनः संयोजक बीसी 1531 (आरबीसी 1531) ई। कोलाई में व्यक्त किया गया था और एक संबंध टैग का उपयोग करके शुद्ध किया गया था। एक्स-रे क्रिस्टलोग्राफिक प्रयोगों के लिए, क्रिस्टलीआरबीसी 1531 प्रोटीन की स्थिति की जांच की गई और अनुकूलित किया गया। आरबीसी 1531 की एंजाइमिक गतिविधि का आकलन करने के लिए, एनटीपीस गतिविधि को नियमित रूप से इस्तेमाल किए जाने वाले रेडियोधी लेबल वाले न्यूक्लियोटाइड्स से बचने के लिए रंगीन तरीके से नजर रखी गई थी। अंत में, प्राप्त बायोफ़िस्कीकेमिकल डेटा के विश्लेषण ने हमें आरबीसी 1531 के ऑलिगोमराइज़ेशन स्टेट और उत्प्रेरक पैरामीटर को निर्धारित करने के साथ-साथ आरबीसी 1531 क्रिस्टल से एक्स-रे विवर्तन डेटा प्राप्त करने के लिए सक्षम किया।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. आरबीसी 1531 के पुनः संयोजक प्रोटीन उत्पादन और शुद्धीकरण

  1. पुनः संयोजक बीसी 1531 प्रोटीन (आरबीसी 1531) -एक्सिप्शन प्लाज्मिड की तैयारी
    1. बी। सीरियस 10 के जीनोमिक डीएनए तैयार करें
    2. बीसी 1531 जीन को अनुक्रिया 10 , बाम हाइ और सल I प्रतिबंध एंजाइम साइट्स बनाने के लिए आगे और रिवर्स प्राइमरों (सामग्री सूची देखें) का इस्तेमाल करते हुए, बी। सीरियस जीनोमिक डीएनए के पोलीमरेज़ चेन रिएक्शन (पीसीआर) के एक टेम्पलेट से बढ़ाएं।
    3. 11 वर्णित के अनुसार पीसीआर उत्पाद को डाइजेस्ट करें और एक संशोधित पीईटी 49 बी वेक्टर (पीईटी 49 बीएम) बाम HI और साल I का उपयोग करें।
    4. वर्णित 11 के अनुसार, 10 μL प्रतिक्रिया में टी 4 डीएनए लीगेज का इस्तेमाल करते हुए पचाने वाले पीसीआर उत्पाद और वेक्टर (3: 1 अनुपात) को 1.1.3 से मिलाएं। 30 मिनट के लिए 18 डिग्री सेल्सियस पर सेते हैं
    5. पाइपेेट 3 μL की बायोमेडिकल प्रतिक्रिया में 50 μL केमिका मेंएक ट्यूब में lly सक्षम ई। कोलाई DH5α कोशिकाओं 30 मिनट के लिए बर्फ पर पिपेट करके धीरे-धीरे मिक्स करें और बर्फ पर रखें। 42 डिग्री सेल्सियस पर 45 डिग्री सेल्सियस के लिए गर्मी झटका लुरीया-बर्टानी (एलबी) माध्यम के 1 एमएल जोड़ें और सिकुड़ते हुए (250 आरपीएम, 37 डिग्री सेल्सियस, 45 मिनट) कोशिकाओं को बढ़ाना।
    6. चरण 1.1.6 से परिवर्तित कोशिकाओं के 100 μL ले लो और उन्हें 100 माइक्रोग्राम / एमएल कनामाइसिन (कान) के साथ एलबी-एगर प्लेटों पर फैला दिया। 37 डिग्री सेल्सियस पर ~ 18 घंटे के लिए सेते हैं
    7. एक बाँझ टिप का उपयोग करके कॉलोनियों को उठाएं और 100 एमजी / एमएल कान के साथ 3 एमएल एलबी माध्यम में कोशिकाओं को बढ़ाना; जोर से हिलाएं (250 आरपीएम, 37 डिग्री सेल्सियस, 18 घंटे)
    8. 10 वर्णित के अनुसार, क्षारीय-एसडीएस विधि विधि का उपयोग करके प्लाज्मिड डीएनए तैयार करें।
    9. डीएनए अनुक्रमण 12 का उपयोग करके आरबीसी 1531-अभिव्यक्ति के न्यूक्लियोटाइड अनुक्रम की पुष्टि करें।
  2. आरबीसी 1531 प्रोटीन का ओवर एक्सस्पियन
    1. आरबीसी 1531-एपी के साथ ई। कोलाई बीएल 21 (डी 3) तनाव को फिर से बदलनारेसियन प्लाज्मिड, जैसा कि 1.1.5-1.1.6 के चरणों में वर्णित है, ओवर एक्सपेशन के लिए।
    2. एक कॉलोनी का चयन करें और इसे 50 मिलीग्राम / एमएल कान (एलबी + कान) युक्त 10 मिलीलीटर एलबी माध्यम में बढ़ो; 37 डिग्री सेल्सियस पर 18 घंटे के लिए सख्ती से हिलाएं
    3. एलएल + कान मध्यम के 1 एल में रातोंरात संस्कृति में 10 एमएल डालना और ओडी 600 (600 एनएम पर ऑप्टिकल घनत्व) ~ 0.7 तक पहुंचने तक 37 डिग्री सेल्सियस तक बढ़ो।
    4. बर्फ-ठंडे पानी में ~ 15 मिनट के तापमान को 18 डिग्री सेल्सियस तक शांत करने के लिए संस्कृति को कम करें और पुनः संयोजक प्रोटीन अभिव्यक्ति के लिए 1 एमएम की अंतिम एकाग्रता में संस्कृति को आइसोप्रापील बीटा-डी-1-थियोग्लैक्टोपायरॉनसाइड (आईपीटीजी) जोड़ें। एक अतिरिक्त ~ 16-18 घंटे के लिए 18 डिग्री सेल्सियस पर संस्कृति बढ़ाएं।
  3. आरबीसी 1531 की शुद्धि
    1. सेंटीफ्यूगेशन (5000 xg, 4 डिग्री सेल्सियस, 30 मिनट) के द्वारा कोशिकाओं का फसल करें। सतह पर तैरनेवाला को सावधानी से त्याग दें ताकि कोशिकाओं को परेशान न करें। 50 मिलीलीटर की फॉस्फेट-बफर्ड खारा (पीबीएस) समाधान में 10 एमएम इमिडाजोल युक्त कोशिकाओं को पुनः निलंबित करें।
    2. सेल lysates (समय: 2 मिनट 30 s; चक्र: 5 एस, चक्र बंद: 10 एस, आयाम: 38%) के अति-हीटिंग को रोकने के लिए बर्फ पर sonication द्वारा दो बार Lyse।
    3. सेंट्रिफ्यूगेशन (~ 25,000 xg, 4 डिग्री सेल्सियस, 30 मिनट) से सेल लाइसेैट साफ़ करें
    4. 3 एमएल निकल मोती और 60 एमएल की पीबीएस युक्त 10 एमएम इमिडाज़ोल और गुरुत्वाकर्षण प्रवाह को 2.5 x 10 सेमी कांच क्रोमैटोग्राफी कॉलम में संतुलन वाले निकल मोतियों को व्यवस्थित करने के लिए अतिरिक्त बफर प्रदान करें।
    5. स्पीप 1.3.3 से सतह पर तैरनेवाला को पूर्व-समसाइक्लाइड निकल मोती के साथ स्तंभ में स्थानांतरित करने के लिए पिपेट और कम गति (~ 20 आरपीएम) पर कताई व्हील पर 2 घंटे के लिए 4 डिग्री सेल्सियस पर सेते हैं।
    6. सतह पर तैरने वाले को गुरुत्वाकर्षण द्वारा निकालने की अनुमति दें और तीन बार के भीतर निकल मोती को तीन मिमी में 100 मिलीलीटर पीबीएस युक्त 10 एमएम इमिडाज़ोल युक्त धो लें।
    7. एलबीसी 1531 प्रोटीन को 4 x 5 एमएल की पीबीएस युक्त 250 एमएम इमिडाज़ोल युक्त एल्यूच्यूट प्रोटीन
    8. चरण 1.3.7 से लुभाने के 15 μL ले लो और इसे 15% एसडीएस पृष्ठ पर चलाएं। प्रोटीन बैंड को विज़ुअलाइज़ करेंजूम का कॉमेसाई ब्लू स्केनिंग 10
  4. थ्रोबिन प्रोटीओलिसिस द्वारा आरबीसी 1531 प्रोटीन के आत्मीयता टैग को हटाने
    1. डायलिसिस ट्यूब में भिन्न टुकड़े पिपेट करें (आणविक वजन काट: 3 केडीए) और 4 लीटर थ्रोम्बिन क्लेविज-संगत बफर (20 मिमी एचईपीईएस, पीएच 7.4, 150 एमएम NaCl, और 1.5 एमएम β-मेर्केटोटोथैनॉल युक्त युक्त बीकर में ट्यूब को रखें) 4 डिग्री सेल्सियस पर रात भर
    2. भिन्न भागों को पिपेट करें और उन्हें शंक्वाकार ट्यूब में स्थानांतरित करें।
    3. 280 एनएम पर अवशोषण को मापें और आरबीसी 1531 प्रोटीन एकाग्रता का अनुमान लगाया, जैसा कि 13 वर्णित है
    4. 0.5 एमएल ट्यूब में 50 माइक्रोग्राम आरबीसी 1531 लें और विभिन्न मात्रा में थ्रोम्बिन ( यानी, 2, 1, 0.6, और 0.3 इकाइयां) जोड़ें। आरबीसी 1531 और थ्रोम्बिन प्रतिक्रियाओं को 20 डिग्री सेल्सियस पर ~ 3 घंटे से कम करने के लिए एन-टर्मिनल एफ़िनिटी टैग को तंग करने के लिए आवश्यक कम से कम थ्रोम्बिन का निर्धारण करना।
    5. आरबीसी 1531 को चलाएं और 15%एसडीएस पेज और थ्रोम्बिन की न्यूनतम मात्रा ( जैसे, आरबीसी 1531 के 50 μg प्रति थ्रोम्बिन के 0.3 यूनिट) निर्धारित करते हैं जो पूरी तरह से एन टर्मिनल एफ़िनिटी टैग को पचाने और एक टैग रहित आरबीसी 1531 का उत्पादन करता है।
    6. 15 एमएल ट्यूब में 10 मिलीग्राम आरबीसी 1531 प्रोटीन और थ्रोम्बिन की 60 इकाइयां जोड़ें और थ्रोम्बिन-प्रोटीलाइजिस प्रतिक्रिया के लिए ~ 3 एच के लिए 20 डिग्री सेल्सियस पर सेवन करें।
    7. 13 वर्णित के अनुसार, आकार-बहिष्करण क्रोमैटोग्राफी (एसईसी) स्तंभ में जेल-निस्पंदन मानकों को लागू करें, आणविक भार और अलौकिक संस्करणों की एक मानक वक्र तैयार करने के लिए।
    8. 5 मिमी से कम की मात्रा को कम करने के लिए 4 डिग्री सेल्सियस पर 3,000 ग्राम पर एक केन्द्रापसारक फिल्टर ट्यूब (आणविक वजन काट: 3 केडीए) और अपकेंद्रित्र में चरण 1.4.6 से थ्रोम्बिन-पाचनकृत आरबीसी 1531 प्रोटीन रखें।
    9. एसईसी कॉलम में केंद्रित आरबीसी 1531 प्रोटीन को लागू करें और प्रति ट्यूब 13 में 0.5 एमएल में 60 एल्यूलेशन वाले अंश इकट्ठा करें।
    10. प्रत्येक अंश के 15 μL लें, उन्हें 15% एसडीएस पृष्ठ पर रखें, और स्टेईक्यूमेस्सी स्टीनिंग सोल्यूशन (0.15% (w / v) Coomassie शानदार नीले, 40% (वी / वी) मेथनॉल, और 10% (वी / वी) हिमनदों एसिटिक एसिड) का इस्तेमाल करते हुए जेल 10 जैसा वर्णित है।
    11. आरबीसी 1531 वाले अंश को पिपेट करें और उन्हें एक ट्यूब में जमा करें।

2. आरबीसी 1531 के क्रिस्टलाइजेशन स्क्रीनिंग और ऑप्टिमाइज़ेशन

  1. आरबीसी 1531 प्रोटीन क्रिस्टलीकरण के लिए स्क्रीनिंग की स्थिति
    1. चरण 1.4.8 में वर्णित के अनुसार, केन्द्रापसारक फिल्टर ट्यूब का उपयोग करके चरण 1.4.11 से ~ 18.5 मिलीग्राम / एमएल तक आरबीसी 1531 को ध्यान में रखें।
    2. 96-अच्छी तरह से बैठे ड्रॉप क्रिस्टलीकरण प्लेटों के कुओं के लिए प्रत्येक क्रिस्टलीकरण स्क्रीनिंग समाधान (अनुभाग 2.2 देखें) के 50 μL जोड़ें। बैठे बिस्तर पर 18.5 मिलीग्राम / एमएल आरबीसी 1531 प्रोटीन समाधान के 0.5 μL रखें। पूरी तरह से 0.5 μL के साथ प्रोटीन समाधान मिलाएं, पूरे प्लेट के लिए प्रक्रिया को दोहराएं।
    3. स्पष्ट चिपकने वाली फिल्म के साथ प्लेट को कवर करें18 डिग्री सेल्सियस पर 96-अच्छी तरह प्लेटें रखें और वाष्प प्रसार की अनुमति दें।
    4. 2-3 हफ्तों के लिए दैनिक क्रिस्टल गठन की निगरानी के लिए एक प्रकाश सूक्ष्मदर्शी का उपयोग करके 20-40 x बढ़ाई पर बूंदें स्कैन करें।
    5. प्राप्त आरबीसी 1531 प्रोटीन क्रिस्टल का प्रयोग करके एक्स-रे विवर्तन डेटा 12 लीजिए।
  2. आरबीसी 1531 क्रिस्टलीकरण की स्थिति का अनुकूलन
    1. चयनित प्रारंभिक क्रिस्टलीकरण हालत समाधान ( उदाहरण के लिए, 0.1 एम सोडियम cacodylate, पीएच 6.5 और 1.0 एम सोडियम साइट्रेट) के 500 μL तैयार करें और बैठे ड्रॉप के लिए 24-अच्छी तरह से क्रिस्टलीकरण प्लेट भरें।
    2. बैठे बिस्तर पर 18.5 मिलीग्राम / एमएल आरबीसी 1531 प्रोटीन समाधान के 0.5 μL जोड़ें, अच्छी तरह से समाधान के 0.5 μL के साथ मिश्रण करें, और स्पष्ट चिपकने वाली फिल्म के साथ तुरंत प्लेट को कवर करें। प्लेट को 18 डिग्री सेल्सियस पर रखें
    3. एक सप्ताह के लिए एक प्रकाश सूक्ष्मदर्शी के नीचे क्रिस्टल वृद्धि का निरीक्षण करें।
    4. पीएच ( यानी अलग करके विभिन्न क्रिस्टलीकरण की स्थिति का अनुकूलन करें। 5.5-6.8) पीएच 5.5-6.8) और नमक एकाग्रता ( यानी, 0.9-1.2 एम) को एकमात्र क्रिस्टल प्राप्त करने के लिए सोडियम साइट्रेट के द्वारा बदलकर। ~ 1 सप्ताह के लिए क्रिस्टल वृद्धि को मॉनिटर करें और एक्स-रे विवर्तन डेटा 12 इकट्ठा करें

3. आरबीसी 1531 की न्यूक्लियोसाइड ट्राइफोस्फेटेज (एनटीपीस) की गतिविधि का लक्षण

  1. अकार्बनिक फॉस्फेट पर निर्भर रंगीनेट्रिक अध्ययन की मान्यता
    1. पिओरोफोस्फेट (100 मिमी) के एक स्टॉक को तैयार करें और इसे प्रतिक्रिया बफर के 200 μL में 0.1, 0.25, 0.5, 1.0, 5.0, 10, 50, 100, और 250 माइक्रोन के अंतिम सांद्रता (20 मिमी HEPES, पीएच 7.4; 150 एमएम नाओकल और 2 एमएम एमजीसीएल 2 ) डुप्लिकेट 96-अच्छी तरह प्लेट्स में। पहली प्लेट को एक नियंत्रण के रूप में उपयोग करें (इसमें पाइरोफॉस्फेटस शामिल नहीं है)। सुनिश्चित करें कि दूसरी प्लेट में पिरोप्रोस्फोटेस को काम कर रहे प्लेट के रूप में शामिल किया गया है, जैसा कि चरण 3.1.2 में निर्देशित है।
    2. सैकिकोमाइसेस सीरिविसिया अकार्बनिक पी की 0.01 इकाई जोड़ेंकाम प्लेट की कुओं के लिए यॉफोस्फेटेज (1 μL) और 30 से 60 मिनट के लिए 20 डिग्री सेल्सियस पर सेते हैं।
    3. अमोनियम मोलिब्देट (0.86% वी / वी) और एस्कॉर्बिक एसिड (14% वी / वी) समाधानों को 7: 3 अनुपात में मिलाकर मिश्रित एसिड समाधान तैयार करें। काम और नियंत्रण कुओं के 16 mLybdate एसिड समाधान के 16 μL जोड़ें और 15 मिनट की प्रतीक्षा करें।
    4. 690 एनएम (ओडी 690 एनएम) पर ऑप्टिकल घनत्व पढ़ें
  2. रंगीनमेट्रिक एनटीपीस परख
    1. 100 एमएम न्यूक्लियोसाइड त्रिफॉस्फेट (एनटीपी) सब्सट्रेट के एक स्टॉक को तैयार करें और 180 μL परख बफर (20 मिमी HEPES में वांछित एकाग्रता ( उदा। 0, 0.2, 4.4, 11, 22, 44, 88 या 132 सुक्ष्ममापी) पीएच 7.4; 150 मिमी NaCl; और 2 मिमी एमजीसीएल 2 )।
    2. एक 9 6-अच्छी तरह से प्लेट में प्रति प्रतिक्रिया में 200 μL तक की रोटेशन 3.2.1 से 20 माइक्रोग्राम आरबीसी 1531 (1.5 एमएम) और एनटीपी सबस्ट्रेट्स को जोड़ें और अच्छी तरह से मिश्रण करने के लिए ऊपर और नीचे पिपेट करें। प्लेट को उसके ढक्कन के साथ कवर करें और इसे 30 मिनट के लिए 37 डिग्री सेल्सियस इनक्यूबेटर में रखेंसब्सट्रेट हाइड्रोलिसिस प्रतिक्रिया करने के लिए
    3. थाली को 70 डिग्री सेल्सियस पानी के स्नान में ट्रांसफर कर दें और आरबीसी 1531-मध्यस्थतागत उत्प्रेरक प्रतिक्रियाओं को रोकने के लिए 15 मिनट के लिए खड़े होने की अनुमति दें।
    4. रिसेप्शन प्लेट के प्रत्येक कुएं के एस एसरेविसिया अकार्बनिक पाइरोफॉस्फेटस (1 μL) की 0.01 इकाई जोड़ें (चरण 3.2.3 से) और 30 मिनट के लिए 20 डिग्री सेल्सियस पर सेते हैं। रंग (~ 15 मिनट) को विकसित करने के लिए प्रतिक्रिया प्लेट में 16 μL मोलिडेट एसिड समाधान जोड़ें। ओडी 6 9 0 एनएम पर पढ़ें
    5. माइकलिस-मेंटन समीकरण का उपयोग करके विश्लेषण करें, जैसा कि 12 वर्णित है

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

इस अध्ययन में ब्याज की प्रोटीन की विशेषता ने पुनः संयोजक बी। सीरियस बीसी 1531 (आरबीसी 1531) प्रोटीन की पर्याप्त मात्रा तैयार करके शुरू किया, जो कि अधिमानतः कई मिलीग्राम से अधिक है। बीसी 1531 प्रोटीन एन्कोडिंग डीएनए टुकड़ा बीसी सीरिज के जीनोमिक डीएनए का इस्तेमाल करते हुए पीसीआर द्वारा तैयार किया गया था, क्योंकि इसमें बा 1554 के समान ओर्थोलोगस जीन शामिल हैं। आरबीसी 1531 को ई। कोली कोशिकाओं में एक घुलनशील प्रोटीन के रूप में अत्यधिक संकुचित किया गया था। आरबीसी 1531 प्रोटीन को 6 एक्स-हिस्टिडाइन टैग और एन-टर्मिनस 12 पर थ्रोम्बिन क्लेवेज साइट के साथ व्यक्त किया गया था। शुद्धि के पहले चरण के रूप में, आरबीसी 1531 को निकेल-एनालिटी क्रोमैटोग्राफी ( चित्रा 1 ए ) द्वारा शुद्ध किया गया था। इसके बाद, आरबीसी 1531 ( चित्रा 1 ए ) से आत्मीयता टैग के पूर्ण पाचन के लिए जरूरी थ्रोम्बिन की न्यूनतम राशि निर्धारित करने के लिए एक थ्रोम्बिन पाचन परीक्षण किया गया था। हमारे हाथों में, थ्रोम्बिन के 0.3 यूनिट सूख थेआरबीसी 1531 से एफ़िनिटी टैग पूरी तरह से निकालने के लिए पर्याप्त है इस प्रकार, जब स्केलिंग, 10 एमजी आरबीसी 1531 को टैग निकालने के लिए थ्रोम्बिन के 60 इकाइयों के साथ इलाज किया गया था। थ्रोम्बिन पाचन के बाद, किसी भी घुलनशील समुच्चय और उच्च- या निम्न-आणविक भार संदूषक को हटाने के लिए टैग-मुक्त आरबीसी 1531 को एसईसी स्तंभ पर लागू किया गया था। आरबीसी 1531 के अंश का विश्लेषण एसडीएस पेज द्वारा किया गया, जिसके परिणामस्वरूप सुझाव दिया गया कि आरबीसी 1531 99% शुद्ध ( चित्रा 1 ए ) था। कुल मिलाकर, 1 एल संस्कृति ने ~ 8 मिलीग्राम आरबीसी 1531 प्रोटीन उत्पन्न किया

आरबीसी 1531 की ऑलिगोमरिक स्थिति का अनुमान लगाने के लिए, एसईसी का प्रदर्शन किया गया। एक मानक रैखिक वक्र जो प्रोटीन मानकों ( चित्रा 1 बी ) की चोटियों का उपयोग कर उनके संबंधित क्षालन संस्करणों के साथ नमूनों के आणविक भार के लॉग मूल्य को संबोधित किया गया था। आरबीसी 1531 ~ 84 एमएल की मात्रा में छिद्रित किया गया था, और इसके स्पष्ट आणविक वजन का अनुमान ~ 55 केडीए था। यह देखते हुए कि गणना की आणविक हमआरबीसी 1531 मोनोमर की दृष्टि ~ 13 केडीए है, इन परिणामों से संकेत मिलता है कि आरबीसी 1531 एक टेट्रामर के रूप में इकट्ठा करते हैं।

शुद्ध-वाष्प प्रसार पद्धति में ~ 400 परिस्थितियों का उपयोग करके क्रिस्टलीकरण के लिए शुद्ध आरबीसी 1531 की जांच की गई। आरबीसी 1531 क्रिस्टल दो स्थितियों में 2 दिनों में दिखाई देते हैं: शर्त-ए, 0.1 एम सोडियम साइट्रेट (पीएच 5.5) और 20% पीईजी 3000 ( चित्रा 2 ए ) और हालत-बी, 0.1 एम सोडियम कैकोडालेट (पीएच 6.5) और 1.0 एम सोडियम साइट्रेट ( चित्रा 2 बी ) क्रिस्टलीकरण की स्थिति पीएच (0.1 एम सोडियम साइट्रेट, पीएच 5.0-6.0) और स्थिति- ए से पीईजी 3000 (18-21% पीईजी 3000) की एकाग्रता और पीएच (0.1 एम सोडियम कैकोडालेट, पीएच 5.5-6.8) और नमक एकाग्रता (0.9-1.2 एम सोडियम साइट्रेट) से शर्त बी विवर्तन-योग्य क्रिस्टल केवल शर्त बी के लिए प्राप्त किए गए थे, जबकि स्थिति-ए से क्रिस्टल एकवचन के बजाय अंतर-बढ़े हुए थे। कंडीशन-बी क्रिस्टल2.74 ए ( चित्रा 2 सी ) के संकल्प के लिए एक्स-रे विघटित और आरबीसी 1531 संरचना निर्धारण के लिए उपयोग किया गया था।

BA1554 प्रोटीन अनुक्रम में एक संरक्षित MazG डोमेन के अवलोकन ने एनटीपीज़ गतिविधि की उपस्थिति का सुझाव दिया था जो हाइड्रोलाइजिंग एनटीपीज में सक्षम था। एनटीपी हाइड्रोलिसिस आमतौर पर न्यूक्लियोसाइड डिफोस्फेट (एनडीपी) और अकार्बनिक फॉस्फेट (पीआई), या न्यूक्लॉसाइड मोनोफोस्फेट (एनएमपी) और पाइरोफॉस्फेट (पीपीआई) का उत्पादन करती है। पीआई के लिए अतिरिक्त पाइरोफॉस्फेट की गतिविधि की आवश्यकता होती है जो कि पीआई के लिए होती है पीआई के स्तर को सीधे मोलिडेडेट के द्वारा मापा जा सकता है, जो 6 9 एनएम (ओडी 690 एनएम) ( चित्रा 3 ए ) की तरंग दैर्ध्य पर ऑप्टिकल घनत्व का उपयोग करके मॉनिटर किया जा सकता है, जो पी (मोलिब्डेट-पी) के साथ एक नीले रंग का परिसर बनाता है। हमारे अध्ययन में, आरबीसी 1531 द्वारा एनटीपी हाइड्रोलिसिस के बाद, मोलिब्डेट ( चित्रा 3 बी ) को जोड़ने के बाद कोई भी स्पष्ट नीले रंग का उत्पादन नहीं हुआ। हालांकि, जब आरइबीसी 1531-मध्यस्थता वाले एनटीपी हाइड्रोलिसिस में पाइरोफॉस्फेटस जोड़ा गया थाएनेक्शन, रंग गहरे नीले रंग ( चित्रा 3 बी ) में बदल गया है, यह दर्शाता है कि आरबीसी 1531 में एनटीपी पायरोफोस्फिहाइड्रॉलीज गतिविधि है। आरबीसी 1531 एंजाइम ( चित्रा -3 सी ) के लिए कैनेटीक मापदंडों ( अधिकतम अधिकतम 0.75 और 10 मीटर की मी मी ) निर्धारित करने के लिए ओडी 6 9 0 एनएम और एनटीपी एकाग्रता की एक साजिश का विश्लेषण किया गया था, जिसमें गैर-रैखिक प्रतिगमन विधि का उपयोग किया गया था।

आकृति 1
चित्रा 1: एसडीएस पृष्ठ और आकार बहिष्करण क्रोमैटोग्राफी (एसईसी) विश्लेषण। ( ) आरबीसी 1531 के एसडीएस पेज विश्लेषण (वाम) निकल संबंध क्रोमैटोग्राफी (लेन 2, नी) और एसईसी (लेन 3) से आरबीसी 1531 क्षीण चोटियों का प्रोटीन मानकों (लेन 1; केडीए में लेबल किया गया) के साथ विश्लेषण किया गया था। एफ़िनिटी टैग को हटाने के लिए आरबीसी 1531 के थ्रोम्बिन पाचन का (सही) विश्लेषण। विभिन्न प्रतिक्रियाओं में आरबीसी 1531 के 50 डीग्रेड में थ्रोम्बिन की मात्रा शामिल है Iजेल से ऊपर की इकाइयां ( बी ) आरबीसी 1531 और प्रोटीन मानकों का आकार-बहिष्करण क्रोमैटोग्राफी (एसईसी) विश्लेषण। आरबीसी 1531 (नीला) और मानक (लाल) के एल्यूशन प्रोफाइल (बाएं)। मानक प्रोटीन के आणविक भार प्रत्येक शिखर से ऊपर दिखाए जाते हैं, केडीए में। ऊर्ध्वाधर (वाई) और क्षैतिज (एक्स) अक्ष क्रमशः मिलती-अवशोषण इकाइयों (280 एनएम पर एमएयू) और प्रतिधारण संस्करण (एमएल) दिखाते हैं। (दाएं) आरबीसी 1531 का स्पष्ट आणविक आकार आणविक भार के लिए एक रैखिक भूखंड, लॉग स्केल में, और प्रोटीन मानकों (आर 2 = 0.9 9 34) के अलगाव संस्करणों का उपयोग करने का अनुमान लगाया गया था। इस आंकड़े के एक बड़े संस्करण को देखने के लिए कृपया यहां क्लिक करें

चित्र 2
चित्रा 2: क्रिस्टलीकरण और एक्स-रे विवर्तन। ( ) रेसीबीसी 1531 क्रिस्टल कॉन्सिटि मेंए-ए, 0.1 एम सोडियम साइट्रेट (पीएच 5.5) और 20% पीईजी 3000। ( बी ) आरबीसी 1531 क्रिस्टल में बी -10, 0.1 एम सोडियम कैकोडालेट (पीएच 6.5) और 1.0 एम सोडियम साइट्रेट। प्रारंभिक (बाएं) और अनुकूलित (मध्य और दाएं) क्रिस्टल दिखाए जाते हैं। एक्स-रे विवर्तन के लिए अनुकूलित आरबीसी 1531 क्रिस्टल (सही, ~ 0.35 मिमी x ~ 0.35 मिमी x ~ 0.20 मिमी) का उपयोग किया गया था। स्केल सलाखों = 100 माइक्रोन ( सी ) पीएआर बीमलाइन बीएल -7 ए 12 में प्राप्त आरबीसी 1531 क्रिस्टल की एक्स-रे विवर्तन छवि तीर एक उच्च-रिज़ॉल्यूशन स्पॉट इंगित करता है। इस आंकड़े के एक बड़े संस्करण को देखने के लिए कृपया यहां क्लिक करें

चित्र तीन
चित्रा 3: एनटीपीज़ गतिविधि। ( ) मोलिब्डेनम-पी परिसर का गठन पी की एकाग्रता पर निर्भर है। 690 एनएम पर ऑप्टिकल घनत्व हैपाई स्तरों में वृद्धि के साथ सुस्पष्ट जुड़े Y- अक्ष और एक्स-अक्ष अनुक्रिया पीडी के ओडी 690 एनएम और एकाग्रता (माइक्रोन) का प्रतिनिधित्व करते हैं। ( बी ) पाइरोफॉस्फेटेज के अलावा रंग बदलता है कुओं की पहली पंक्ति में, पाइरोफॉस्फेटस जोड़ा नहीं गया था और नीले रंग के पी-कॉम्प्लेक्स का गठन नहीं किया था। हालांकि, दूसरी पंक्ति में कुओं के होते हैं जिसमें आरबीसी 1531-एनटीपी प्रतिक्रियाओं का इलाज पैरोफॉस्फेटस के साथ किया गया था और नीले रंग का विकास किया था। ओडी 690 एनएम मूल्य एनटीपी सांद्रता में वृद्धि के साथ वृद्धि हुई। ( सी ) आरबीसी 1531-एनटीपी प्रतिक्रियाओं के माइकलिस-मेंटन प्लॉट Y- अक्ष और एक्स-अक्ष क्रमशः एनटीपी सबस्ट्रेट्स के ओडी 690 एनएम और एकाग्रता (0-120 माइक्रोन) का प्रतिनिधित्व करते हैं। त्रुटि बार तीन अलग-अलग प्रयोगों के लिए मानक विचलन का प्रतिनिधित्व करते हैं। इस आंकड़े के एक बड़े संस्करण को देखने के लिए कृपया यहां क्लिक करें

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखकों के पास खुलासे के लिए कुछ भी नहीं है।

Acknowledgments

पोहांग एक्सेलेरेटर प्रयोगशाला (कोरिया) के बीमलाइन 7 ए में एक्स-रे विवर्तन डेटासेट एकत्र किए गए थे। यह अध्ययन, विज्ञान, आईसीटी और भविष्य योजना मंत्रालय (2015 आर 1 ए 1 ए 001057574 एमएएच) द्वारा वित्त पोषित राष्ट्रीय अनुसंधान फाउंडेशन ऑफ कोरिया (एनआरएफ) के माध्यम से प्रशासित बेसिक साइंस रिसर्च कार्यक्रम द्वारा समर्थित था।

Materials

Name Company Catalog Number Comments
Bacillus cereus ATCC14579 Korean Collection for Tissue Culture 3624
Genomic DNA prep kit GeneAll 106-101 Genomic DNA preparation
Forward primer Macrogen GAAGGATCCGGAAGCAAAAA
CGATGAAAGATATGCA
BamHI site is underlined
Reverse primer Macrogen CTTGTCGACTTATTCTTTCTCT
CCCTCATCAATACGTG
SalI site is underlined
nPfu-Forte Enzynomics P410 PCR polymerase
BamHI Enzynomics R003S
SalI Enzynomics R009S
pET49b expression vector Novagen 71463 Expression vector was modified to add affinity tags and BamHI/SalI sites10
T4 DNA ligase Enzynomics M001S
Dialysis memebrane Thermofisher 18265017
Dry block heater JSR JSBL-02T
LB broth (Luria-Bertani) LPS solution LB-05
LB Agar, Miller (Luria-Bertani) Becton, Dickinson and Company
Kanamycin LPS solution KAN025
Mini-prep kit Favorgen FAPDE300 Plasmid DNA preparation
BL21(DE3) Competent cell Novagen 69450-3CN
Isopropyl β-D-1-thiogalactopyranoside (IPTG) Fisher BioReagents 50-213-378
Sodium chloride Daejung 7548-4100 PBS material
Potassium chloride Daejung 6566-4405 PBS material
Potassium phosphate Bio Basic Inc PB0445 PBS material
Sodium phosphate Bio Basic Inc S0404 PBS material
Imidazole Bio Basic Inc IB0277
Sonicator Sonics VCX 130
Ni-NTA agaros Qiagen 30210 Nickel bead
Rotator Finepcr AG
Precision Plus Protein Dual Color Standards Bio-rad 1610374 SDS-PAGE protein standard
Coonmassie Brilliant Blue R-250 Fisher BioReagents BP101-25 Coomassie staining solution
Methyl alcohol Samchun chemical M0585 Coomassie staining solution
Acetic acid Daejung 1002-4105 Coomassie staining solution
Dialysis memebrane Thermofisher 68035
2-Mercaptoethanol Sigma-aldrich M6250
Thrombin Merckmillipore 605157-1KUCN Prepare aliquots of 20 μL (1 Unit per μL) and store at 70 °C and thaw before use
Superdex 200 16/600 General Electric 28989335 Size exclusion chromatography
Gel filtration standard Bio-rad 151-1901
Centrifugal filter Amicon UFC800396
Crystralization plates Hampton research HR3-083 96-well sitting drop plate
The JCSG core suite I-IV Qiagen 130924-130927 Crystallization secreening solution
Microscope Nikon SMZ745T
Cryschem plates Hampton research HR3-158 24-well sitting drop plate
Inorganic pyrophosphatase Sigma 10108987001
Ammonium molybdate solution Sigma 13106-76-8
L-ascorbic acid Sigma 50-81-7
NTP substrate Startagene 200415-51
Spectrophotometer Biotek SynergyH1 microplate reader
GraphPad Prism 5 GraphPad Prism 5 for Window

DOWNLOAD MATERIALS LIST

References

  1. Ivanova, N., et al. Genome sequence of Bacillus cereus and comparative analysis with Bacillus anthracis. Nature. 423, 87-91 (2003).
  2. Spencer, R. C. Bacillus anthracis. J Clin Pathol. 56, 182-187 (2003).
  3. Deli, A., et al. LmbE proteins from Bacillus cereus are de-N-acetylases with broad substrate specificity and are highly similar to proteins in Bacillus anthracis. FEBS J. 277, 2740-2753 (2010).
  4. Gross, M., Marianovsky, I., Glaser, G. MazG -- a regulator of programmed cell death in Escherichia coli. Mol Microbiol. 59, 590-601 (2006).
  5. Galperin, M. Y., Moroz, O. V., Wilson, K. S., Murzin, A. G. House cleaning, a part of good housekeeping. Mol Microbiol. 59, 5-19 (2006).
  6. Lee, S., et al. Crystal structure of Escherichia coli MazG, the regulator of nutritional stress response. J Biol Chem. 283, 15232-15240 (2008).
  7. Moroz, O. V., et al. Dimeric dUTPases, HisE, and MazG belong to a new superfamily of all-alpha NTP pyrophosphohydrolases with potential "house-cleaning" functions. J Mol Biol. 347, 243-255 (2005).
  8. Robinson, A., et al. A putative house-cleaning enzyme encoded within an integron array: 1.8 A crystal structure defines a new MazG subtype. Mol Microbiol. 66, 610-621 (2007).
  9. Moroz, O. V., et al. The crystal structure of a complex of Campylobacter jejuni dUTPase with substrate analogue sheds light on the mechanism and suggests the "basic module" for dimeric d(C/U)TPases. J Mol Biol. 342, 1583-1597 (2004).
  10. Green, M., Sambrook, J. Molecular cloning: A laboratory Manual. 1, John Inglis. (2012).
  11. Brown, T. A. Gene cloning an introduction. Chapman & Hall. (1986).
  12. Kim, M. I., Hong, M. Crystal structure of the Bacillus-conserved MazG protein, a nucleotide pyrophosphohydrolase. Biochem Biophys Res Commun. 472, 237-242 (2016).
  13. Sheehan, D. Physical biochemistry: Principles and applications. A John Wiley & Sons. (2009).
  14. Lesley, S. A., Wilson, I. A. Protein production and crystallization at the joint center for structural genomics. J Struct Funct Genomics. 6, 71-79 (2005).
  15. Jeon, Y. J., et al. Structural and biochemical characterization of bacterial YpgQ protein reveals a metal-dependent nucleotide pyrophosphohydrolase. J Struct Biol. 195, 113-122 (2016).
पुनः संयोजक प्रोटीन अभिव्यक्ति, क्रिस्टलीकरण, और बायोफिजिकल स्टडीज ऑफ़ ए<em&gt; बेसिलस</em&gt; -अधिकृत न्यूक्लियोटाइड पाइरोफॉस्फोरियम, बीसीएमजीजी
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Kim, M. I., Lee, C., Hong, M. Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG. J. Vis. Exp. (123), e55576, doi:10.3791/55576 (2017).More

Kim, M. I., Lee, C., Hong, M. Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG. J. Vis. Exp. (123), e55576, doi:10.3791/55576 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter