Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biochemistry

Birliğin Rekombinant Protein Ekspresyonu, Kristalleştirilmesi ve Biyofiziksel Araştırmaları doi: 10.3791/55576 Published: May 16, 2017

Summary

Bacillus anthracis ölümcül inhalasyon şarbonunun zorunlu patojendir, bu nedenle genleri ve proteinleri üzerine yapılan çalışmalar kesinlikle düzenlenmiştir. Alternatif bir yaklaşım, ortolog genleri incelemektir. B. cereus , bc1531'de B. antrasis ortologunun biyofizikokimyasal çalışmalarını, minimal deney ekipmanı gerektiren ve ciddi güvenlik endişeleri içermeyen çalışmalarını anlattık.

Abstract

Gerçek patojenlerden genleri ve proteinleri incelerken emniyet kısıtlamalarını ve yönetmelikleri aşmak için bunların homologları incelenebilir. Bacillus anthracis ölümcül inhalasyon şarbonuna neden olan zorunlu bir patojendir. Bacillus cereus , yakın evrimsel ilişkisi nedeniyle B. anthracis'i incelemek için faydalı bir model olarak düşünülür. B. anthracis'in ba1554 - ba1558 gen kümesi B. cereus'daki bc1531 - bc1535 kümesi ile Bacillus thuringiensis'deki bt1364 - bt1368 kümesi ile yüksek oranda korunmuştur, bu da Bacillus cinsindeki ilişkili genlerin kritik rolünü göstermektedir. Bu el yazması, B. anthracis'teki gen kümesinden birinci gen ( ba1554 ) 'ün bir protein ürününü B. cereus , bc1531'deki ortologunun rekombinant bir proteinini kullanarak hazırlamak ve karakterize etmek için kullanılan yöntemleri açıklamaktadır.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Rekombinant protein ekspresyonu, sınırlı protein miktarı ve zararlı kontaminasyon gibi doğal protein kaynaklarıyla ilişkili problemlerin üstesinden gelmek için yaygın olarak kullanılmaktadır. Ayrıca, patojenik genler ve protein araştırmalarında ilave güvenlik önlemleri gerektirmeyen alternatif bir laboratuvar suşu kullanılabilir. Örneğin, Bacillus cereus , yakın evrimsel ilişkileri nedeniyle Bacillus anthracis'i incelemek için faydalı bir modeldir 1 .

B. anthracis , insanlarda ve hayvanlarda ölümcül inhalasyon şarbonuna neden olan zorunlu bir patojendir ve potansiyel olarak bir biyolojik silah olarak kullanılabilir 2 . Dolayısıyla, B. anthracis ile ilgili laboratuvar çalışmaları, ABD Hastalık Kontrol Merkezleri tarafından sıkı bir şekilde düzenlenir ve laboratuar alanının negatif oda basıncıyla ayrılması zorunluluğu getiren biyogüvenlik seviyesi 3 (BSL-3) uygulamaları gerektirir. B. anthracis'in aksine B. cereus bir BSL-1 ajan olarak kategorize edilir ve bu nedenle en az güvenlik kaygısı vardır. B. cereus , enfeksiyon sırasında gıda zehirlenmesine neden olan ve tıbbi yardım almadan tedavi edilebilen, fırsatçı bir patojendir. Bununla birlikte, B. cereus B. anthracis ile birçok kritik geni paylaştığı için, B. anthracis proteinlerinin fonksiyonları B. cereus 1'in ilgili homologları kullanılarak incelenebilir.

B. anthracis'in ba1554 - ba1558 gen kümesi, bc1531 - bc1535 kümesi ile oldukça korunmuştur B. cereus'un yanı sıra Bacillus thuringiensis'in bt1364-bt1368 kümesiyle , gen organizasyonu ve sekansı açısından. Dahası, ilgili kümelerin ilk genleri ( ba1554 , bc1531 ve bt1364 ) tamamen korunmuştur ( yani, % 100 nükleotid sekansı özdeşliği)Bacillus türündeki gen ürününün kritik bir rolü. Bu gen kümelerindeki konumu nedeniyle ba1554 , varsayılan bir transkripsiyon regülatörü 3 olarak yanlış tanımlandı. Bununla birlikte, ba1554 ürününün amino asit sekansı analizi, nükleotid pirofosfohidrolaz aktivitesine sahip olan ve transkripsiyon faktörü aktivitesi 4 , 5 ile ilişkili olmayan MazG ailesine ait olduğunu gösterir. MazG ailesine ait proteinler genel dizi ve uzunluk bakımından çeşitlilik göstermesine rağmen, bir EXXE 12-28 EXXD motifiyle ("X" herhangi bir amino asit artığı anlamına gelir) karakterize edilen yaygın bir ~ 100 kalıntı MazG alanını paylaşırlar ve sayı X kalıntılarının sayısını belirtir).

MazG alanı belli bir katalitik etkinliği her zaman doğrudan doğruya açıklamaz. Escherichia coli'den bir MazG üyesi (EcMazG), iki MazG alanına sahiptir, ancakC-terminal MazG alanı enzimatik olarak aktif 6 . Dahası, MazG enzimlerinin substrat özgüllüğü spesifik olmayan nükleozid trifosfatlardan (EcMazG için) belirli dCTP / dATP'ye (integrin ile ilişkili MazG için) ve dUTP'ye (dUTPazlar için) 6 , 7 , 8 , 9 arasında değişir. Bu nedenle, BA1554 proteininin biyofizyokimyasal analizleri, NTPaz etkinliğini teyit etmek ve substrat özgüllüğünü deşifre etmek için gereklidir.

Burada, B. anthracis ba1554'ün bir ortologu olan B. cereus bc1531 geninin protein ürününü moleküler düzeyde karakterize etmek için bir BSL-3 tesisi olmayan çoğu laboratuvarın izleyebileceği adım adım bir protokol sunuyoruz. Kısaca, rekombinant BC1531 (rBC1531), E. coli'de eksprese edildi ve bir afınite etiketi kullanılarak arıtıldı. X-ışını kristalografik deneyleri için, kristalRBC1531 proteininin zation koşulları tarandı ve optimize edildi. RBC1531'in enzimatik aktivitesini değerlendirmek için, geleneksel olarak kullanılan radyoaktif olarak işaretlenmiş nükleotidlerden kaçınmak için NTPaz etkinliği kolorimetrik olarak izlenmiştir. Son olarak, elde edilen biyofizikokimyasal verilerin analizi, rBC1531'in oligomerleşme durumunu ve katalitik parametrelerini belirlememize ve rBC1531 kristalinden X-ışını kırınım verilerini elde etmemize olanak sağladı.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1.RBC1531'in Rekombinant Protein Üretimi ve Saflaştırılması

  1. Bir rekombinant BC1531 proteini (rBC1531) ekspresyon plazmidinin hazırlanması
    1. B. cereus'un genomik DNA'sını hazırlayın 10 .
    2. Sırasıyla Bam HI ve Sal I kısıtlama enzimi siteleri oluşturmak için ileri ve geri primerler (Bkz. Malzeme Listesi) kullanılarak polimeraz zincir reaksiyonu (PCR) ile B. cereus genomik DNA şablonundan bc1531 genini yükseltin 10 .
    3. PCR ürününü ve değiştirilmiş bir pET49b vektörünü (pET49bm) Bam HI ve Sal I kullanarak tanımlayın ( 11) .
    4. Söndürülen PCR ürününü ve vektörünü (adım 3'te tarif edildiği gibi) bir 10 uL reaksiyonda T4 DNA ligaz kullanarak 1.1.3 adımından karıştırın. 18 ° C'de 30 dakika inkübe edin.
    5. 50 μL kimya içine ligasyon reaksiyonu 3 mcL pipetleyinYetkili E. coli DH5α hücrelerini bir tüp içinde tutun. Pipetleme yaparak yavaşça karıştırın ve 30 dakika boyunca buz üzerinde bırakın. 42 ° C'de 45 sn ısı şoku. 1 mL Luria-Bertani (LB) ortamı ekleyin ve kuvvetli çalkantılar yaparken hücreleri büyütünüz (250 rpm, 37 ° C, 45 dak.).
    6. Adım 1.1.6'dan 100 μL dönüştürülmüş hücreleri alın ve bunları 100 μg / mL kanamisin (Kan) ile LB-agar plakalarına yayın. ~ 18 saat boyunca 37 ° C'de inkübe edin.
    7. Steril bir uç kullanarak koloniler seçin ve 100 μg / mL Kan ile 3 mL LB ortamında hücreleri büyütün; Çalkalayın (250 rpm, 37 ° C, 18 saat).
    8. Plazmid DNA'yı, açıklandığı gibi bir alkalin-SDS liziz yöntemi kullanarak hazırlayın.
    9. DNA dizilemesi kullanılarak rBC1531-ekspresyon yapısının nükleotid dizisini doğrulayın 12 .
  2. RBC1531 proteinin aşırı ekspresyonu
    1. E. coli BL21 (DE3) suşunu rBC1531-exp ile yeniden transforme edinAşırı ekspresyon için aşamalar 1.1.5-1.1.6'da tarif edildiği gibi hazırlama plazmiti.
    2. Bir koloni seçin ve 50 μg / mL Kan (LB + Kan) içeren 10 mL LB ortamında büyütün; 37 ° C'de 18 saat şiddetle çalkalayın.
    3. 1 L LB + Kan ortamında gece boyunca 10 mL kültür inoküle edin ve OD 600 (600 nm'de optik yoğunluk) ~ 0.7'ye ulaşıncaya kadar 37 ° C'de büyütün.
    4. Sıcaklığı 18 ° C'ye soğutmak için ~ 15 dakika boyunca buz soğuk suda kültür batırın ve rekombinant protein ekspresyonu için 1 mM nihai konsantrasyonda kültür izopropil β-D-1-tiogalaktopiranosid (IPTG) ekleyin. Kültürü 18 ° C'de ek bir 16-18 saat daha büyütün.
  3. RBC1531'in saflaştırılması
    1. Hücreleri santrifüjle (5,000 xg, 4 ° C, 30 dakika) hasat edin. Hücreleri rahatsız etmeyecek şekilde süpernatanı dikkatle atın. Hücreleri, 10 mM imidazol içeren 50 mL fosfat tamponlu salin (PBS) solüsyonunda yeniden süspanse edin.
    2. Hücre lizatlarının fazla ısınmasını önlemek için (saat: 2 dak. 30 s; devir sayısı: 5 s; devreden çıkma: 10 s; genlik:% 38), buz üzerinde sonikasyon ile hücreleri iki kez lize edin.
    3. Santrifüjleme (~ 25.000 xg, 4 ° C, 30 dakika) ile hücre lisatını boşaltın.
    4. Dengelenmiş nikel boncuklarını 2,5 x 10 cm'lik bir cam kromatografi kolonuna yerleştirmek için, 3 mL nikel boncukları ve 10 mM imidazol ve yerçekimi akışı içeren 60 mL PBS'yi ekstra tamponla karıştırın.
    5. Süpernatantı adım 1.3.3'ten önceden dengelenmiş nikel boncukları olan kolona aktarmak için pipet ve düşük devirde (~ 20 rpm) bir eğirme tekerleğinde 2 saat boyunca 4 ° C'de inkübe edin.
    6. Süpernatanın yerçekimi ile boşaltılmasına izin verin ve kolondaki nikel boncuklarını 10 mM imidazol ihtiva eden 100 mL PBS ile üç kez yıkayın.
    7. 250 mM imidazol içeren 4 x 5 mL PBS uygulayarak rBC1531 proteini elute edin.
    8. Adım 1.3.7'den 15 uL elüsyon alın ve% 15 SDS-PAGE'de çalıştırın. Üzerinde protein bantları görselleştirmekCoomassie mavisi boyama 10 kullanarak jel.
  4. RBC1531 proteinin afinite etiketlerinin trombin proteoliziyle giderilmesi
    1. Fraksiyonları diyaliz tüpüne pipetleyin (molekül ağırlığı kesildi: 3 kDa) ve tüp, 4 L trombin bölünme-uyumlu tampon (20 mM HEPES, pH 7.4, 150 mM NaCl ve 1.5 mM β-merkaptoetanol) içeren bir beher içine yerleştirin. Gece boyunca 4 ° C'de.
    2. Kesirleri pipetleyin ve konik bir boruya aktarın.
    3. 280 nm'de absorbansı ölçün ve tarif edildiği gibi rBC1531 protein konsantrasyonunu hesaplayın 13 .
    4. 0.5 mL'lik bir tüpte 50 μg rBC1531 alın ve çeşitli miktarlarda trombin ekleyin ( yani 2, 1, 0.6 ve 0.3 birim). N-terminal afinite etiketini parçalamak için gereken en düşük trombin miktarını belirlemek için rBC1531 ve trombin reaksiyonlarını 20 ° C'de ~ 3 saat inkübe edin.
    5. RBC1531 ve trombin reaksiyonlarını% 15SDS-PAGE ile yıkayın ve N-terminal afinite etiketini tamamen sindiren ve etiketsiz bir rBC1531 üreten en düşük trombin miktarını ( örn., 50 μg rBC1531 başına 0.3 ünite trombin) belirleyin.
    6. 15 mL'lik bir tüpe 10 mg rBC1531 proteini ve 60 ünite trombin ekleyin ve trombin-proteoliz reaksiyonu için ~ 3 saat boyunca 20 ° C'de inkübe edin.
    7. Açıklanan moleküler ağırlıkların ve elüsyon hacimlerinin standart bir eğrisini hazırlamak için jel filtreleme standartlarını boyut dışlama kromatografısi (SEC) sütununa uygulayın 13 .
    8. Adım 1.4.6'dan trombin ile sindirilmiş rBC1531 proteinini bir santrifüj filtresi tüpüne (molekül ağırlığı kesilmiş: 3 kDa) yerleştirin ve 5 mL'den daha düşük bir hacme indirgemek için 3 ° C'de 4 ° C'de santrifüjleyin.
    9. Konsantre rBC1531 proteinini SEC sütununa uygulayın ve tüp başına 0.5 mL içinde elüsyona uğramış 60 fraksiyon toplamayın 13 .
    10. Her fraksiyonun 15 μL'ini alın, onları% 15'lik bir SDS-PAGE üzerinde çalıştırın ve stai10'da tarif edildiği gibi, Coomassie boyama çözeltisi (% 0.15 (v / v) Coomassie parlak mavi,% 40 (v / v) metanol ve% 10 (v / v) glasiyal asetik asit) kullanılarak jel.
    11. RBC1531 içeren fraksiyonları pipetleyin ve bir tüpe toplayın.

2. rBC1531'in Kristalizasyon Tarama ve Optimizasyonu

  1. RBC1531 protein kristalleşmesi için tarama koşulları
    1. Adım 1.4.8'de tarif edildiği gibi, rBC1531'i, adım 1.4.11'den ~ 18.5 mg / mL'ye kadar bir santrifüj filtresi tüpü kullanarak konsantre hale getirin.
    2. Her kristalleştirme tarama solüsyonundan 50 μL (bkz. Bölüm 2.2) 14 , 96-gözlü oturma-damla kristalizasyon plakalarının oyuklarına ilave edin. Oturan bir yatağa 0.5 uL 18.5 mg / mL rBC1531 protein solüsyonu yerleştirin. Protein solüsyonunu 0.5 mL'lik iyi çözeltiyle karıştırın, plakanın tamamı için işlemi tekrarlayın.
    3. Plakayı açık yapışkan filmle örtün.96 oyuklu plakaları 18 ° C'ye yerleştirin ve buhar difüzyonuna izin verin.
    4. 2-3 hafta boyunca günlük olarak kristal oluşumunu izlemek için hafif bir mikroskop kullanarak damlaları 20-40X büyütmede tarayın.
    5. Elde edilen rBC1531 protein kristallerini kullanarak X-ışını kırınım verilerini 12 toplayın.
  2. RBC1531 kristalleşme koşullarının optimizasyonu
    1. Seçilen başlangıç ​​kristalleştirme koşul solüsyonundan ( örn., 0.1 M sodyum cacodylate, pH 6.5 ve 1.0 M sodyum sitrat) 500 mcL hazırlayın ve oturma damlası için 24 gözlü bir kristalleştirme plakasını doldurun.
    2. Bir oturma yatağına 0.5 μL 18.5 mg / mL rBC1531 protein solüsyonu ilave edin, 0.5 mL'lik iyi çözeltiyle karıştırın ve plakayı açık yapışkan filmle hemen örtün. Plakayı 18 ° C'ye yerleştirin.
    3. Haftalık bir mikroskop altında kristal büyümesine bir hafta boyunca dikkat edin.
    4. PH değerini değiştirerek çeşitli kristalleşme koşullarını optimize edin ( örn., PH 5.5-6.8) ve sodyum sitratın tuz konsantrasyonunu ( yani, 0.9-1.2 M) değiştirerek tekil kristaller elde edildi. ~ 1 hafta boyunca kristal büyümesini izleyin ve X-ışını kırınım verileri toplamak 12 .

3. rBC1531'in Nükleozid Trifosfataz (NTPaz) Aktivitesinin Karakterizasyonu

  1. İnorganik fosfat bağımlı kolorimetrik çalışmanın doğrulanması
    1. Bir pirofosfat (100 mM) stokunu hazırlayın ve reaksiyon tamponunun 200 mcL'sinde (20 mM HEPES, pH 7.4; 150 mM) 0,1, 0.25, 0.5, 1.0, 5.0, 10, 50, 100 ve 250 mcM nihai konsantrasyonlarına kadar sulandırın. MM NaCI ve 2 mM MgCl2) ile yıkandı. İlk plakayı bir kontrol olarak kullanın (bu pirofosfataz içermez). İkinci plakanın, adım 3.1.2'de belirtildiği gibi, bir çalışma plakası olarak pirofosfataz içerdiğinden emin olun.
    2. 0.01 birim Saccharomyces cerevisiae inorganik pYrophosphatase (1 μL) çalışma plakasının çukurlarına bırakın ve 20 ° C'de 30-60 dakika inkübe edin.
    3. Molibden asit çözeltisini, 7: 3 oranında amonyum molibdat (% 0.86 v / v) ve askorbik asit (% 14 v / v) çözeltileri ile karıştırarak hazırlayın. Çalışma ve kontrol kuyularına molibdat asit çözeltisi 16 uL ekleyin ve 15 dakika bekleyin.
    4. Optik yoğunluğu 690 nm'de (OD 690 nm) okuyun .
  2. Kolorimetrik NTPaz tahlili
    1. 100 mM nükleozid trifosfat (NTP) substrat stoğu hazırlayın ve 180 uL tahlil tamponu (20 mM HEPES, 100 mM NEP) içinde beklenen konsantrasyona ( örn., 0, 0.2, 4.4, 11, 22, 44, 88 veya 132 uM) PH 7.4; 150 mM NaCI ve 2 mM MgCl2).
    2. Adım 3.2.1'den 20 μg rBC1531 (1.5 mM) ve NTP substratları, 96 oyuklu bir plakada 200 μL'ye kadar reaksiyona ekleyin ve iyice karıştırmak için pipetleyin. Plakayı kapağı ile kapatın ve 30 dakika boyunca 37 ° C inkübatöre yerleştirin.Substrat hidrolizi reaksiyonu gerçekleştirmek için.
    3. Plakayı 70 ° C su banyosuna aktarın ve rBC1531 aracılı katalitik reaksiyonları durdurmak için 15 dakika bekletin.
    4. Reaksiyon plakasının her bir gözüne (adım 3.2.3'ten) 0,01 ünite S. cerevisiae inorganik pirofosfataz (1 uL) ilave edin ve 20 ° C'de 30 dakika inkübe edin. Rengi (~ 15 dakika) geliştirmek için reaksiyon plakasına molibdat asit çözeltisi 16 uL ekleyin. OD 690nm'de okuyun.
    5. Michaelis-Menten denklemini kullanarak tarif edildiği gibi analiz edin 12 .

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Bu çalışmada ilgilenilen proteinin karakterizasyonu, tercihen birkaç miligramdan daha fazla rekombinant B. cereus bc1531 (rBC1531) proteininin yeterli bir miktarının hazırlanmasıyla başlamıştır. BC1531 proteinini kodlayan DNA parçası, ba1554'e özdeş ortolog genler içerdiği için B. cereus'un genomik DNA'sını şablon olarak kullanarak PCR ile hazırlandı . RBC1531, E. coli hücrelerinde çözünür bir protein olarak aşırı eksprese edildi. RBC1531 proteini, 6x-Histidine etiketi ve N-terminusu 12'de bir trombin bölünme bölgesi ile eksprese edildi. Saflaştırmanın ilk basamağı olarak rBC1531, nikel-afinite kromatografisi ile saflaştırılmıştır ( Şekil 1A ). Daha sonra, rBC1531'den afinite etiketinin tam sindirimi için gerekli en düşük trombin miktarını belirlemek üzere bir trombin sindirim denemesi gerçekleştirildi ( Şekil 1A ). Elimizde 0.3 ünite trombin sufRBC1531'den afinite etiketini tamamen çıkarmak için yeterli. Böylece, ölçeklendirme yapılırken, 10 mg rBC1531, etiket çıkarımı için 60 ünite trombin ile muamele edildi. Trombin sindiriminden sonra, etiketsiz rBC1531, herhangi bir çözünebilir agregayı ve daha yüksek veya daha düşük molekül ağırlıklı kirleticileri çıkarmak için bir SEC sütununa uygulandı. RBC1531 fraksiyonları SDS-PAGE ile analiz edildi ve sonuçlar rBC1531'in% 99 saf olduğunu ( Şekil 1A ) ileri sürdü. Genel olarak, 1 L kültür ~ 8 mg rBC1531 protein vermiştir.

RBC1531'in oligomerik durumunu tahmin etmek için SEC uygulandı. Numunelerin moleküler ağırlığının log değerini karşılık gelen elüsyon hacimleri ile ilişkilendiren standart bir doğrusal eğri, protein standartlarının tepeleri kullanılarak çizildi ( Şekil 1B ). RBC1531 ~ 84 mL'lik bir elüsyon hacminde yıkandı ve görünür molekül ağırlığı ~ 55 kDa olarak hesaplandı. Hesaplanan moleküler değerinRBC1531 monomerinin ~ 13 kDa olduğu bu sonuçlar, rBC1531'in bir tetramer olarak birleştiğini gösterir.

Arıtılmış rBC1531, bir oturma-damla buhar difüzyon yönteminde ~ 400 koşullar kullanılarak kristalleştirme için tarandı. RBC1531 kristalleri 2 gün içinde iki koşulda ortaya çıktı: durum-A, 0.1 M sodyum sitrat (pH 5.5) ve% 20 PEG 3000 ( Şekil 2A ) ve koşul-B, 0.1 M sodyum cacodylate (pH 6.5) ve 1.0 M sodyum Sitrat ( Şekil 2B ). Kristalizasyon koşulları, A durumundan pH'ı (0.1 M sodyum sitrat, pH 5.0-6.0) ve PEG 3000 konsantrasyonunu (% 18-21 PEG 3000) değiştirmek suretiyle ve pH'ı değiştirerek (0.1 M sodyum kakodilat, pH 5.5-6.8) ve tuz konsantrasyonu (0.9-1.2 M sodyum sitrat) B koşulu. Kırılmaya uygun kristaller sadece koşul-B için elde edilirken, A koşulu kristalleri tekil değil birlikte büyümekte idi. Durum-B kristalleri2.74Å'lık bir çözünürlüğe kadar kırınımlı X-ışınları ( Şekil 2C ) ve rBC1531 yapı tayini için kullanıldı.

BA1554 protein dizisindeki korunmuş bir MazG alanının gözlemlenmesi, NTP'leri hidrolize edebilen NTPaz aktivitesinin varlığını önerdi. NTP hidrolizi genellikle nükleozid difosfat (NDP) ve inorganik fosfat (Pi) veya nükleosid monofosfat (NMP) ve pirofosfat (PPi) üretir. PPi, Pi'yi vermek için ek pirofosfataz aktivitesi gerektirir. Pi seviyeleri, 690 nm dalga boyunda (OD 690 nm) optik yoğunluk kullanılarak izlenebilen (Molibdat-Pi) mavi renkli bir kompleks oluşturan molibdat kullanılarak doğrudan ölçülebilir ( Şekil 3A ). Çalışmamızda, rBC1531 ile NTP hidrolizinden sonra, molibdat ilave edildikten sonra görünür mavi renk üretilmemiştir ( Şekil 3B ). Bununla birlikte, rBC1531 aracılı NTP hidrolizine pirofosfataz ilave edildiğindeEaction, rengin derin maviye dönüştüğü ( Şekil 3B ), rBC1531'in NTP pirofosfohidrolaz aktivitesine sahip olduğunu belirtir. OD 690 nm ve NTP konsantrasyonunun bir çizimi, rBC1531 enzimi için kinetik parametrelerin (0.75 Vmax ve 10 uM K m ) belirlenmesi için doğrusal olmayan bir regresyon yöntemi kullanılarak analiz edildi ( Şekil 3C ).

Şekil 1
Şekil 1: SDS-PAGE ve boyut dışlama kromatografisi (SEC) analizi. ( A ) rBC1531'in SDS-PAGE analizi. (Sol) nikel afinite kromatografisinden (şerit 2, Ni) ve SEC'den (şerit 3) rBC1531 elüsyon zirveleri, protein standartlarıyla birlikte (şerit 1, kDa olarak etiketlenmiştir) analiz edildi. (Sağda) afinite etiketinin çıkarılması için rBC1531'in trombin sindiriminin analizi. Farklı reaksiyonlarda 50 μg rBC1531'e eklenen trombin miktarı indJelin üstünde birimler halinde icat edilmiştir. ( B ) rBC1531 ve protein standartlarının ebat dışlama kromatografisi (SEC) analizi. (Sol) rBC1531'in (mavi) ve standartların (kırmızı) elüsyon profilleri. Standart proteinlerin molekül ağırlıkları, her pikin üstünde, kDa cinsinden gösterilir. Dikey (y) ve yatay (x) eksenler sırasıyla mili emme birimlerini (mAU, 280 nm'de) ve tutma hacimlerini (mL) göstermektedir. (Sağda) rBC1531'in görünür molekül boyutu, log skalasında moleküler ağırlıklar ve protein standartlarının elüsyon hacimleri için doğrusal bir arsa kullanılarak hesaplandı (R2 = 0.9934). Bu rakamın daha büyük bir versiyonunu görmek için lütfen tıklayınız.

şekil 2
Şekil 2: Kristalizasyon ve X-ışını kırınımı. ( A ) condito'daki rBC1531 kristalleri0.1 M sodyum sitrat (pH 5.5) ve% 20 PEG 3000 ( B ) koşul-B'de rBC1531 kristalleri, 0.1 M sodyum cacodylate (pH 6.5) ve 1.0 M sodyum sitrat. İlk (sol) ve optimize edilmiş (orta ve sağ) kristaller gösterilir. X-ışını kırınımı için optimize edilmiş rBC1531 kristali (sağ, ~ 0.35 mm x 0.35 mm x 0.20 mm) kullanıldı. Ölçek çubukları = 100 μm. ( C ) PAL beamline BL-7A 12'de elde edilen rBC1531 kristalinin X-ışını kırınım görüntüsü. Ok, yüksek çözünürlüklü bir noktayı belirtir. Bu rakamın daha büyük bir versiyonunu görmek için lütfen tıklayınız.

Şekil 3
Şekil 3: NTPaz aktivitesi. ( A ) Molibden-Pi kompleksinin oluşumu Pi konsantrasyonuna bağlıdır. 690 nm'de optik yoğunluk diPi seviyelerinde artış ile doğrudan ilişkilidir. Y ekseni ve X ekseni sırasıyla Pi'nin OD 690nm ve konsantrasyonunu (μM) temsil eder. ( B ) Pirofosfataz ilavesi üzerine renk değişir. Birinci sıradaki çukurlarda pirofosfataz eklenmedi ve mavi renkli Pi-kompleksi oluşturmadı. Bununla birlikte, ikinci sıra, rBC1531-NTP reaksiyonlarının pirofosfataz ile muamele edildiği ve mavi bir renk geliştirdiği kuyucuklardan oluşur. OD 690nm değerleri, NTP konsantrasyonlarında artışla birlikte arttı. ( C ) rBC1531-NTP reaksiyonlarının Michaelis-Menten arsa. Y ekseni ve X ekseni, sırasıyla, NTP substratlarının OD 690nm ve konsantrasyonunu (0-120 uM) temsil etmektedir. Hata çubukları, üç ayrı deney için standart sapmayı temsil etmektedir. Bu rakamın daha büyük bir versiyonunu görmek için lütfen tıklayınız.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarların açıklayacak bir şeyi yok.

Acknowledgments

X-ışını kırınımı veri setleri, Pohang Hızlandırıcı Laboratuvarının (Kore) kiriş çizgisi 7A'da toplandı. Bu çalışma, Bilim Bakanlığı, BİT ve Gelecek Planlama (2015R1A1A01057574 - MH) tarafından finanse edilen Kore Ulusal Araştırma Vakfı (NRF) aracılığıyla uygulanan Temel Bilim Araştırma Programı tarafından desteklenmiştir.

Materials

Name Company Catalog Number Comments
Bacillus cereus ATCC14579 Korean Collection for Tissue Culture 3624
Genomic DNA prep kit GeneAll 106-101 Genomic DNA preparation
Forward primer Macrogen GAAGGATCCGGAAGCAAAAA
CGATGAAAGATATGCA
BamHI site is underlined
Reverse primer Macrogen CTTGTCGACTTATTCTTTCTCT
CCCTCATCAATACGTG
SalI site is underlined
nPfu-Forte Enzynomics P410 PCR polymerase
BamHI Enzynomics R003S
SalI Enzynomics R009S
pET49b expression vector Novagen 71463 Expression vector was modified to add affinity tags and BamHI/SalI sites10
T4 DNA ligase Enzynomics M001S
Dialysis memebrane Thermofisher 18265017
Dry block heater JSR JSBL-02T
LB broth (Luria-Bertani) LPS solution LB-05
LB Agar, Miller (Luria-Bertani) Becton, Dickinson and Company
Kanamycin LPS solution KAN025
Mini-prep kit Favorgen FAPDE300 Plasmid DNA preparation
BL21(DE3) Competent cell Novagen 69450-3CN
Isopropyl β-D-1-thiogalactopyranoside (IPTG) Fisher BioReagents 50-213-378
Sodium chloride Daejung 7548-4100 PBS material
Potassium chloride Daejung 6566-4405 PBS material
Potassium phosphate Bio Basic Inc PB0445 PBS material
Sodium phosphate Bio Basic Inc S0404 PBS material
Imidazole Bio Basic Inc IB0277
Sonicator Sonics VCX 130
Ni-NTA agaros Qiagen 30210 Nickel bead
Rotator Finepcr AG
Precision Plus Protein Dual Color Standards Bio-rad 1610374 SDS-PAGE protein standard
Coonmassie Brilliant Blue R-250 Fisher BioReagents BP101-25 Coomassie staining solution
Methyl alcohol Samchun chemical M0585 Coomassie staining solution
Acetic acid Daejung 1002-4105 Coomassie staining solution
Dialysis memebrane Thermofisher 68035
2-Mercaptoethanol Sigma-aldrich M6250
Thrombin Merckmillipore 605157-1KUCN Prepare aliquots of 20 μL (1 Unit per μL) and store at 70 °C and thaw before use
Superdex 200 16/600 General Electric 28989335 Size exclusion chromatography
Gel filtration standard Bio-rad 151-1901
Centrifugal filter Amicon UFC800396
Crystralization plates Hampton research HR3-083 96-well sitting drop plate
The JCSG core suite I-IV Qiagen 130924-130927 Crystallization secreening solution
Microscope Nikon SMZ745T
Cryschem plates Hampton research HR3-158 24-well sitting drop plate
Inorganic pyrophosphatase Sigma 10108987001
Ammonium molybdate solution Sigma 13106-76-8
L-ascorbic acid Sigma 50-81-7
NTP substrate Startagene 200415-51
Spectrophotometer Biotek SynergyH1 microplate reader
GraphPad Prism 5 GraphPad Prism 5 for Window

DOWNLOAD MATERIALS LIST

References

  1. Ivanova, N., et al. Genome sequence of Bacillus cereus and comparative analysis with Bacillus anthracis. Nature. 423, 87-91 (2003).
  2. Spencer, R. C. Bacillus anthracis. J Clin Pathol. 56, 182-187 (2003).
  3. Deli, A., et al. LmbE proteins from Bacillus cereus are de-N-acetylases with broad substrate specificity and are highly similar to proteins in Bacillus anthracis. FEBS J. 277, 2740-2753 (2010).
  4. Gross, M., Marianovsky, I., Glaser, G. MazG -- a regulator of programmed cell death in Escherichia coli. Mol Microbiol. 59, 590-601 (2006).
  5. Galperin, M. Y., Moroz, O. V., Wilson, K. S., Murzin, A. G. House cleaning, a part of good housekeeping. Mol Microbiol. 59, 5-19 (2006).
  6. Lee, S., et al. Crystal structure of Escherichia coli MazG, the regulator of nutritional stress response. J Biol Chem. 283, 15232-15240 (2008).
  7. Moroz, O. V., et al. Dimeric dUTPases, HisE, and MazG belong to a new superfamily of all-alpha NTP pyrophosphohydrolases with potential "house-cleaning" functions. J Mol Biol. 347, 243-255 (2005).
  8. Robinson, A., et al. A putative house-cleaning enzyme encoded within an integron array: 1.8 A crystal structure defines a new MazG subtype. Mol Microbiol. 66, 610-621 (2007).
  9. Moroz, O. V., et al. The crystal structure of a complex of Campylobacter jejuni dUTPase with substrate analogue sheds light on the mechanism and suggests the "basic module" for dimeric d(C/U)TPases. J Mol Biol. 342, 1583-1597 (2004).
  10. Green, M., Sambrook, J. Molecular cloning: A laboratory Manual. 1, John Inglis. (2012).
  11. Brown, T. A. Gene cloning an introduction. Chapman & Hall. (1986).
  12. Kim, M. I., Hong, M. Crystal structure of the Bacillus-conserved MazG protein, a nucleotide pyrophosphohydrolase. Biochem Biophys Res Commun. 472, 237-242 (2016).
  13. Sheehan, D. Physical biochemistry: Principles and applications. A John Wiley & Sons. (2009).
  14. Lesley, S. A., Wilson, I. A. Protein production and crystallization at the joint center for structural genomics. J Struct Funct Genomics. 6, 71-79 (2005).
  15. Jeon, Y. J., et al. Structural and biochemical characterization of bacterial YpgQ protein reveals a metal-dependent nucleotide pyrophosphohydrolase. J Struct Biol. 195, 113-122 (2016).
Birliğin Rekombinant Protein Ekspresyonu, Kristalleştirilmesi ve Biyofiziksel Araştırmaları<em&gt; Bacillus</em&gt; - Konserve Nükleotid Pyrophosphorylase, BcMazG
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Kim, M. I., Lee, C., Hong, M. Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG. J. Vis. Exp. (123), e55576, doi:10.3791/55576 (2017).More

Kim, M. I., Lee, C., Hong, M. Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG. J. Vis. Exp. (123), e55576, doi:10.3791/55576 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter