Summary

ביטוי חלבון רקומביננטי, התגבשות, מחקרים ביופיסיקליים של א<em> Bacillus</em> -שמר Nucleotide Pyrophosphorylase, BcMazG

Published: May 16, 2017
doi:

Summary

Bacillus anthracis הוא הפתוגן המחייב של אנתרקס משאיפת קטלני, ולכן מחקרים על הגנים והחלבונים שלהם מוסדרים בקפידה. גישה חלופית היא ללמוד גנים אורתולוגיים. אנו מתארים מחקרים biophysicochemical של B. אנתרקיס אורת'ולוג ב B. cereus , bc1531, הדורש ציוד ניסיוני מינימלי וחסרים בעיות בטיחות חמורות.

Abstract

כדי להתגבר על הגבלות בטיחות ותקנות בעת לימוד גנים וחלבונים מפני פתוגנים אמיתיים, הומולוגים שלהם ניתן ללמוד. Bacillus anthracis הוא פתוגן מחייב שגורם לאנתרקס שאיפה קטלני. Bacillus cereus נחשב מודל שימושי ללימוד ב 'אנתרקיס בשל הקשר האבולוציוני הקרוב שלה. אשכול הגנים ba1554ba1558 של B. anthracis נשמר מאוד עם אשכול bc1531bc1535 ב- B. cereus , וכן עם bt1364-bt1368 באשכול ב- Bacillus thuringiensis, המציין את התפקיד הקריטי של הגנים המשויכים לסוג Bacillus . כתב היד מתאר שיטות להכנת ואפיון של מוצר חלבון של הגן הראשון ( ba1554 ) מקבוצת גנים ב B. anthracis באמצעות חלבון רקומביננטי של אורתולוג ב B. cereus , bc1531.

Introduction

ביטוי חלבון רקומביננטי נעשה שימוש נרחב כדי להתגבר על בעיות הקשורות מקורות חלבון טבעי, כגון כמויות חלבון מוגבל זיהום מזיק. יתר על כן, במחקרים על גנים וחלבונים פתוגניים, ניתן לנצל זן מעבדה חלופי שאינו דורש אמצעי בטיחות נוספים. לדוגמה, Bacillus cereus הוא מודל שימושי לחקר Bacillus anthracis בשל הקשר האבולוציוני הקרוב שלהם 1 .

B. anthracis הוא פתוגן מחייב שגורם לאנתרקס משאיפה קטלנית בבני אדם ובעלי חיים, והוא עשוי לשמש כ bioweapon 2 . לפיכך, מחקרים מעבדה על B. anthracis מוסדרים בקפדנות על ידי המרכזים האמריקאים לבקרת מחלות, המחייבים פרקטיקות של רמה 3 (BSL-3) של בטיחות ביולוגית, אשר קובעות כי אזור המעבדה יופרד עם לחץ שלילי בחדר. בניגוד ל- B. anthracis </eM>, B. cereus מסווג כסוכן BSL-1 ולכן יש חששות בטיחות מינימליים. B. cereus הוא פתוגן אופורטוניסטי אשר, עם זיהום, גורם הרעלת מזון שניתן לטפל ללא סיוע רפואי. עם זאת, מכיוון שב 'cereus חולק גנים קריטיים רבים עם B. anthracis , ניתן לבדוק את הפונקציות של חלבונים אנתראקיס באמצעות ההומולוגים המתאימים של B. cereus 1 .

Ba1554ba1558 אשכול גנים של B. anthracis הוא שמר מאוד עם bc1531bc1535 אשכול של B. cereus , וכן עם bt1364-bt1368 אשכול של Bacillus thuringiensis , במונחים של ארגון גנים ורצף. יתר על כן, הגנים הראשונים ( ba1554 , bc1531 , bt1364 ) של אשכולות בהתאמה משומרים לחלוטין ( כלומר, 100% רצף נוקלאוטיד זהות), implyiNg תפקיד קריטי של המוצר הגן במינים Bacillus . בשל מיקומה של אשכולות גנים אלה, ba1554 זוהה בטעות כווסת שעתוק משוער 3 . עם זאת, רצף חומצות אמינו ניתוח של המוצר ba1554 מציין כי היא שייכת למשפחת MazG, אשר יש פעילות pyrophosphohydrolase נוקלאוטיד אינו קשור עם גורם שעתוק פעילות 4 , 5 . למרות חלבונים השייכים למשפחת MazG הם מגוונים ביחס לרצף הכולל אורך, הם חולקים משותף ~ 100-שאריות MazG תחום מאופיין EXXE 12-28 EXXD מוטיב ("X" מייצג שאריות חומצות אמינו, ומספר מציין את מספר שאריות X).

תחום ה- MazG לא תמיד מייצג באופן ישיר פעילות קטליטית מסוימת. חבר MazG מ Escherichia coli (EcMazG) בעל שני תחומים MazG, אבל בLy מסוף C- תחום MazG הוא פעיל enzymatically 6 . יתר על כן, הספציפי המצע של אנזימים MazG משתנה מ nonphoside nucleoside שאינם ספציפיים (עבור EcMazG) ספציפיים dCTP / dATP (עבור integrin הקשורים מזג) ו DUTP (עבור dUTPases) 6 , 7 , 8 , 9 . לכן, מנתח biophysicochemical של החלב BA1554 יש צורך לאשר פעילות NTPase שלה לפענח את הספציפיות המצע שלה.

כאן, אנו מספקים פרוטוקול צעד אחר צעד כי מעבדות ביותר ללא מתקן BSL-3 יכול לעקוב כדי לאפיין את המוצר חלבון של הגן bc1531 B. cereus , שהוא אורתולוג של B. anthracis ba1554 , ברמה המולקולרית. בקצרה, רקומביננטי BC1531 (rBC1531) התבטא ב coli ו מטוהרים באמצעות תג זיקה. עבור ניסויים קריסטלוגרפיים רנטגן, קריסטליZation התנאים של חלבון rBC1531 הוקרנו אופטימיזציה. כדי להעריך את הפעילות האנזימטית של rBC1531, פעילות NTPase היה פיקוח colorimetrically כדי למנוע רדיואקטיבי שכותרתו נוקליאוטידים כי כבר בשימוש מקובל. לבסוף, ניתוחים של הנתונים biophysicochemical שהושגו אפשרה לנו לקבוע את המדינה oligomerization ופרמטרים קטליטי של rBC1531, כמו גם להשיג נתונים עקיפה רנטגן מן גביש rBC1531.

Protocol

1. Recombinant חלבון ייצור וטיהור של rBC1531 הכנת חלבון BC1531 רקומביננטי (rBC1531) – ביטוי פלסמיד הכינו DNA גנומי של B. cereus 10 . להגביר…

Representative Results

אפיון של חלבון העניין במחקר זה החל על ידי הכנת כמות מספקת של רקומביננטי B. B. creus bc1531 (rBC1531) חלבון, רצוי יותר ממספר מיליגרם. קטע ה- DNA המקודד את החלבון BC1531 הוכן על ידי PCR באמצעות הדנ"א הגנומי של B. cereus כתבנית, שכן הוא מכיל גנים אורתולוגים זהים ba…

Discussion

Studies of true pathogens are limited due to safety restrictions and regulations. Alternatively, pathogens can be studied using evolutionarily related non-pathogens or less pathogenic species. The ba1554 gene is considered a critical gene in B. anthracis. Fortunately, an identical gene is present in nonclinical B. cereus. Thus, without serious safety concerns, recombinant BC1531 protein can be used for biophysical and enzymatic characterization. Here, we described detailed procedures, moving fr…

Disclosures

The authors have nothing to disclose.

Acknowledgements

מערכי האפקט של קרני הרנטגן נאספו ב- beamline 7A של מעבדת ה- Pohang Accelerator (קוריאה). מחקר זה נתמך על ידי תוכנית המחקר הבסיסי למדע, אשר ניתנה באמצעות הקרן הלאומית למחקר של קוריאה (NRF), הממומנת על ידי משרד המדע, ICT & תכנון עתידי (2015R1A1A01057574 ל- MH).

Materials

Bacillus cereus ATCC14579 Korean Collection for Tissue Culture 3624
Genomic DNA prep kit GeneAll 106-101 Genomic DNA preparation
Forward primer Macrogen GAAGGATCCGGAAGCAAAAA
CGATGAAAGATATGCA
BamHI site is underlined
Reverse primer Macrogen CTTGTCGACTTATTCTTTCTCT
CCCTCATCAATACGTG
SalI site is underlined
nPfu-Forte Enzynomics P410 PCR polymerase
BamHI Enzynomics R003S
SalI Enzynomics R009S
pET49b expression vector Novagen 71463 Expression vector was modified to add affinity tags and BamHI/SalI sites10
T4 DNA ligase Enzynomics M001S
Dialysis memebrane Thermofisher 18265017
Dry block heater JSR JSBL-02T
LB broth (Luria-Bertani) LPS solution LB-05
LB Agar, Miller (Luria-Bertani) Becton, Dickinson and Company
Kanamycin LPS solution KAN025
Mini-prep kit Favorgen FAPDE300 Plasmid DNA preparation
BL21(DE3) Competent cell Novagen 69450-3CN
Isopropyl β-D-1-thiogalactopyranoside (IPTG) Fisher BioReagents 50-213-378
Sodium chloride Daejung 7548-4100 PBS material
Potassium chloride Daejung 6566-4405 PBS material
Potassium phosphate Bio Basic Inc PB0445 PBS material
Sodium phosphate Bio Basic Inc S0404 PBS material
Imidazole Bio Basic Inc IB0277
Sonicator Sonics VCX 130
Ni-NTA agaros Qiagen 30210 Nickel bead
Rotator Finepcr AG
Precision Plus Protein Dual Color Standards Bio-rad 1610374 SDS-PAGE protein standard
Coonmassie Brilliant Blue R-250 Fisher BioReagents BP101-25 Coomassie staining solution
Methyl alcohol Samchun chemical M0585 Coomassie staining solution
Acetic acid Daejung 1002-4105 Coomassie staining solution
Dialysis memebrane Thermofisher 68035
2-Mercaptoethanol Sigma-aldrich M6250
Thrombin Merckmillipore 605157-1KUCN Prepare aliquots of 20 μl (1 Unit per μl) and store at 70 °C and thaw before use
Superdex 200 16/600 General Electric 28989335 Size exclusion chromatography
Gel filtration standard Bio-rad 151-1901
Centrifugal filter Amicon UFC800396
Crystralization plates Hampton research HR3-083 96-well sitting drop plate
The JCSG core suite I-IV Qiagen 130924-130927 Crystallization secreening solution
Microscope Nikon SMZ745T
Cryschem plates Hampton research HR3-158 24-well sitting drop plate
Inorganic pyrophosphatase Sigma 10108987001
Ammonium molybdate solution Sigma 13106-76-8
L-ascorbic acid Sigma 50-81-7
NTP substrate Startagene 200415-51
Spectrophotometer Biotek SynergyH1 microplate reader
GraphPad Prism 5 GraphPad Prism 5 for Window

References

  1. Ivanova, N., et al. Genome sequence of Bacillus cereus and comparative analysis with Bacillus anthracis. Nature. 423, 87-91 (2003).
  2. Spencer, R. C. Bacillus anthracis. J Clin Pathol. 56, 182-187 (2003).
  3. Deli, A., et al. LmbE proteins from Bacillus cereus are de-N-acetylases with broad substrate specificity and are highly similar to proteins in Bacillus anthracis. FEBS J. 277, 2740-2753 (2010).
  4. Gross, M., Marianovsky, I., Glaser, G. MazG — a regulator of programmed cell death in Escherichia coli. Mol Microbiol. 59, 590-601 (2006).
  5. Galperin, M. Y., Moroz, O. V., Wilson, K. S., Murzin, A. G. House cleaning, a part of good housekeeping. Mol Microbiol. 59, 5-19 (2006).
  6. Lee, S., et al. Crystal structure of Escherichia coli MazG, the regulator of nutritional stress response. J Biol Chem. 283, 15232-15240 (2008).
  7. Moroz, O. V., et al. Dimeric dUTPases, HisE, and MazG belong to a new superfamily of all-alpha NTP pyrophosphohydrolases with potential "house-cleaning" functions. J Mol Biol. 347, 243-255 (2005).
  8. Robinson, A., et al. A putative house-cleaning enzyme encoded within an integron array: 1.8 A crystal structure defines a new MazG subtype. Mol Microbiol. 66, 610-621 (2007).
  9. Moroz, O. V., et al. The crystal structure of a complex of Campylobacter jejuni dUTPase with substrate analogue sheds light on the mechanism and suggests the "basic module" for dimeric d(C/U)TPases. J Mol Biol. 342, 1583-1597 (2004).
  10. Green, M., Sambrook, J. . Molecular cloning: A laboratory Manual. 1, (2012).
  11. Brown, T. A. . Gene cloning an introduction. , (1986).
  12. Kim, M. I., Hong, M. Crystal structure of the Bacillus-conserved MazG protein, a nucleotide pyrophosphohydrolase. Biochem Biophys Res Commun. 472, 237-242 (2016).
  13. Sheehan, D. . Physical biochemistry: Principles and applications. , (2009).
  14. Lesley, S. A., Wilson, I. A. Protein production and crystallization at the joint center for structural genomics. J Struct Funct Genomics. 6, 71-79 (2005).
  15. Jeon, Y. J., et al. Structural and biochemical characterization of bacterial YpgQ protein reveals a metal-dependent nucleotide pyrophosphohydrolase. J Struct Biol. 195, 113-122 (2016).

Play Video

Cite This Article
Kim, M. I., Lee, C., Hong, M. Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG. J. Vis. Exp. (123), e55576, doi:10.3791/55576 (2017).

View Video