Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biochemistry

Rekombinant Proteinuttryck, Kristallisation och Biofysiska Studier av a doi: 10.3791/55576 Published: May 16, 2017

Summary

Bacillusantracis är den obligatoriska patogenen för dödlig inhalationsantrax, så studier av dess gener och proteiner är strikt reglerade. Ett alternativt tillvägagångssätt är att studera ortopologiska gener. Vi beskriver biofysikkemiska studier av en B. antracis ortholog i B. cereus , bc1531, som kräver minimal experimentell utrustning och saknar allvarliga säkerhetsproblem.

Abstract

För att övervinna säkerhetsrestriktioner och föreskrifter när man studerar gener och proteiner från sanna patogener kan deras homologer studeras. Bacillus antracis är en obligatorisk patogen som orsakar dödlig inandningsbrandbrand. Bacillus cereus anses vara en användbar modell för att studera B. antracis på grund av dess nära utvecklingsrelation. Genklumpen ba1554 - ba1558 av B. antracis är starkt konserverad med bc1531 - bc1535- klustret i B. cereus , liksom med bt1364-bt1368- klustret i Bacillus thuringiensis, vilket indikerar den kritiska rollen hos de associerade generna i Bacillus- släktet. Detta manuskript beskriver metoder för att bereda och karakterisera en proteinprodukt från den första genen ( ba1554 ) från genklustret i B. antracis med användning av ett rekombinant protein av dess ortholog i B. cereus , bc1531.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Rekombinant proteinuttryck används i stor utsträckning för att övervinna problem som hör samman med naturliga proteinkällor, såsom begränsade proteinkvantiteter och skadlig kontaminering. Vidare kan i en studie av patogena gener och proteiner användas en alternativ laboratoriestam som inte kräver ytterligare säkerhetsåtgärder. Till exempel är Bacillus cereus en användbar modell för att studera Bacillus antracis på grund av deras nära evolutionära förhållande 1 .

B. antracis är en obligatorisk patogen som orsakar dödlig inhalationsantrax hos människor och boskap och kan potentiellt användas som en bioweapon 2 . Laboratoriestudier på B. antracis regleras därför strängt av de amerikanska centrumen för sjukdomskontroll, som kräver biosäkerhetsnivå 3 (BSL-3) praxis, vilket innebär att laboratorieområdet ska segregeras med negativt rums tryck. I motsats till B. antracis B. cereus är kategoriserad som ett BSL-1-medel och har sålunda minimala säkerhetsproblem. B. cereus är en opportunistisk patogen som vid infektion orsakar matförgiftning som kan behandlas utan medicinsk hjälp. Eftersom B. cereus delar många kritiska gener med B. antracis kan funktionerna för B. antracisproteiner studeras med motsvarande homologer av B. cereus 1 .

Ba1554 - ba1558 - genklustret av B. antracis är starkt bevarat med bc1531 - bc1535-klyftan Av B. cereus , liksom med bt1364-bt1368- klustret av Bacillus thuringiensis , vad gäller genorganisation och sekvens. Vidare är de första generna ( ba1554 , bc1531 och bt1364 ) av respektive kluster absolut bevarade ( dvs 100% nukleotidsekvensidentitet), implNg en kritisk roll för genprodukten i Bacillus- arten. På grund av sin plats i dessa genkluster var ba1554 felidentifierad som en antydande transkriptionsregulator 3 . En aminosyrasekvensanalys av ba1554-produkten indikerar dock att den tillhör MazG-familjen, som har nukleotidpyrofoshydrolasaktivitet och inte är associerad med transkriptionsfaktoraktivitet 4 , 5 . Även om proteiner som tillhör MazG-familjen är olika med avseende på övergripande sekvens och längd, delar de en gemensam MazG-domän med 100 rester, kännetecknad av ett EXXE 12-28 EXXD-motiv ("X" står för vilken aminosyrarest som helst och numret Anger antalet X-rester).

MazG-domänen ansvarar inte alltid för en viss katalytisk aktivitet. En MazG-medlem från Escherichia coli (EcMazG) har två MazG-domäner, men påLi den C-terminala MazG-domänen är enzymatisk aktiv 6 . Dessutom varierar substratspecificiteten hos MazG-enzymer från icke-specifika nukleosidtrifosfater (för EcMazG) till specifika dCTP / dATP (för integrin-associerad MazG) och dUTP (för dUTPaser) 6 , 7 , 8 , 9 . Därför är biofysikologiska analyser av BA1554-proteinet nödvändiga för att bekräfta dess NTPasaktivitet och att dechiffrera dess substratspecificitet.

Här tillhandahåller vi ett steg för steg protokoll som de flesta laboratorier utan en BSL-3-anläggning kan följa för att karakterisera proteinprodukten från B. cereus bc1531- genen, som är en ortholog av B. antracis ba1554 , på molekylär nivå. I korthet uttrycktes rekombinant BC1531 (rBC1531) i E. coli och renades med användning av en affinitetsmärkning. För röntgenkristallografiska experiment, kristalliZationbetingelserna för rBC1531-proteinet screenades och optimerades. För att bedöma den enzymatiska aktiviteten hos rBC1531 övervakades NTPasaktiviteten kolorimetriskt för att undvika radioaktivt märkta nukleotider som konventionellt har använts. Slutligen möjliggjorde analyser av de erhållna biofysikemiska data oss att bestämma oligomeriseringstillståndet och katalytiska parametrarna för rBC1531, såväl som att erhålla röntgendiffraktionsdata från rBC1531-kristallen.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Rekombinant proteinproduktion och rening av rBC1531

  1. Framställning av en rekombinant BC1531-protein (rBC1531) -expressionsplasmid
    1. Framställ genomiskt DNA av B. cereus 10 .
    2. Förstärka bc1531- genen från en mall av B. cereus genomiskt DNA genom polymeras-kedjereaktion (PCR), med användning av framåt och bakåt-primers (se Materiallistan) för att skapa BamHI- och Sall- restriktionsenzymställen 10 respektive 10 .
    3. Digestera PCR-produkten och en modifierad pET49b-vektor (pET49bm) med användning av BamHI och Sal I, såsom beskrivet 11 .
    4. Blanda den digererade PCR-produkten och vektorn (3: 1-förhållandet) från steg 1.1.3 med användning av T4-DNA-ligas i en 10 | il reaktion, såsom beskrivet 11 . Inkubera vid 18 ° C under 30 minuter.
    5. Pipettera 3 μl av ligeringsreaktionen i 50 μl kemikaLly kompetenta E. coli DH5a celler i ett rör. Blanda försiktigt genom pipettering upp och ner och lägg på is under 30 minuter. Värmechock under 45 s vid 42 ° C. Tillsätt 1 ml Luria-Bertani (LB) -medium och odla cellerna under kraftig skakning (250 rpm, 37 ° C, 45 min).
    6. Ta 100 μl av de transformerade cellerna från steg 1.1.6 och sprida dem på LB-agarplattorna med 100 μg / ml kanamycin (Kan). Inkubera i ~ 18 h vid 37 ° C.
    7. Välj kolonier med hjälp av en steril spets och odla cellerna i 3 ml LB-medium med 100 μg / ml Kan; Skaka kraftigt (250 rpm, 37 ° C, 18 h).
    8. Förbered plasmid-DNA med användning av en alkalisk-SDS-lyseringsmetod, såsom beskrivits 10 .
    9. Bekräfta nukleotidsekvensen av rBC1531-expressionskonstruktionen med användning av DNA-sekvensering 12 .
  2. Överuttryck av rBC1531-proteinet
    1. Omforma E. coli BL21 (DE3) -stammen med rBC1531-expRundsekvensplasmid, såsom beskrivs i steg 1.1.5-1.1.6, för överuttryck.
    2. Välj en koloni och odla den i 10 ml LB-medium innehållande 50 μg / ml Kan (LB + Kan); Skaka kraftigt under 18 timmar vid 37 ° C.
    3. Inokulera 10 ml nattkultur i 1 liter LB + Kan-medium och odla vid 37 ° C tills OD 600 (optisk densitet vid 600 nm) når ~ 0,7.
    4. Dunkla kulturen i iskallt vatten i ~ 15 min för att kyla ner temperaturen till 18 ° C och tillsätt isopropyl β-D-1-tiogalaktopyranosid (IPTG) till odlingen vid en slutlig koncentration av 1 mM för rekombinant proteinuttryck. Odla kulturen vid 18 ° C under ytterligare 16-18 h.
  3. Rening av rBC1531
    1. Skörda cellerna genom centrifugering (5000 xg, 4 ° C, 30 min). Kassera supernatanten försiktigt för att inte störa cellerna. Suspendera cellerna i 50 ml fosfatbuffrad saltlösning (PBS) lösning innehållande 10 mM imidazol.
    2. Lyse cellerna två gånger genom sonication på is för att förhindra övervärmning av celllysaten (tid: 2 min 30 s, cykel på: 5 s, cykla av: 10 s; amplitud: 38%).
    3. Töm celllysatet genom centrifugering (~ 25 000 xg, 4 ° C, 30 min).
    4. Blanda 3 ml nickelpärlor och 60 ml PBS innehållande 10 mM imidazol och gravitation-flödet den extra bufferten för att sedimentera de jämviktiga nickelpärlorna i en 2,5 x 10 cm glaskromatografikolonn.
    5. Pipett för att överföra supernatanten från steg 1.3.3 till kolonnen med förjämviktiga nickelpärlor och inkubera vid 4 ° C i 2 timmar på ett spinnhjul med låg hastighet (~ 20 rpm).
    6. Låt supernatanten tömma genom gravitation och tvätta nickelkulorna i kolonnen tre gånger med 100 ml PBS innehållande 10 mM imidazol.
    7. Elute rBC1531 protein genom att applicera 4 x 5 ml PBS innehållande 250 mM imidazol.
    8. Ta 15 μl av elueringen från steg 1.3.7 och kör den på 15% SDS-PAGE. Visualisera proteinbanden påGelén med användning av Coomassie-blåfärgning 10 .
  4. Avlägsnande av affinitetsmärkningama för rBC1531-proteinet genom trombinproteolys
    1. Pipettera fraktionerna i dialysröret (molekylviktskärning: 3 kDa) och placera röret i en bägare innehållande 4 1 trombinklyvningskompatibel buffert (20 mM HEPES, pH 7,4, 150 mM NaCl och 1,5 mM p-merkaptoetanol) Vid 4 ° C över natten.
    2. Pipettera fraktionerna och överför dem till ett koniskt rör.
    3. Mät absorbansen vid 280 nm och uppskatta rBC1531 proteinkoncentrationen, som beskrivet 13 .
    4. Ta 50 μg rBC1531 i ett 0,5 ml rör och tillsätt olika mängder trombin ( dvs 2, 1, 0,6 och 0,3 enheter). Inkubera rBC1531- och trombinreaktionerna vid 20 ° C i ~ 3 h för att bestämma den minsta mängden trombin som krävs för att klyva den N-terminala affinitetsmärket.
    5. Kör rBC1531 och trombinreaktionerna på en 15%SDS-PAGE och bestämma den lägsta mängden trombin ( t ex 0,3 enheter trombin per 50 μg rBC1531) som fullständigt digererar den N-terminala affinitetsmärket och producerar en taggfri rBC1531.
    6. Tillsätt 10 mg rBC1531 protein och 60 enheter trombin till ett 15 ml rör och inkubera vid 20 ° C i ~ 3 h för trombin-proteolysreaktionen.
    7. Applicera gelfiltreringsstandarder till en SEKS-kolonn för storlek-uteslutningskromatografi för att framställa en standardkurva med molekylvikter och elueringsvolymer, såsom beskrivits 13 .
    8. Placera det trombinfördelade rBC1531-proteinet från steg 1.4.6 i ett centrifugalfilterrör (molekylviktsklippning: 3 kDa) och centrifugera vid 3000 g vid 4 ° C för att reducera till en volym mindre än 5 ml.
    9. Applicera det koncentrerade rBC1531-proteinet till SEC-kolonnen och samla 60 eluerade fraktioner i 0,5 ml per rör 13 .
    10. Ta 15 μl av varje fraktion, kör dem på en 15% SDS-PAGE och staiN gelén med användning av Coomassie-färgningslösning (0,15% (vikt / volym) Coomassie briljantblå, 40% (volym / volym) metanol och 10% (volym / volym) isättiksyra) som beskrivits 10 .
    11. Pipettera de fraktioner som innehåller rBC1531 och samla dem i ett rör.

2. Krystallisering Screening och optimering av rBC1531

  1. Screeningsbetingelser för rBC1531-proteinkristallisation
    1. Koncentrera rBC1531 från steg 1.4.11 upp till ~ 18,5 mg / ml med användning av ett centrifugalfilterrör, som beskrivs i steg 1.4.8.
    2. Tillsätt 50 μl av varje kristalliserings-screeningslösning (se avsnitt 2.2) 14 till brunnarna i kristalliseringsplattor med 96 brunnar. Placera 0,5 μl av 18,5 mg / ml rBC1531 proteinlösningen på en sittbädd. Blanda proteinlösningen med 0,5 | il av brunnslösningen, upprepa processen för hela plattan.
    3. Täck plattan med klar limfilm.Placera plattorna med 96 brunnar vid 18 ° C och tillåta ångdiffusion.
    4. Skanna dropparna vid 20-40X förstoring med hjälp av ett ljusmikroskop för att övervaka kristallbildning dagligen i 2-3 veckor.
    5. Samla röntgendiffraktionsdata 12 med användning av de erhållna rBC1531 proteinkristallerna.
  2. Optimering av kristalliseringsbetingelserna rBC1531
    1. Förbered 500 μL av den valda initialkristalliseringsbetingelsemedlet ( t ex 0,1 M natriumkakodylat, pH 6,5 och 1,0 M natriumcitrat) och fyll en kristalliseringsplatta med 24 brunnar för sittdroppen.
    2. Tillsätt 0,5 μL av 18,5 mg / ml rBC1531 proteinlösningen till en sittbädd, blanda med 0,5 μL brunnslösningen och täck omedelbart plåten med klar limfilm. Placera plattan vid 18 ° C.
    3. Observera kristalltillväxt under ett ljusmikroskop i en vecka.
    4. Optimera olika kristalliseringsförhållanden genom att ändra pH ( dvs.PH 5,5-6,8) av 0,1 M kakodylat och genom att ändra saltkoncentrationen ( dvs 0,9-1,2 M) natriumcitrat för att erhålla singulära kristaller. Övervaka kristalltillväxten i ~ 1 vecka och samla röntgendiffraktionsdata 12 .

3. Karakterisering av nukleosidtrifosfatas (NTPas) aktivitet av rBC1531

  1. Validering av den oorganiska fosfatberoende kolorimetriska studien
    1. Förbered ett lager av pyrofosfat (100 mM) och utspäd det till slutliga koncentrationer av 0,1, 0,25, 0,5, 1,0, 5,0, 10, 50, 100 och 250 / xM i 200 | il reaktionsbuffert (20 mM HEPES, pH 7,4; 150 MM NaCl och 2 mM MgCl2) i dubbla plattor med 96 brunnar. Använd den första plattan som en kontroll (detta innehåller inte pyrofosfatas). Se till att den andra plattan innehåller pyrofosfatas som en arbetsplåt, enligt anvisningarna i steg 3.1.2.
    2. Lägg till 0,01 enhet Saccharomyces cerevisiae oorganisk pYrofosfatas (1 jil) till brunnarna på arbetsplattan och inkubera vid 20 ° C under 30-60 minuter.
    3. Förbered molybdatsyralösningen genom att blanda ammoniummolybdat (0,86% volym / volym) och askorbinsyra (14% volym / volym) lösningar i ett förhållande 7: 3. Tillsätt 16 μL molybdatsyralösning till både arbets- och kontrollbrunnarna och vänta i 15 min.
    4. Läs den optiska densiteten vid 690 nm (OD 690nm ).
  2. Colorimetrisk NTPasanalys
    1. Bered ett lager av 100 mM nukleosidtrifosfat (NTP) substrat och utspäd till önskad koncentration ( t ex 0, 0,2, 4,4, 11, 22, 44, 88 eller 132 uM) i 180 pi analysbuffert (20 mM HEPES, PH 7,4, 150 mM NaCl och 2 mM MgCl2).
    2. Tillsätt 20 μg rBC1531 (1,5 mM) och NTP-substraten från steg 3.2.1 till 200 μl per reaktion i en 96-brunnsplatta och pipetten upp och ner för att blanda väl. Täck tallriken med locket och placera den i en 37 ° C inkubator i 30 minuterFör att utföra substrathydrolysreaktionen.
    3. Överför tallriken till ett 70 ° C vattenbad och låt stå i 15 minuter för att stoppa rBC1531-medierade katalytiska reaktioner.
    4. Tillsätt 0,01 enhet S. cerevisiae oorganisk pyrofosfatas (1 μl) till varje brunn i reaktionsplattan (från steg 3.2.3) och inkubera vid 20 ° C under 30 minuter. Tillsätt 16 μL molybdatsyralösning till reaktionsplattan för att utveckla färgen (~ 15 min). Läs på OD 690nm .
    5. Analysera med hjälp av Michaelis-Menten ekvationen, som beskrivet 12 .

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Karakterisering av proteinet av intresse i denna studie började genom att framställa en tillräcklig mängd rekombinant B. cereus bc1531 (rBC1531) protein, företrädesvis mer än flera milligram. DNA-fragmentet som kodar för BC1531-proteinet framställdes genom PCR med användning av det genomiska DNA'et av B. cereus som en mall, eftersom den innehåller ortopologiska gener identiska med ba1554 . RBC1531 överuttrycktes som ett lösligt protein i E. coli- celler. RBC1531-proteinet uttrycktes med en 6x-histidin-tagg och en trombinklyvningsplats vid dess N-ände 12 . Som ett första steg av rening renades rBC1531 genom nickelaffinitetskromatografi ( Figur 1A ). Därefter utfördes en trombin-digestionsförsök för bestämning av den lägsta mängden trombin som erfordras för fullständig digestion av affinitetsmärket från rBC1531 ( Figur 1A ). I våra händer var 0,3 enheter trombin sufTillräcklig för att helt avlägsna affinitetsmärket från rBC1531. Således, vid skalning, behandlades 10 mg rBC1531 med 60 enheter trombin för taggavlägsnande. Efter trombin-digestion applicerades den taggfria rBC1531 på en SEC-kolonn för att avlägsna eventuella lösliga aggregat och föroreningar med högre eller lägre molekylvikt. RBC1531-fraktionerna analyserades med SDS-PAGE, vars resultat antyder att rBC1531 var ~ 99% ren ( Figur 1A ). Sammantaget gav 1 liter odling ~ 8 mg rBC1531-protein.

För att uppskatta den oligomera statusen av rBC1531 utfördes SEC. En standardlinjär kurva som korrelerar logvärdet för provets molekylvikter med deras motsvarande elueringsvolymer, plottades med användning av topparna av proteinstandarderna ( Figur IB ). RBC1531 eluerades vid en elueringsvolym av ~ 84 ml och dess uppenbara molekylvikt uppskattades som ~ 55 kDa. Med tanke på att den beräknade molekylära viÅtta av rBC1531-monomeren är ~ 13 kDa, dessa resultat indikerar att rBC1531 monteras som en tetramer.

Renat rBC1531 screenades för kristallisation med användning av ~ 400 betingelser i en söndagsfalldampdiffusionsmetod. RBC1531-kristallerna uppträdde i ~ 2 dagar vid två betingelser: tillstånd-A, 0,1 M natriumcitrat (pH 5,5) och 20% PEG 3000 ( Figur 2A ) och tillstånd B, 0,1 M natriumkakodylat (pH 6,5) och 1,0 M natrium Citrat ( Figur 2B ). Kristallisationsbetingelserna optimerades genom att man varierade pH-värdet (0,1 M natriumcitrat, pH 5,0-6,0) och koncentrationen av PEG 3000 (18-21% PEG 3000) från tillstånd A och genom modifiering av pH-värdet (0,1 M natriumkakodylat, pH 5,5-6,8) och saltkoncentration (0,9-1,2 M natriumcitrat) från tillstånd-B. Diffraktionskompatibla kristaller erhölls endast för tillstånd B, medan kristallerna från tillståndet A tenderade att vara vuxna i stället för singulär. Condition-B-kristallerDiffrakterade röntgenstrålar till en upplösning av 2,74 Å ( Figur 2C ) och användes för bestämning av rBC1531 struktur.

Observationen av en konserverad MazG-domän i BA1554-proteinsekvensen föreslog närvaron av NTPasaktivitet med förmåga att hydrolysera NTPs. NTP-hydrolys ger i allmänhet nukleosiddifosfat (NDP) och oorganiskt fosfat (Pi) eller nukleosidmonofosfat (NMP) och pyrofosfat (PPi). PPi kräver ytterligare pyrofosfatasaktivitet för att ge Pi. Nivån av Pi kan mätas direkt med användning av molybdat, vilket bildar ett blåfärgat komplex med Pi (molybdat-Pi) som kan övervakas med användning av den optiska densiteten vid en våglängd av 690 nm (OD 690 nm ) ( Figur 3A ). I vår studie, efter NTP hydrolys med rBC1531, producerades ingen synlig blå färg efter tillsats av molybdat ( Figur 3B ). När pyrofosfatas tillsattes till den rBC1531-medierade NTP-hydrolysen rEktion, färgen ändras till djupblå ( Figur 3B ), vilket indikerar att rBC1531 har NTP pyrofoshydrolasaktivitet. En plot av OD 690nm och NTP-koncentrationen analyserades med användning av en icke-linjär regressionsmetod för att bestämma de kinetiska parametrarna ( Vmax på 0,75 och Km av 10 pM) för rBC1531-enzymet ( Figur 3C ).

Figur 1
Figur 1: SDS-PAGE och size-exclusion chromatography (SEC) analys. ( A ) SDS-PAGE-analys av rBC1531. (Vänster) RBC1531-elueringstopparna från nickelaffinitetskromatografi (bana 2, Ni) och SEC (bana 3) analyserades tillsammans med proteinstandarder (bana 1, märkt i kDa). (Höger) Analys av trombin-digestionen av rBC1531 för avlägsnande av affinitetsmärket. Mängderna trombin tillsatt till 50 | ig rBC1531 i olika reaktioner är indIcerade i enheter ovanför gelén. ( B ) Storleks-uteslutningskromatografi (SEC) -analys av rBC1531 och proteinstandarderna. (Vänster) Elueringsprofiler av rBC1531 (blå) och standarder (röd). Molekylvikter av standardproteinerna visas ovanför varje topp, i kDa. De vertikala (y) och horisontella (x) axlarna visar milliabsorptionsenheterna (mAU vid 280 nm) respektive retentionsvolymerna (ml). (Höger) Den skenbara molekylstorleken hos rBC1531 uppskattades med användning av en linjär plot för molekylvikterna, i loggskala och elueringsvolymer av proteinstandarder (R2 = 0,9934). Vänligen klicka här för att se en större version av denna figur.

Figur 2
Figur 2: Kristallisation och röntgendiffraktion. ( A ) rBC1531 kristaller i konditi0,1 M natriumcitrat (pH 5,5) och 20% PEG 3000. ( B ) rBC1531 kristaller i tillstånd B, 0,1 M natriumkakodylat (pH 6,5) och 1,0 M natriumcitrat. Initial (vänster) och optimerade (mitten och höger) kristaller visas. Den optimerade rBC1531-kristallen (höger, ~ 0,35 mm x ~ 0,35 mm x ~ 0,20 mm) användes för röntgendiffraktion. Skalstänger = 100 μm. ( C ) röntgendiffraktionsbild av rBC1531-kristallen erhållen vid PAL-strållinjen BL-7A 12 . Pilen indikerar en plats med hög upplösning. Vänligen klicka här för att se en större version av denna figur.

Figur 3
Figur 3: NTPasaktivitet. ( A ) Bildningen av molybden-Pi-komplexet är beroende av Pi-koncentrationen. Optisk densitet vid 690 nm är diRektivt förknippad med ökningen i Pi-nivåer. Y-axeln och X-axeln representerar OD respektive OD 690 nm och koncentrationen (μM). ( B ) Färgen förändras vid tillsatsen av pyrofosfatas. I den första raden av brunnar tillsattes inte pyrofosfatas och bildade inte det blåfärgade Pi-komplexet. Den andra raden består emellertid av brunnar där rBC1531-NTP-reaktionerna behandlades med pyrofosfatas och utvecklades en blå färg. OD 690nm-värdena ökade med ökad NTP-koncentration. ( C ) Michaelis-Menten-plot av rBC1531-NTP-reaktionerna. Y-axeln och X-axeln representerar OD 690 nm och koncentration (0-120 | im) av NTP-substrat. Felstängerna representerar standardavvikelsen för tre separata experiment. Vänligen klicka här för att se en större version av denna figur.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna har ingenting att avslöja.

Acknowledgments

Röntgendiffraktionsdataseten samlades in vid strålningslinjen 7A i Pohang Accelerator Laboratory (Korea). Denna studie stöddes av Grundforskningsprogrammet administrerat genom Nationella forskningsstiftelsen i Korea, finansierat av ministeriet för vetenskap, IKT och framtidsplanering (2015R1A1A01057574 till MH).

Materials

Name Company Catalog Number Comments
Bacillus cereus ATCC14579 Korean Collection for Tissue Culture 3624
Genomic DNA prep kit GeneAll 106-101 Genomic DNA preparation
Forward primer Macrogen GAAGGATCCGGAAGCAAAAA
CGATGAAAGATATGCA
BamHI site is underlined
Reverse primer Macrogen CTTGTCGACTTATTCTTTCTCT
CCCTCATCAATACGTG
SalI site is underlined
nPfu-Forte Enzynomics P410 PCR polymerase
BamHI Enzynomics R003S
SalI Enzynomics R009S
pET49b expression vector Novagen 71463 Expression vector was modified to add affinity tags and BamHI/SalI sites10
T4 DNA ligase Enzynomics M001S
Dialysis memebrane Thermofisher 18265017
Dry block heater JSR JSBL-02T
LB broth (Luria-Bertani) LPS solution LB-05
LB Agar, Miller (Luria-Bertani) Becton, Dickinson and Company
Kanamycin LPS solution KAN025
Mini-prep kit Favorgen FAPDE300 Plasmid DNA preparation
BL21(DE3) Competent cell Novagen 69450-3CN
Isopropyl β-D-1-thiogalactopyranoside (IPTG) Fisher BioReagents 50-213-378
Sodium chloride Daejung 7548-4100 PBS material
Potassium chloride Daejung 6566-4405 PBS material
Potassium phosphate Bio Basic Inc PB0445 PBS material
Sodium phosphate Bio Basic Inc S0404 PBS material
Imidazole Bio Basic Inc IB0277
Sonicator Sonics VCX 130
Ni-NTA agaros Qiagen 30210 Nickel bead
Rotator Finepcr AG
Precision Plus Protein Dual Color Standards Bio-rad 1610374 SDS-PAGE protein standard
Coonmassie Brilliant Blue R-250 Fisher BioReagents BP101-25 Coomassie staining solution
Methyl alcohol Samchun chemical M0585 Coomassie staining solution
Acetic acid Daejung 1002-4105 Coomassie staining solution
Dialysis memebrane Thermofisher 68035
2-Mercaptoethanol Sigma-aldrich M6250
Thrombin Merckmillipore 605157-1KUCN Prepare aliquots of 20 μL (1 Unit per μL) and store at 70 °C and thaw before use
Superdex 200 16/600 General Electric 28989335 Size exclusion chromatography
Gel filtration standard Bio-rad 151-1901
Centrifugal filter Amicon UFC800396
Crystralization plates Hampton research HR3-083 96-well sitting drop plate
The JCSG core suite I-IV Qiagen 130924-130927 Crystallization secreening solution
Microscope Nikon SMZ745T
Cryschem plates Hampton research HR3-158 24-well sitting drop plate
Inorganic pyrophosphatase Sigma 10108987001
Ammonium molybdate solution Sigma 13106-76-8
L-ascorbic acid Sigma 50-81-7
NTP substrate Startagene 200415-51
Spectrophotometer Biotek SynergyH1 microplate reader
GraphPad Prism 5 GraphPad Prism 5 for Window

DOWNLOAD MATERIALS LIST

References

  1. Ivanova, N., et al. Genome sequence of Bacillus cereus and comparative analysis with Bacillus anthracis. Nature. 423, 87-91 (2003).
  2. Spencer, R. C. Bacillus anthracis. J Clin Pathol. 56, 182-187 (2003).
  3. Deli, A., et al. LmbE proteins from Bacillus cereus are de-N-acetylases with broad substrate specificity and are highly similar to proteins in Bacillus anthracis. FEBS J. 277, 2740-2753 (2010).
  4. Gross, M., Marianovsky, I., Glaser, G. MazG -- a regulator of programmed cell death in Escherichia coli. Mol Microbiol. 59, 590-601 (2006).
  5. Galperin, M. Y., Moroz, O. V., Wilson, K. S., Murzin, A. G. House cleaning, a part of good housekeeping. Mol Microbiol. 59, 5-19 (2006).
  6. Lee, S., et al. Crystal structure of Escherichia coli MazG, the regulator of nutritional stress response. J Biol Chem. 283, 15232-15240 (2008).
  7. Moroz, O. V., et al. Dimeric dUTPases, HisE, and MazG belong to a new superfamily of all-alpha NTP pyrophosphohydrolases with potential "house-cleaning" functions. J Mol Biol. 347, 243-255 (2005).
  8. Robinson, A., et al. A putative house-cleaning enzyme encoded within an integron array: 1.8 A crystal structure defines a new MazG subtype. Mol Microbiol. 66, 610-621 (2007).
  9. Moroz, O. V., et al. The crystal structure of a complex of Campylobacter jejuni dUTPase with substrate analogue sheds light on the mechanism and suggests the "basic module" for dimeric d(C/U)TPases. J Mol Biol. 342, 1583-1597 (2004).
  10. Green, M., Sambrook, J. Molecular cloning: A laboratory Manual. 1, John Inglis. (2012).
  11. Brown, T. A. Gene cloning an introduction. Chapman & Hall. (1986).
  12. Kim, M. I., Hong, M. Crystal structure of the Bacillus-conserved MazG protein, a nucleotide pyrophosphohydrolase. Biochem Biophys Res Commun. 472, 237-242 (2016).
  13. Sheehan, D. Physical biochemistry: Principles and applications. A John Wiley & Sons. (2009).
  14. Lesley, S. A., Wilson, I. A. Protein production and crystallization at the joint center for structural genomics. J Struct Funct Genomics. 6, 71-79 (2005).
  15. Jeon, Y. J., et al. Structural and biochemical characterization of bacterial YpgQ protein reveals a metal-dependent nucleotide pyrophosphohydrolase. J Struct Biol. 195, 113-122 (2016).
Rekombinant Proteinuttryck, Kristallisation och Biofysiska Studier av a<em&gt; Bacillus</em&gt; -konserverad nukleotidpyrofosforylas, BcMazG
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Kim, M. I., Lee, C., Hong, M. Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG. J. Vis. Exp. (123), e55576, doi:10.3791/55576 (2017).More

Kim, M. I., Lee, C., Hong, M. Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG. J. Vis. Exp. (123), e55576, doi:10.3791/55576 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter