Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biochemistry

تعبير البروتين المؤتلف، التبلور، والدراسات البيوفيزيائية ل doi: 10.3791/55576 Published: May 16, 2017

Summary

عصيات الجمرة الخبيثة هو الممرض الملزم من الجمرة الخبيثة استنشاق قاتلة، لذلك يتم تنظيم دراسات جيناته والبروتينات بدقة. وثمة نهج بديل هو دراسة الجينات أورثولوغوس. نحن تصف الدراسات الفيزيائية الحيوية من B. انثراسيس أورثولوغ في B. سيريوس ، bc1531، التي تتطلب الحد الأدنى من المعدات التجريبية والافتقار إلى مخاوف تتعلق بالسلامة خطيرة.

Abstract

للتغلب على القيود واللوائح السلامة عند دراسة الجينات والبروتينات من مسببات الأمراض الحقيقية، ويمكن دراسة مثيلاتها. عصيات الجمرة الخبيثة هو الممرض الملزم الذي يسبب الجمرة الخبيثة استنشاق قاتلة. عصية سيريوس يعتبر نموذجا مفيدا لدراسة B. الجمرة الخبيثة بسبب العلاقة التطورية وثيقة. يتم حفظ مجموعة الجينات ba1554 - ba1558 من B. الجمرة الخبيثة للغاية مع الكتلة bc1531 - bc1535 في B. سيريوس ، وكذلك مع الكتلة bt1364-bt1368 في عصيات ثورينجينزيس، مما يدل على الدور الحاسم للجينات المرتبطة في جنس عصيات . تصف هذه المخطوطة طرق إعداد وتوصيف منتج بروتين من الجين الأول ( ba1554 ) من مجموعة الجينات في B. انثراسيس باستخدام بروتين المؤتلف من أورثولوغ في B. سيريوس ، bc1531.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

يستخدم تعبير البروتين المؤتلف على نطاق واسع للتغلب على المشاكل المرتبطة بمصادر البروتين الطبيعية، مثل كميات البروتين محدودة والتلوث الضارة. وعلاوة على ذلك، في دراسات الجينات المسببة للأمراض والبروتينات، سلالة المختبرات البديلة التي لا تتطلب احتياطات السلامة إضافية يمكن استخدامها. على سبيل المثال، عصية سيريوس هو نموذج مفيد لدراسة عصيات الجمرة الخبيثة بسبب العلاقة التطورية وثيقة 1 .

B. الجمرة الخبيثة هو الممرض الملزم الذي يسبب الجمرة الخبيثة استنشاق قاتلة في البشر والماشية، ويمكن أن تستخدم كطائرة بيولوجية 2 . وهكذا، فإن الدراسات المختبرية على B. الخبيثة تخضع لرقابة صارمة من قبل المراكز الأمريكية لمكافحة الأمراض، والتي تتطلب ممارسات السلامة البيولوجية المستوى 3 (بسل-3)، التي تنص على فصل منطقة المختبر مع ضغط الغرفة السلبي. على النقيض من B. الجمرة الخبيثة B. سيريوس كعامل بسل-1 وبالتالي لديه الحد الأدنى من المخاوف المتعلقة بالسلامة. B. سيريوس هو الممرض الانتهازية التي، عند الإصابة، يسبب التسمم الغذائي التي يمكن علاجها دون مساعدة طبية. ومع ذلك، لأن B. سيريوس سهم العديد من الجينات الحرجة مع B. الجمرة الخبيثة ، وظائف B. البروتينات الجمرة الخبيثة يمكن دراستها باستخدام هومولوجس المقابلة من B. سيريوس 1 .

يتم حفظ ba1554 - ba1558 مجموعة الجينات من B. الجمرة الخبيثة للغاية مع bc1531 - bc1535 العنقودية من B. سيريوس ، وكذلك مع مجموعة bt1364-bt1368 من عصيات ثورينجينزيس ، من حيث تنظيم الجينات وتسلسل. وعلاوة على ذلك، فإن الجينات الأولى ( ba1554 ، bc1531 ، و bt1364 ) من مجموعات كل الحفاظ عليها تماما ( أي 100٪ هوية تسلسل النوكليوتيدات)، إمبلينانوغرام دورا حاسما للمنتج الجين في الأنواع العصوية . نظرا لموقعها في هذه المجموعات الجينية، تم تعريف ba1554 خطأ كمنظم النسخ المفترضة 3 . ومع ذلك، تحليل تسلسل الأحماض الأمينية من المنتج ba1554 يشير إلى أنه ينتمي إلى عائلة مازغ، التي لديها نشاط النيوكليوتيدات بيروفوسفهيدرولاز ولا يرتبط مع نشاط عامل النسخ 4 ، 5 . على الرغم من أن البروتينات التي تنتمي إلى عائلة مازغ متنوعة فيما يتعلق بالتتابع الكلي والطول، فإنها تشترك في نطاق مازغ 100 ~ متبقي يتميز عزر إكس 12-28 إكسد ("X" يقف على أي بقايا حمض أميني، وعدد يشير إلى عدد من بقايا X).

مجال مازغ لا دائما تمثل مباشرة لنشاط حفزي معين. عضو مازغ من الإشريكية القولونية (إكمازغ) تمتلك اثنين من المجالات مازغ، ولكن جرالي C- محطة مازغ المجال هو الأنزيمية نشطة 6 . وعلاوة على ذلك، فإن خصوصية الركيزة من إنزيمات مازغ يختلف من ثلاثي فوسفات النيوكليوسيد غير محددة (ل إكمازغ) إلى دكب / داتب محددة (للمازجين المرتبطة إنتغرين) و دوتب (ل دوتباسيس) 6 ، 7 ، 8 ، 9 . ولذلك، والتحليلات الفيزيائية الحيوية للبروتين BA1554 ضرورية لتأكيد نشاطها نتباز وفك خصوصية ركيزة لها.

هنا، ونحن نقدم بروتوكول خطوة بخطوة أن معظم المختبرات دون مرفق بسل-3 يمكن أن يتبع لتوصيف المنتج البروتين من الجين B. سيريوس bc1531 ، وهو أورثولوغ من B. انثراسيس ba1554 ، على المستوى الجزيئي. باختصار، تم التعبير عن BC1531 المؤتلف (rBC1531) في E. القولونية وتنقيتها باستخدام علامة تقارب. للتجارب البلورية بالأشعة السينية، البلوريةتم فحص ظروف زاتيون من البروتين RBC1531 والأمثل. لتقييم النشاط الأنزيمي من RBC1531، تم رصد نشاط نتباز كولوريمتريكالي لتجنب نوكلأوتيدس المسمى إشعاعيا التي تم استخدامها تقليديا. وأخيرا، مكننا تحليل البيانات الفيزيائية الحيوية التي تم الحصول عليها من تحديد حالة أوليغوميريزاتيون والمعلمات الحفازة من rBC1531، وكذلك للحصول على بيانات حيود الأشعة السينية من الكريستال rc1531.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. إنتاج البروتين المؤتلف وتنقية rc1531

  1. إعداد البروتين المؤتلف BC1531 (rBC1531) -البلازميد التعبير
    1. إعداد الحمض النووي الجيني من B. سيريوس 10 .
    2. تضخيم الجين bc1531 من قالب من الحمض النووي الجيني B. سيريوس من تفاعل البوليميراز سلسلة (ير)، وذلك باستخدام الاشعال إلى الأمام والعكس (انظر قائمة المواد) لإنشاء بام هاي و سال I مواقع انزيم تقييد، على التوالي 10 .
    3. هضم المنتج ير وناقل pET49b تعديل (pET49bm) باستخدام بام مرحبا و سال I، كما هو موضح 11 .
    4. مزيج المنتج ير يهضم وناقلات (3: 1 نسبة) من الخطوة 1.1.3 باستخدام ليغاز T4 دنا في رد فعل 10 ميكرولتر، كما هو موضح 11 . احتضان عند 18 درجة مئوية لمدة 30 دقيقة.
    5. ماصة 3 ميكرولتر من رد فعل ربط في 50 ميكرولتر من الكيمياءلي المختصة E. القولونية خلايا DH5α في أنبوب. مزيج بلطف بيبتينغ صعودا وهبوطا ومكان على الجليد لمدة 30 دقيقة. صدمة حرارة لمدة 45 ثانية عند 42 درجة مئوية. إضافة 1 مل من لوريا-بيرتاني (لب) المتوسطة وتنمو الخلايا في حين يهز بقوة (250 دورة في الدقيقة، 37 درجة مئوية، 45 دقيقة).
    6. خذ 100 ميكرولتر من الخلايا المحولة من الخطوة 1.1.6 ونشرها على لوحات لب-أجار مع 100 ميكروغرام / مل كانامايسين (كان). احتضان لمدة ~ 18 ساعة عند 37 درجة مئوية.
    7. اختيار المستعمرات باستخدام طرف العقيمة وتنمو الخلايا في 3 مل من وسط لب مع 100 ميكروغرام / مل كان؛ يهز بقوة (250 دورة في الدقيقة، 37 درجة مئوية، 18 ساعة).
    8. إعداد الحمض النووي البلازميد باستخدام طريقة تحلل القلوية-سدز، كما هو موضح 10 .
    9. تأكيد تسلسل النيوكليوتيدات من التعبير RBC1531 بناء باستخدام تسلسل الحمض النووي 12 .
  2. أوفيركسريسيون من البروتين rc1531
    1. إعادة تحويل E. القولونية BL21 (DE3) سلالة مع rBC1531-إكسريسيون البلازميد، كما هو موضح في الخطوات 1.1.5-1.1.6، ل أوفيركسريسيون.
    2. حدد مستعمرة وتنمو في 10 مل من وسط لب تحتوي على 50 ميكروغرام / مل كان (لب + كان). يهز بقوة لمدة 18 ساعة عند 37 درجة مئوية.
    3. تطعيم 10 مل من الثقافة بين عشية وضحاها في 1 لتر من لب + كان المتوسطة وتنمو عند 37 درجة مئوية حتى أود 600 (الكثافة البصرية في 600 نانومتر) تصل ~ 0.7.
    4. تغمر الثقافة في الماء البارد لمدة 15 دقيقة ~ لتبريد درجة الحرارة إلى 18 درجة مئوية وإضافة الأيزوبروبيل β-D-1-ثيوغالاكتوبيرانوسيد (إيبت) إلى الثقافة في تركيز النهائي من 1 ملم للتعبير البروتين المؤتلف. تنمو الثقافة في 18 درجة مئوية لمدة إضافية ~ 16-18 ح.
  3. تنقية rc1531
    1. حصاد الخلايا بواسطة الطرد المركزي (5000 x ج، 4 درجات مئوية، 30 دقيقة). تجاهل طاف بعناية حتى لا يزعج الخلايا. إعادة تعليق الخلايا في 50 مل من محلول ملحي الفوسفات مخزنة (بس) تحتوي على 10 ملي إيميدازول.
    2. ليس الخلايا مرتين عن طريق سونيكاتيون على الجليد لمنع الإفراط في التدفئة من ليسيتس الخلية (الوقت: 2 دقيقة 30 ثانية؛ دورة على: 5 ثانية؛ دورة قبالة: 10 ثانية؛ السعة: 38٪).
    3. مسح المحللة الخلية بواسطة الطرد المركزي (~ 25،000 x ج، 4 درجات مئوية، 30 دقيقة).
    4. مزيج 3 مل من الخرز النيكل و 60 مل من برنامج تلفزيوني يحتوي على 10 ملي إيميدازول والجاذبية تدفق العازلة اضافية لتسوية الخرز النيكل معايرتها في عمود كروماتوغرافيا الزجاج 2.5 × 10 سم.
    5. ماصة لنقل طاف من الخطوة 1.3.3 إلى العمود مع ما قبل معايره الخرز النيكل واحتضان في 4 درجات مئوية لمدة 2 ساعة على عجلة الغزل في سرعة منخفضة (~ 20 دورة في الدقيقة).
    6. السماح طاف لاستنزاف من قبل الجاذبية وغسل الخرز النيكل في العمود ثلاث مرات مع 100 مل من برنامج تلفزيوني يحتوي على 10 ملي إيميدازول.
    7. أزل البروتين RBC1531 من خلال تطبيق 4 × 5 مل من برنامج تلفزيوني يحتوي على 250 ملي إيميدازول.
    8. خذ 15 ميكرولتر من شطف من الخطوة 1.3.7 وتشغيله على 15٪ سدز-بادج. تصور العصابات البروتين جراهلام باستخدام كوماسي تلطيخ الأزرق 10 .
  4. إزالة علامات تقارب بروتين rc1531 عن طريق التحلل البروتين ثرومبين
    1. ماصة الكسور في أنبوب غسيل الكلى (الوزن الجزيئي قطع: 3 كيلو دالتون) ووضع أنبوب في كوب يحتوي على 4 L من العازلة ثرومبين الانقسام متوافق (20 ملي هيبيس، ودرجة الحموضة 7.4، 150 ملي كلوريد الصوديوم، و 1.5 ملي β ميركابتوثانول) عند 4 درجات مئوية بين عشية وضحاها.
    2. ماصة الكسور ونقلها إلى أنبوب مخروطي الشكل.
    3. قياس الامتصاصية في 280 نانومتر وتقدير تركيز البروتين RBC1531، كما هو موضح 13 .
    4. تأخذ 50 ميكروغرام من RBC1531 في أنبوب 0.5 مل وإضافة كميات مختلفة من الثرومبين ( أي 2، 1، 0.6، و 0.3 وحدة). احتضان ردود الفعل rc1531 والثرومبين في 20 درجة مئوية لمدة ~ 3 ساعة لتحديد أقل كمية من الثرومبين المطلوبة لتلصق علامة تقارب N- محطة.
    5. تشغيل ردود الفعل rc1531 والثرومبين على 15٪سدز-بادج وتحديد أقل كمية من الثرومبين (على سبيل المثال، 0.3 وحدة من الثرومبين في 50 ميكروغرام من RBC1531) أن هضم تماما علامة تقارب N- محطة وإنتاج rc1531 خالية من العلامات.
    6. إضافة 10 ملغ من البروتين RBC1531 و 60 وحدة من الثرومبين إلى أنبوب 15 مل واحتضان عند 20 درجة مئوية لمدة ~ 3 ساعة لرد فعل ثرومبين-التحلل البروتيني.
    7. تطبيق معايير الترشيح هلام إلى العمود اللوني استبعاد الحجم (سيك) لإعداد منحنى القياسية من الأوزان الجزيئية وأحجام شطف، كما هو موضح 13 .
    8. وضع البروتين rc1531 هضم الثرومبين من الخطوة 1.4.6 في أنبوب فلتر الطرد المركزي (الوزن الجزيئي قطع: 3 كيلو دالتون) وأجهزة الطرد المركزي في 3000 غرام في 4 درجات مئوية للحد من حجم أقل من 5 مل.
    9. تطبيق البروتين المركزة rc1531 إلى العمود المجلس الأعلى للتعليم وجمع 60 كسور إلوتد في 0.5 مل لكل أنبوب 13 .
    10. خذ 15 ميكرولتر من كل جزء، تشغيلها على 15٪ سدز-بادج، وستايn هلام باستخدام حل تلطيخ كوماسي (0.15٪ (ث / ت) كوماسي الأزرق الرائعة، 40٪ (الخامس / الخامس) الميثانول، و 10٪ (الخامس / الخامس) حمض الخليك الجليدي) كما هو موضح 10 .
    11. ماصة الكسور التي تحتوي على rc1531 وجمعها في أنبوب واحد.

2. فحص التبلور وتحسين RBC1531

  1. ظروف الفحص للبروتين RBC1531 تبلور
    1. تركيز rc1531 من الخطوة 1.4.11 تصل إلى ~ 18.5 ملغ / مل باستخدام أنبوب فلتر الطرد المركزي، كما هو موضح في الخطوة 1.4.8.
    2. إضافة 50 ميكرولتر من كل حل تبلور الفحص (انظر القسم 2.2) 14 إلى آبار 96-جيدا بلورات الجلوس إسقاط التبلور. وضع 0.5 ميكرولتر من 18.5 ملغ / مل RBC1531 حل البروتين على سرير الجلوس. مزيج من محلول البروتين مع 0.5 ميكرولتر من حل جيدا، وتكرار عملية لوحة كاملة.
    3. تغطية لوحة مع فيلم لاصق واضح.وضع لوحات 96 جيدا في 18 درجة مئوية والسماح لنشر البخار.
    4. مسح قطرات في التكبير 20-40X باستخدام المجهر الضوئي لرصد تشكيل الكريستال يوميا لمدة 2-3 أسابيع.
    5. جمع بيانات حيود الأشعة السينية 12 باستخدام البلورات البروتين RBC1531 التي تم الحصول عليها.
  2. تحسين ظروف البلورة rc1531
    1. إعداد 500 ميكرولتر من حل حالة التبلور الأولي المحدد (على سبيل المثال، 0.1 M كاكوديلات الصوديوم، ودرجة الحموضة 6.5 و 1.0 M سيترات الصوديوم) وملء لوحة بلورة 24 جيدا للهبوط الجلوس.
    2. إضافة 0.5 ميكرولتر من 18.5 ملغ / مل RBC1531 حل البروتين إلى سرير الجلوس، وتخلط مع 0.5 ميكرولتر من محلول جيدا، وتغطية لوحة على الفور مع فيلم لاصق واضح. وضع لوحة في 18 درجة مئوية.
    3. مراقبة نمو الكريستال تحت المجهر الضوئي لمدة أسبوع.
    4. تحسين ظروف التبلور المختلفة عن طريق تغيير الرقم الهيدروجيني ( أي، ودرجة الحموضة 5.5-6.8) من 0.1 M كاكوديلات وعن طريق تغيير تركيز الملح ( أي 0.9-1.2 M) من سترات الصوديوم للحصول على بلورات المفرد. رصد نمو الكريستال لمدة ~ 1 أسبوع وجمع بيانات حيود الأشعة السينية 12 .

3. توصيف نوكليوسيد ثلاثي الفوسفاتيز (نتباس) نشاط RBC1531

  1. التحقق من دراسة اللونية غير العضوية المعتمدة على الفوسفات
    1. إعداد مخزون من بيروفوسفات (100 ملم) وتمييع إلى تركيزات النهائية من 0.1، 0.25، 0.5، 1.0، 5.0، 10، 50، 100، و 250 ميكرومتر في 200 ميكرولتر من العازلة رد فعل (20 ملي هيبيس، ودرجة الحموضة 7.4، 150 مم كلوريد الصوديوم؛ و 2 ملي مغكل 2 ) في لوحات مكررة 96-جيدا. استخدام لوحة الأولى كعنصر تحكم (وهذا لا يحتوي على بيروفوسفاتيز). تأكد من أن اللوحة الثانية تحتوي على بيروفوسفاتيز كما لوحة عمل، وفقا لتوجيهات في الخطوة 3.1.2.
    2. إضافة 0.01 وحدة من ساكاروميسز سيريفيسياي غير العضوية pيروفوسفهاتاز (1 ميكرولتر) لآبار لوحة العمل واحتضان عند 20 درجة مئوية لمدة 30-60 دقيقة.
    3. إعداد محلول حمض الموليبديت عن طريق خلط الموليبديت الأمونيوم (0.86٪ الخامس / الخامس) وحمض الاسكوربيك (14٪ الخامس / الخامس) الحلول في نسبة 7: 3. إضافة 16 ميكرولتر من محلول حمض الموليبديت إلى كل من الآبار العمل والتحكم والانتظار لمدة 15 دقيقة.
    4. قراءة الكثافة البصرية في 690 نانومتر ( أود 690nm ).
  2. مقايسة نتباز اللونية
    1. إعداد مخزون من 100 ملي نكليوسيد ثلاثي الفوسفات (نتب) الركيزة وتمييع إلى التركيز المطلوب (على سبيل المثال، 0، 0.2، 4.4، 11، 22، 44، 88، أو 132 ميكرومتر) في 180 ميكرولتر من العازلة فحص (20 هيبيس ملي، ودرجة الحموضة 7.4، 150 ملي كلوريد الصوديوم، و 2 ملي مغكل 2 ).
    2. إضافة 20 ميكروغرام من RBC1531 (1.5 ملم) و ركائز نتب من الخطوة 3.2.1 تصل إلى 200 ميكرولتر لكل رد فعل في لوحة 96 جيدا وماصة صعودا وهبوطا لخلط جيدا. تغطية لوحة مع غطاء ووضعه في حاضنة 37 درجة مئوية لمدة 30 دقيقةلأداء رد فعل التحلل الركيزة.
    3. نقل لوحة إلى حمام مياه 70 درجة مئوية والسماح للوقوف لمدة 15 دقيقة لوقف ردود الفعل الحفازة بوساطة RBC1531.
    4. إضافة 0.01 وحدة من S. سيريفيسياي بيروفوسفاتيز غير العضوية (1 ميكرولتر) إلى كل بئر من لوحة التفاعل (من الخطوة 3.2.3) واحتضان عند 20 درجة مئوية لمدة 30 دقيقة. إضافة 16 ميكرولتر من محلول حمض الموليبديت إلى لوحة رد فعل لتطوير اللون (~ 15 دقيقة). قراءة في أود 690nm .
    5. تحليل باستخدام معادلة ميليليس-منتن، كما هو موضح 12 .

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

توصيف البروتين من الاهتمام في هذه الدراسة بدأت من خلال إعداد كمية كافية من المؤتلف B. سيريوس bc1531 (rBC1531) البروتين، ويفضل أكثر من عدة ملليغرام. تم إعداد جزء الحمض النووي ترميز البروتين BC1531 بواسطة ير باستخدام الحمض النووي الجيني من B. سيريوس كقالب، لأنه يحتوي على الجينات أورثولوغوس متطابقة ل ba1554 . كان RBC1531 أوفيركسرسد كبروتين قابل للذوبان في E. القولونية الخلايا. تم التعبير عن بروتين rc1531 مع علامة 6x-هيستيدين وموقع الانقسام الثرومبين في N- محطة 12 لها . كخطوة أولى من تنقية، تم تنقية rBC1531 بواسطة اللوني تقارب اللوني ( الشكل 1A ). بعد ذلك، تم تنفيذ تجربة الثرومبين الهضم لتحديد أقل كمية من الثرومبين المطلوبة للهضم الكامل لعلامة تقارب من RBC1531 ( الشكل 1A ). في أيدينا، كان 0.3 وحدة من الثرومبين سوففيسيت لإزالة علامة التقارب تماما من rc1531. وهكذا، عند التحجيم، تم علاج 10 ملغ من RBC1531 مع 60 وحدة من الثرومبين لإزالة العلامة. بعد الهضم الثرومبين، تم تطبيق rc1531 خالية من العلامة إلى العمود سيك لإزالة أي المجاميع القابلة للذوبان والملوثات الوزن أعلى أو أقل الجزيئية. تم تحليل الكسور rBC1531 من قبل سدز-بادج، ونتائج التي أشارت إلى أن RBC1531 كان ~ 99٪ نقية ( الشكل 1A ). عموما، 1 لتر من الثقافة أسفرت ~ 8 ملغ من البروتين RBC1531.

لتقدير حالة أوليغوميريك من RBC1531، تم تنفيذ سيك. المنحنى الخطي القياسي الذي يرتبط قيمة السجل من الأوزان الجزيئية من العينات مع أحجام شطف المقابلة كانت تآمر باستخدام قمم معايير البروتين ( الشكل 1B ). تم إزالتها RBC1531 في حجم شطف من ~ 84 مل، وكان يقدر وزنها الجزيئي الظاهري كما ~ 55 كيلو دالتون. وبالنظر إلى أن الجزيئية المحسوبة نحنإيت من المونومر rc1531 هو ~ 13 كيلو دالتون، وتشير هذه النتائج إلى أن rc1531 تجميع كما تيترامر.

تم فحص RBC1531 المنقى للتبلور باستخدام ~ 400 الظروف في طريقة الجلوس البخار قطرة نشر. وظهرت بلورات rc1531 في ~ 2 أيام في شرطين: حالة A، 0.1 M سيترات الصوديوم (الرقم الهيدروجيني 5.5) و 20٪ بيج 3000 ( الشكل 2A ) والحالة- B، 0.1 M كاكوديلات الصوديوم (الرقم الهيدروجيني 6.5) و 1.0 M الصوديوم سيترات ( الشكل 2B ). تم تحسين ظروف التبلور عن طريق تغيير الرقم الهيدروجيني (0.1 M سيترات الصوديوم، ودرجة الحموضة 5.0-6.0) وتركيز بيج 3000 (18-21٪ بيج 3000) من الشرط- A وتعديل الرقم الهيدروجيني (0.1 M كاكوديلات الصوديوم، ودرجة الحموضة 5.5-6.8) وتركيز الملح (0.9-1.2 M سيترات الصوديوم) من الشرط-B. تم الحصول على بلورات الانعراج مناسبة فقط للشرط B، في حين أن البلورات من الشرط-A تميل إلى أن تكون مزروعة بدلا من المفرد. بلورات الحالة-بأعسر الأشعة السينية إلى قرار من 2.74 Å ( الشكل 2C ) واستخدمت لتحديد هيكل RBC1531.

وأشارت ملاحظة مجال مازغ المحفوظة في تسلسل البروتين BA1554 وجود نشاط نتباز قادرة على هدروليزينغ نتبس. ويؤدي التحلل المائي نتب عموما إلى ثنائي فوسفات النيوكليوسيد (ندب) والفوسفات غير العضوية (بي)، أو مونوكوسفات النيوكليوسيد (نمب) والبيروفوسفات (بي). بي يتطلب نشاط بيروفوسفاتيز إضافية لانتاج بي. مستويات بي يمكن قياسها مباشرة باستخدام الموليبدات، الذي يشكل مجمع أزرق اللون مع بي (الموليبدات بي) التي يمكن رصدها باستخدام الكثافة البصرية في الطول الموجي من 690 نانومتر (أود 690nm) ( الشكل 3A ). في دراستنا، بعد نتب التحلل بواسطة rc1531، لم يتم إنتاج أي لون أزرق مرئي بعد إضافة الموليبدات ( الشكل 3B ). ومع ذلك، عندما تمت إضافة بيروفوسفاتيز إلى rc1531 بوساطة نتب هدروليسيس rإيكتيون، تغير لون إلى الأزرق العميق ( الشكل 3B )، مشيرا إلى أن rBC1531 ديه نتب بايروفوسفهيدرولاس النشاط. تم تحليل مؤامرة من أود 690nm و نتب تركيز باستخدام طريقة الانحدار غير الخطية لتحديد المعلمات الحركية (V ماكس من 0.75 و K م من 10 ميكرومتر) لانزيم rBC1531 ( الشكل 3C ).

شكل 1
الشكل 1: سدز-بادج وتحليل كروماتوجرافيا الحجم الاستبعاد (سيك). ( A ) تحليل سدز-بادج من rBC1531. (يسار) تم تحليل قمم rc1531 شطف من اللوني تقارب النيكل (حارة 2، ني) و سيك (حارة 3) جنبا إلى جنب مع معايير البروتين (حارة 1؛ المسمى في كيلو دالتون). (يمين) تحليل الهضم الثرومبين من rBC1531 لإزالة علامة تقارب. وأضافت كميات من الثرومبين إلى 50 ميكروغرام من RBC1531 في ردود فعل مختلفة هي إندالمثلج، إلى داخل، الوحدات، آنفا، ال التعريف، جيل. ( B ) تحليل الاستبعاد اللوني (سيك) من RBC1531 ومعايير البروتين. (يسار) ملامح شطف RBC1531 (الأزرق) والمعايير (الأحمر). وتظهر الأوزان الجزيئية للبروتينات القياسية أعلاه كل ذروة، في كيلو دالتون. وتبين المحاور العمودية (y) والأفقية (x) وحدات امتصاص الملي (ماو في 280 نانومتر) وحجم الاحتفاظ (مل)، على التوالي. (يمين) تم تقدير الحجم الجزيئي الظاهري لل RBC1531 باستخدام مؤامرة خطية للأوزان الجزيئية، في نطاق السجل، وأحجام شطف من معايير البروتين (R 2 = 0.9934). الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الشكل 2
الشكل 2: تبلور وحيود الأشعة السينية. ( A ) RBC1531 بلورات في كونديتي(أ ف 5.5) و 20٪ بيج 3000. ( ب ) بلورات rc1531 في حالة B، 0.1 M كاكوديلات الصوديوم (درجة الحموضة 6.5) و 1.0 M سيترات الصوديوم. يتم عرض الأولي (يسار) والأمثل (الأوسط واليمين) بلورات. تم استخدام كريستال rc1531 الأمثل (يمين، ~ 0.35 مم x ~ 0.35 مم x ~ 0.20 مم) للحيود الأشعة السينية. مقياس الحانات = 100 ميكرون. ( C ) صورة حيود الأشعة السينية من الكريستال rc1531 التي تم الحصول عليها في بال الخط الحديدي بل-7A 12 . السهم يشير إلى بقعة عالية الدقة. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الشكل 3
الشكل 3: النشاط نتباز. ( A ) تشكيل مجمع الموليبدينوم بي يعتمد على تركيز بي. كثافة بصرية في 690 نانومتر هو دييرتبط بشكل مستقيم مع زيادة في مستويات بي. المحور Y ومحور X تمثل أود 690nm والتركيز (ميكرومتر) من بي، على التوالي. ( ب ) يتغير لون على إضافة بيروفوسفاتيز. في الصف الأول من الآبار، لم يتم إضافة البيروفوسفاتيز ولم تشكل اللون الأزرق بي معقدة. ومع ذلك، فإن الصف الثاني يتكون من الآبار التي تم التعامل مع ردود الفعل RBC1531-نتب مع بيروفوسفاتيز وتطوير اللون الأزرق. زادت القيم أود 690nm مع زيادة في تركيزات نتب. ( C ) مكيليس-منتن مؤامرة من ردود الفعل rc1531-نتب. المحور Y ومحور X تمثل أود 690nm والتركيز (0-120 ميكرومتر) من ركائز نتب، على التوالي. تمثل أشرطة الخطأ الانحراف المعياري لثلاثة تجارب منفصلة. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

الكتاب ليس لديهم ما يكشف.

Acknowledgments

جمعت مجموعات بيانات حيود الأشعة السينية في خط الأشعة 7A لمختبر مسرع بوهانغ (كوريا). وقد تم دعم هذه الدراسة من قبل برنامج بحوث العلوم الأساسية التي تديرها المؤسسة الوطنية للبحوث في كوريا (نرف)، بتمويل من وزارة العلوم وتكنولوجيا المعلومات والاتصالات والتخطيط المستقبلي (2015R1A1A01057574 إلى م).

Materials

Name Company Catalog Number Comments
Bacillus cereus ATCC14579 Korean Collection for Tissue Culture 3624
Genomic DNA prep kit GeneAll 106-101 Genomic DNA preparation
Forward primer Macrogen GAAGGATCCGGAAGCAAAAA
CGATGAAAGATATGCA
BamHI site is underlined
Reverse primer Macrogen CTTGTCGACTTATTCTTTCTCT
CCCTCATCAATACGTG
SalI site is underlined
nPfu-Forte Enzynomics P410 PCR polymerase
BamHI Enzynomics R003S
SalI Enzynomics R009S
pET49b expression vector Novagen 71463 Expression vector was modified to add affinity tags and BamHI/SalI sites10
T4 DNA ligase Enzynomics M001S
Dialysis memebrane Thermofisher 18265017
Dry block heater JSR JSBL-02T
LB broth (Luria-Bertani) LPS solution LB-05
LB Agar, Miller (Luria-Bertani) Becton, Dickinson and Company
Kanamycin LPS solution KAN025
Mini-prep kit Favorgen FAPDE300 Plasmid DNA preparation
BL21(DE3) Competent cell Novagen 69450-3CN
Isopropyl β-D-1-thiogalactopyranoside (IPTG) Fisher BioReagents 50-213-378
Sodium chloride Daejung 7548-4100 PBS material
Potassium chloride Daejung 6566-4405 PBS material
Potassium phosphate Bio Basic Inc PB0445 PBS material
Sodium phosphate Bio Basic Inc S0404 PBS material
Imidazole Bio Basic Inc IB0277
Sonicator Sonics VCX 130
Ni-NTA agaros Qiagen 30210 Nickel bead
Rotator Finepcr AG
Precision Plus Protein Dual Color Standards Bio-rad 1610374 SDS-PAGE protein standard
Coonmassie Brilliant Blue R-250 Fisher BioReagents BP101-25 Coomassie staining solution
Methyl alcohol Samchun chemical M0585 Coomassie staining solution
Acetic acid Daejung 1002-4105 Coomassie staining solution
Dialysis memebrane Thermofisher 68035
2-Mercaptoethanol Sigma-aldrich M6250
Thrombin Merckmillipore 605157-1KUCN Prepare aliquots of 20 μL (1 Unit per μL) and store at 70 °C and thaw before use
Superdex 200 16/600 General Electric 28989335 Size exclusion chromatography
Gel filtration standard Bio-rad 151-1901
Centrifugal filter Amicon UFC800396
Crystralization plates Hampton research HR3-083 96-well sitting drop plate
The JCSG core suite I-IV Qiagen 130924-130927 Crystallization secreening solution
Microscope Nikon SMZ745T
Cryschem plates Hampton research HR3-158 24-well sitting drop plate
Inorganic pyrophosphatase Sigma 10108987001
Ammonium molybdate solution Sigma 13106-76-8
L-ascorbic acid Sigma 50-81-7
NTP substrate Startagene 200415-51
Spectrophotometer Biotek SynergyH1 microplate reader
GraphPad Prism 5 GraphPad Prism 5 for Window

DOWNLOAD MATERIALS LIST

References

  1. Ivanova, N., et al. Genome sequence of Bacillus cereus and comparative analysis with Bacillus anthracis. Nature. 423, 87-91 (2003).
  2. Spencer, R. C. Bacillus anthracis. J Clin Pathol. 56, 182-187 (2003).
  3. Deli, A., et al. LmbE proteins from Bacillus cereus are de-N-acetylases with broad substrate specificity and are highly similar to proteins in Bacillus anthracis. FEBS J. 277, 2740-2753 (2010).
  4. Gross, M., Marianovsky, I., Glaser, G. MazG -- a regulator of programmed cell death in Escherichia coli. Mol Microbiol. 59, 590-601 (2006).
  5. Galperin, M. Y., Moroz, O. V., Wilson, K. S., Murzin, A. G. House cleaning, a part of good housekeeping. Mol Microbiol. 59, 5-19 (2006).
  6. Lee, S., et al. Crystal structure of Escherichia coli MazG, the regulator of nutritional stress response. J Biol Chem. 283, 15232-15240 (2008).
  7. Moroz, O. V., et al. Dimeric dUTPases, HisE, and MazG belong to a new superfamily of all-alpha NTP pyrophosphohydrolases with potential "house-cleaning" functions. J Mol Biol. 347, 243-255 (2005).
  8. Robinson, A., et al. A putative house-cleaning enzyme encoded within an integron array: 1.8 A crystal structure defines a new MazG subtype. Mol Microbiol. 66, 610-621 (2007).
  9. Moroz, O. V., et al. The crystal structure of a complex of Campylobacter jejuni dUTPase with substrate analogue sheds light on the mechanism and suggests the "basic module" for dimeric d(C/U)TPases. J Mol Biol. 342, 1583-1597 (2004).
  10. Green, M., Sambrook, J. Molecular cloning: A laboratory Manual. 1, John Inglis. (2012).
  11. Brown, T. A. Gene cloning an introduction. Chapman & Hall. (1986).
  12. Kim, M. I., Hong, M. Crystal structure of the Bacillus-conserved MazG protein, a nucleotide pyrophosphohydrolase. Biochem Biophys Res Commun. 472, 237-242 (2016).
  13. Sheehan, D. Physical biochemistry: Principles and applications. A John Wiley & Sons. (2009).
  14. Lesley, S. A., Wilson, I. A. Protein production and crystallization at the joint center for structural genomics. J Struct Funct Genomics. 6, 71-79 (2005).
  15. Jeon, Y. J., et al. Structural and biochemical characterization of bacterial YpgQ protein reveals a metal-dependent nucleotide pyrophosphohydrolase. J Struct Biol. 195, 113-122 (2016).
تعبير البروتين المؤتلف، التبلور، والدراسات البيوفيزيائية ل<em&gt; العصوية</em&gt; -conserved النيوكليوتيد بيروفوسفوريلاس، بكمازغ
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Kim, M. I., Lee, C., Hong, M. Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG. J. Vis. Exp. (123), e55576, doi:10.3791/55576 (2017).More

Kim, M. I., Lee, C., Hong, M. Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG. J. Vis. Exp. (123), e55576, doi:10.3791/55576 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter