Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biochemistry

Rekombinante Protein Expression, Kristallisation und biophysikalische Studien von a doi: 10.3791/55576 Published: May 16, 2017

Summary

Bacillus anthracis ist der obligatorische Erreger der tödlichen Inhalations-Milzbrand, so dass Studien über seine Gene und Proteine ​​streng reguliert sind. Ein alternativer Ansatz ist es, orthologe Gene zu untersuchen. Wir beschreiben biophysikochemische Studien eines B. anthracis ortholog in B. cereus , bc1531, die minimale experimentelle Ausrüstung erfordern und keine ernsthaften Sicherheitsbedenken haben.

Abstract

Zur Überwindung von Sicherheitsbeschränkungen und -regelungen beim Studium von Genen und Proteinen aus echten Pathogenen können ihre Homologen untersucht werden. Bacillus anthracis ist ein obligativer Erreger, der tödliche inhalative Milzbrand verursacht. Bacillus cereus gilt als ein nützliches Modell für das Studium B. anthracis aufgrund seiner engen evolutionären Beziehung. Der Gencluster ba1554 - ba1558 von B. anthracis ist mit dem bc1531 - bc1535 - Cluster in B. cereus sowie mit dem bt1364 - bt1368 - Cluster in Bacillus thuringiensis hoch konserviert, was die kritische Rolle der assoziierten Gene in der Bacillus - Gattung anzeigt. Dieses Manuskript beschreibt Verfahren zur Herstellung und Charakterisierung eines Proteinprodukts des ersten Gens ( ba1554 ) aus dem Gencluster in B. anthracis unter Verwendung eines rekombinanten Proteins seines Orthologen in B. cereus , bc1531.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Rekombinante Proteinexpression ist weit verbreitet, um Probleme zu lösen, die mit natürlichen Proteinquellen verbunden sind, wie z. B. begrenzte Proteinmengen und schädliche Kontamination. Darüber hinaus kann bei Studien von pathogenen Genen und Proteinen eine alternative Laborstämme, die keine zusätzlichen Sicherheitsvorkehrungen erfordern, genutzt werden. Zum Beispiel ist Bacillus cereus ein nützliches Modell für das Studium der Bacillus anthracis aufgrund ihrer engen evolutionären Beziehung 1 .

B. anthracis ist ein obligativer Erreger, der bei Menschen und Vieh tödlichen inhalativen Milzbrand verursacht und potentiell als Biowaffen verwendet werden kann 2 . So werden Laboruntersuchungen an B. anthracis streng von den US-Zentren für die Krankheitsbekämpfung geregelt, die Biosicherheitsstufe 3 (BSL-3) Praktiken erfordern, die behaupten, dass der Laborbereich mit negativem Raumdruck getrennt wird. Im Gegensatz zu B. anthracis B. cereus wird als BSL-1-Agent kategorisiert und hat daher minimale Sicherheitsbedenken. B. cereus ist ein opportunistischer Erreger, der bei der Infektion eine Lebensmittelvergiftung verursacht, die ohne medizinische Hilfe behandelt werden kann. Da aber B. cereus viele kritische Gene mit B. anthracis teilt , können die Funktionen von B. anthracis-Proteinen mit den entsprechenden Homologen von B. cereus 1 untersucht werden.

Der ba1554 - ba1558 - Gencluster von B. anthracis ist mit dem bc1531 - bc1535 - Cluster hoch konserviert Von B. cereus , sowie mit dem bt1364-bt1368- Cluster von Bacillus thuringiensis , in Bezug auf Genorganisation und Sequenz. Weiterhin sind die ersten Gene ( ba1554 , bc1531 und bt1364 ) der jeweiligen Cluster absolut konserviert ( dh 100% Nukleotidsequenzidentität), implyiEine kritische Rolle des Genprodukts in der Bacillus- Spezies. Aufgrund seiner Lage in diesen Genclustern wurde ba1554 als mutmaßlicher Transkriptionsregulator 3 identifiziert. Die Aminosäuresequenzanalyse des ba1554- Produkts zeigt jedoch an, dass es zur MazG-Familie gehört, die eine Nukleotid-Pyrophosphohydrolase-Aktivität aufweist und nicht mit der Transkriptionsfaktor-Aktivität 4 , 5 assoziiert ist. Obwohl Proteine, die zur MazG-Familie gehören, in Bezug auf die Gesamtsequenz und -länge verschieden sind, teilen sie eine gemeinsame MazG-Domäne von 100 Resten, die durch ein EXXE 12-28 EXXD-Motiv charakterisiert ist ("X" steht für jeden Aminosäurerest und die Zahl Gibt die Anzahl der X-Reste an).

Die MazG-Domäne berücksichtigt nicht immer eine bestimmte katalytische Aktivität. Ein MazG-Mitglied aus Escherichia coli (EcMazG) besitzt zwei MazG-Domänen, aber aufDie C-terminale MazG-Domäne ist enzymatisch aktiv 6 . Darüber hinaus variiert die Substratspezifität von MazG-Enzymen von unspezifischen Nukleosidtriphosphaten (für EcMazG) bis zu spezifischem dCTP / dATP (für Integrin-assoziiertes MazG) und dUTP (für dUTPasen) 6 , 7 , 8 , 9 . Daher sind biophysikochemische Analysen des BA1554-Proteins notwendig, um seine NTPase-Aktivität zu bestätigen und seine Substratspezifität zu entschlüsseln.

Hier stellen wir ein Schritt-für-Schritt-Protokoll zur Verfügung, dass die meisten Laboratorien ohne BSL-3-Anlage folgen können, um das Proteinprodukt des B. cereus bc1531- Gens zu charakterisieren , das ein Orthologe von B. anthracis ba1554 auf molekularer Ebene ist. Kurz gesagt wurde rekombinantes BC1531 (rBC1531) in E. coli exprimiert und unter Verwendung eines Affinitätsmarkens gereinigt. Für kristallographische Röntgenuntersuchungen wurden die kristallinenZationsbedingungen des rBC1531-Proteins wurden gesiebt und optimiert. Um die enzymatische Aktivität von rBC1531 zu beurteilen, wurde die NTPase-Aktivität kolorimetrisch überwacht, um radioaktiv markierte Nukleotide zu vermeiden, die herkömmlicherweise verwendet wurden. Schließlich ermöglichten die Analysen der erhaltenen biophysikalisch-chemischen Daten, den Oligomerisierungszustand und die katalytischen Parameter von rBC1531 zu bestimmen sowie Röntgenbeugungsdaten aus dem rBC1531-Kristall zu erhalten.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Rekombinante Proteinherstellung und -reinigung von rBC1531

  1. Herstellung eines rekombinanten BC1531-Proteins (rBC1531) -expressionsplasmids
    1. Genomische DNA von B. cereus 10 vorbereiten .
    2. Amplifizieren des bc1531- Gens aus einer Matrize von B. cereus genomischen DNA durch Polymerasekettenreaktion (PCR) unter Verwendung von Vorwärts- und Rückwärtsprimern (siehe Materialliste) zur Bildung von BamHI- und SalI- Restriktionsenzymstellen bzw. 10 .
    3. Das PCR-Produkt und einen modifizierten pET49b-Vektor (pET49bm) unter Verwendung von BamHI und Sal I, wie beschrieben, verdauen.
    4. Mischen Sie das verdaute PCR-Produkt und den Vektor (3: 1-Verhältnis) aus Schritt 1.1.3 unter Verwendung von T4-DNA-Ligase in einer 10 & mgr; l-Reaktion, wie beschrieben 11 . Inkubieren bei 18 ° C für 30 min.
    5. 3 μl der Ligationsreaktion in 50 μl Chemica pipettierenLly kompetente E. coli DH5α Zellen in einem Röhrchen. Mischen Sie sanft durch Pipettieren auf und ab und legen Sie auf Eis für 30 min. Hitzeschock für 45 s bei 42 ° C. Füge 1 ml Luria-Bertani (LB) Medium hinzu und wachse die Zellen bei kräftigem Schütteln (250 U / min, 37 ° C, 45 min).
    6. Nehmen Sie 100 μl der transformierten Zellen aus Schritt 1.1.6 und verbreiten Sie sie mit 100 μg / ml Kanamycin (Kan) auf die LB-Agarplatten. Inkubieren für ~ 18 h bei 37 ° C.
    7. Pick-Kolonien unter Verwendung einer sterilen Spitze und wachsen die Zellen in 3 ml LB-Medium mit 100 & mgr; g / ml Kan; Kräftig schütteln (250 U / min, 37 ° C, 18 h).
    8. Vorbereiten von Plasmid-DNA unter Verwendung eines alkalischen SDS-Lyse-Verfahrens, wie beschrieben 10 .
    9. Bestätigen Sie die Nukleotidsequenz des rBC1531-Expressionskonstrukts unter Verwendung der DNA-Sequenzierung 12 .
  2. Überexpression des rBC1531-Proteins
    1. Re-transformieren Sie den E. coli BL21 (DE3) Stamm mit rBC1531-expWie in den Schritten 1.1.5-1.1.6 beschrieben, für die Überexpression.
    2. Wählen Sie eine Kolonie und wachsen Sie sie in 10 ml LB-Medium mit 50 μg / ml Kan (LB + Kan); Kräftig für 18 h bei 37 ° C schütteln.
    3. Inkulieren Sie 10 ml über Nacht Kultur in 1 l LB + Kan-Medium und wachsen bei 37 ° C, bis die OD 600 (optische Dichte bei 600 nm) ~ 0,7 erreicht.
    4. Die Kultur in eiskaltem Wasser für ca. 15 min eintauchen, um die Temperatur auf 18 ° C abkühlen zu lassen und Isopropyl-β-D-1-thiogalactopyranosid (IPTG) der Kultur bei einer Endkonzentration von 1 mM zur rekombinanten Proteinexpression zuzusetzen. Wachsen die Kultur bei 18 ° C für weitere ~ 16-18 h.
  3. Reinigung von rBC1531
    1. Die Zellen durch Zentrifugation (5.000 xg, 4 ° C, 30 min) ernten. Verwerfe den Überstand sorgfältig, um die Zellen nicht zu stören. Die Zellen in 50 ml Phosphat-gepufferter Kochsalzlösung (PBS), die 10 mM Imidazol enthält, erneut suspendieren.
    2. Lyse die Zellen zweimal durch Beschallung auf Eis, um die Überhitzung der Zelllysate zu verhindern (Zeit: 2 min 30 s, Zyklus auf: 5 s, Zyklus aus: 10 s, Amplitude: 38%).
    3. Löschen Sie das Zelllysat durch Zentrifugation (~ 25.000 xg, 4 ° C, 30 min).
    4. Mischen Sie 3 ml Nickelperlen und 60 ml PBS, enthaltend 10 mM Imidazol und den Schwerkraftfluss, den zusätzlichen Puffer, um die äquilibrierten Nickelperlen in einer 2,5 x 10 cm großen Glaschromatographiesäule zu fixieren.
    5. Pipettieren Sie den Überstand von Schritt 1.3.3 auf die Säule mit voräquilibrierten Nickelperlen und inkubieren bei 4 ° C für 2 h auf einem Spinnrad bei niedriger Geschwindigkeit (~ 20 U / min).
    6. Den Überstand durch Schwerkraft abtropfen lassen und die Nickelperlen in der Säule dreimal mit 100 ml PBS, enthaltend 10 mM Imidazol, waschen.
    7. Eluiertes rBC1531-Protein durch Aufbringen von 4 x 5 ml PBS, enthaltend 250 mM Imidazol.
    8. Nehmen Sie 15 μl der Elution aus Schritt 1.3.7 und führen Sie es auf 15% SDS-PAGE. Visualisierung der Proteinbänder aufDas Gel mit Coomassie-Blau-Färbung 10 .
  4. Entfernung der Affinitäts-Tags des rBC1531-Proteins durch Thrombin-Proteolyse
    1. Die Fraktionen in das Dialyse-Röhrchen pipettieren (Molekulargewichts-Cutoff: 3 kDa) und das Röhrchen in ein Becherglas geben, das 4 l Thrombinspalt-kompatiblen Puffer (20 mM HEPES, pH 7,4, 150 mM NaCl und 1,5 mM β-Mercaptoethanol) Bei 4 ° C über Nacht.
    2. Die Fraktionen pipettieren und auf ein konisches Röhrchen übertragen.
    3. Messen Sie die Extinktion bei 280 nm und schätzen Sie die rBC1531-Proteinkonzentration, wie beschrieben 13 .
    4. Nehmen Sie 50 μg rBC1531 in ein 0,5 ml-Röhrchen und fügen Sie verschiedene Mengen an Thrombin ( dh 2, 1, 0,6 und 0,3 Einheiten) hinzu. Inkubieren Sie die rBC1531- und Thrombinreaktionen bei 20 ° C für ~ 3 h, um die geringste Menge an Thrombin zu bestimmen, die erforderlich ist, um das N-terminale Affinitäts-Tag zu spalten.
    5. Führen Sie die rBC1531 und Thrombin Reaktionen auf eine 15%SDS-PAGE und bestimmen die niedrigste Menge an Thrombin ( z. B. 0,3 Einheiten Thrombin pro 50 μg rBC1531), die das N-terminale Affinitäts-Tag vollständig verdaut und ein tag-freies rBC1531 erzeugt.
    6. Füge 10 mg rBC1531-Protein und 60 Einheiten Thrombin zu einem 15-ml-Röhrchen hinzu und inkubiere bei 20 ° C für ~ 3 h für die Thrombin-Proteolyse-Reaktion.
    7. Wenden Sie Gel-Filtrationsstandards auf eine Größen-Ausschluss-Chromatographie (SEC) -Spalte an, um eine Standardkurve von Molekulargewichten und Elutionsvolumina herzustellen, wie beschrieben 13 .
    8. Das Thrombin-verdaute rBC1531-Protein aus Schritt 1.4.6 in einem Zentrifugal-Filterröhrchen (Molekulargewichts-Cutoff: 3 kDa) platzieren und bei 3.000 g bei 4 ° C zentrifugieren, um auf ein Volumen von weniger als 5 ml zu reduzieren.
    9. Das konzentrierte rBC1531-Protein in die SEC-Säule geben und 60 eluierte Fraktionen in 0,5 ml pro Röhrchen 13 sammeln.
    10. Nehmen Sie 15 μl pro Fraktion, führen Sie sie auf einer 15% SDS-PAGE und staiN das Gel unter Verwendung der Coomassie-Färbelösung (0,15% (w / v) Coomassie-Brillantblau, 40% (v / v) Methanol und 10% (v / v) Eisessig) wie beschrieben 10 .
    11. Pipettieren Sie die Fraktionen, die rBC1531 enthalten und sammeln sie in einem Tube.

2. Kristallisations-Screening und Optimierung von rBC1531

  1. Screening-Bedingungen für die rBC1531-Proteinkristallisation
    1. Konzentrieren Sie den rBC1531 von Schritt 1.4.11 bis zu ~ 18.5 mg / ml mit einem Zentrifugalfilterrohr, wie in Schritt 1.4.8 beschrieben.
    2. Füge 50 μl jeder Kristallisations-Screening-Lösung (siehe Abschnitt 2.2) 14 zu den Vertiefungen von 96-Well-Sitzen-Tropfen-Kristallisationsplatten hinzu. Platzieren Sie 0,5 μl der 18,5 mg / ml rBC1531 Proteinlösung auf einem Sitzbett. Mischen Sie die Proteinlösung mit 0,5 μl der Bohrlochlösung und wiederholen Sie das Verfahren für die gesamte Platte.
    3. Die Platte mit klarem Klebefilm bedecken.Die Platten mit 96 Vertiefungen auf 18 ° C stellen und Dampfdiffusion zulassen.
    4. Scannen Sie die Tropfen bei 20-40facher Vergrößerung mit einem Lichtmikroskop, um die Kristallbildung täglich für 2-3 Wochen zu überwachen.
    5. Sammeln Sie Röntgenbeugungsdaten 12 unter Verwendung der erhaltenen rBC1531-Proteinkristalle.
  2. Optimierung der rBC1531-Kristallisationsbedingungen
    1. Bereiten Sie 500 & mgr; l der ausgewählten Anfangskristallisationsbedingungen-Lösung ( z. B. 0,1 M Natriumcacodylat, pH 6,5 und 1,0 M Natriumcitrat) vor und füllen Sie eine 24-Well-Kristallisationsplatte für den Sitztropfen.
    2. Füge 0,5 μl der 18,5 mg / mL rBC1531-Proteinlösung zu einem Sitzbett hinzu, mischen mit 0,5 μl der Vertiefungslösung und decke die Platte sofort mit klarem Klebstofffilm ab. Legen Sie die Platte auf 18 ° C.
    3. Beobachten Sie das Kristallwachstum unter einem Lichtmikroskop für eine Woche.
    4. Optimieren Sie verschiedene Kristallisationsbedingungen durch Variieren des pH-Werts ( dh, PH 5,5-6,8) von 0,1 M Kacodylat und durch Veränderung der Salzkonzentration ( dh 0,9-1,2 M) Natriumcitrat , um Singularkristalle zu erhalten. Überwachen Sie das Kristallwachstum für 1 Woche und sammeln Sie Röntgenbeugungsdaten 12 .

3. Charakterisierung der Nucleosid Triphosphatase (NTPase) Aktivität von rBC1531

  1. Validierung der anorganischen Phosphat-abhängigen kolorimetrischen Studie
    1. Bereiten Sie einen Vorrat an Pyrophosphat (100 mM) vor und verdünnen Sie es auf Endkonzentrationen von 0,1, 0,25, 0,5, 1,0, 5,0, 10, 50, 100 und 250 & mgr; M in 200 & mgr; l Reaktionspuffer (20 mM HEPES, pH 7,4; MM NaCl und 2 mM MgCl & sub2 ; ) in doppelten 96-Well-Platten. Benutze die erste Platte als Kontrolle (dies enthält keine Pyrophosphatase). Stellen Sie sicher, dass die zweite Platte Pyrophosphatase als Arbeitsplatte enthält, wie in Schritt 3.1.2 beschrieben.
    2. Add 0.01 Einheit von Saccharomyces cerevisiae anorganischen pYrophosphatase (1 & mgr; l) zu den Vertiefungen der Arbeitsplatte gegeben und bei 20 ° C für 30-60 min inkubiert.
    3. Vorbereitung der Molybdatsäurelösung durch Mischen von Ammoniummolybdat (0,86% v / v) und Ascorbinsäure (14% v / v) Lösungen im Verhältnis 7: 3. Füge 16 μl Molybddsäurelösung sowohl den Arbeits- als auch den Kontrollvertiefungen zu und warte 15 min.
    4. Lesen Sie die optische Dichte bei 690 nm (OD 690nm ).
  2. Farbmetrischer NTPase-Assay
    1. Vorbereiten eines Materials von 100 mM Nukleosidtriphosphat (NTP) -Substrat und Verdünnen auf die gewünschte Konzentration ( z. B. 0, 0,2, 4,4, 11, 22, 44, 88 oder 132 & mgr; M) in 180 & mgr; l Assaypuffer (20 mM HEPES, PH 7,4, 150 mM NaCl und 2 mM MgCl 2 ).
    2. Fügen Sie 20 μg rBC1531 (1,5 mM) und die NTP-Substrate aus Schritt 3.2.1 bis zu 200 μL pro Reaktion in einer 96-Well-Platte hinzu und pipettieren Sie nach oben und unten, um gut zu mischen. Decken Sie die Platte mit dem Deckel ab und legen Sie sie in einen 37 ° C Inkubator für 30 minUm die Substrathydrolysereaktion durchzuführen.
    3. Übertragen Sie die Platte auf ein 70 ° C Wasserbad und lassen Sie für 15 min stehen, um rBC1531-vermittelte katalytische Reaktionen zu stoppen.
    4. Füge 0,01 Einheiten von S. cerevisiae anorganische Pyrophosphatase (1 μL) zu jeder Vertiefung der Reaktionsplatte (aus Schritt 3.2.3) hinzu und inkubiere bei 20 ° C für 30 min. Füge 16 μl Molybddsäurelösung zur Reaktionsplatte hinzu, um die Farbe zu entwickeln (~ 15 min). Lesen Sie bei OD 690nm .
    5. Analysieren mit der Michaelis-Menten-Gleichung, wie beschrieben 12 .

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Die Charakterisierung des Proteins von Interesse in dieser Studie begann mit der Herstellung einer ausreichenden Menge an rekombinantem B. cereus bc1531 (rBC1531) Protein, vorzugsweise mehr als mehrere Milligramm. Das DNA-Fragment, das für das BC1531-Protein kodiert, wurde durch PCR unter Verwendung der genomischen DNA von B. cereus als Matrize hergestellt, da es orthologe Gene enthält, die mit ba1554 identisch sind . RBC1531 wurde als lösliches Protein in E. coli- Zellen überexprimiert. Das rBC1531-Protein wurde mit einem 6x-Histidin-Tag und einer Thrombin-Spaltstelle an seinem N-Terminus 12 exprimiert. Als erster Schritt der Reinigung wurde rBC1531 durch Nickel-Affinitätschromatographie ( Fig. 1A ) gereinigt. Als nächstes wurde eine Thrombinverdauungsstudie durchgeführt, um die niedrigste Menge an Thrombin zu bestimmen, die für die vollständige Verdauung der Affinitätsmarkierung von rBC1531 erforderlich war ( 1A ). In unseren Händen waren 0,3 Einheiten Thrombin sufUm das Affinitäts-Tag von rBC1531 vollständig zu entfernen. So wurden bei der Skalierung 10 mg rBC1531 mit 60 Einheiten Thrombin zur Markierungsentfernung behandelt. Nach der Thrombinverdauung wurde das tagfreie rBC1531 auf eine SEC-Säule aufgetragen, um alle löslichen Aggregate und höher- oder niedermolekularen Verunreinigungen zu entfernen. Die rBC1531-Fraktionen wurden durch SDS-PAGE analysiert, deren Ergebnisse darauf hindeuteten, dass rBC1531 ~ 99% rein war (Abbildung 1A ). Insgesamt ergab 1 L der Kultur ~ 8 mg rBC1531-Protein.

Um den oligomeren Status von rBC1531 abzuschätzen, wurde SEC durchgeführt. Eine lineare Standardkurve, die den logarithmischen Wert der Molekulargewichte der Proben mit ihren entsprechenden Elutionsvolumina korreliert, wurde unter Verwendung der Peaks der Proteinstandards aufgetragen (Abbildung 1B ). RBC1531 wurde mit einem Elutionsvolumen von ~ 84 ml eluiert, und sein scheinbares Molekulargewicht wurde als ~ 55 kDa geschätzt. Angesichts der Tatsache, dass die berechneten molekularen wirIght des rBC1531-Monomers ist ~ 13 kDa, diese Ergebnisse zeigen, dass rBC1531 als Tetramer zusammensetzt.

Gereinigtes rBC1531 wurde zur Kristallisation unter Verwendung von ~ 400 Bedingungen in einem Sitzen-Dampf-Diffusionsverfahren gescreent. Die RBC1531-Kristalle erschienen in zwei Tagen bei zwei Bedingungen: Bedingung-A, 0,1 M Natriumcitrat (pH 5,5) und 20% PEG 3000 ( 2A ) und Bedingung-B, 0,1 M Natriumcacodylat (pH 6,5) und 1,0 M Natrium Citrat ( Fig. 2B ). Die Kristallisationsbedingungen wurden durch Variieren des pH-Werts (0,1 M Natriumcitrat, pH 5,0-6,0) und der Konzentration von PEG 3000 (18-21% PEG 3000) aus der Bedingung -A und durch Modifizieren des pH-Werts (0,1 M Natriumcacodylat, pH-Wert) optimiert 5,5-6,8) und Salzkonzentration (0,9-1,2 M Natriumcitrat) aus der Bedingung-B. Beugungsfähige Kristalle wurden nur für die Bedingung -B erhalten, während die Kristalle aus der Bedingung -A dazu neigten, eher zusammengewachsen als einzeln zu sein. Condition-B-KristalleGebeugten Röntgenstrahlen auf eine Auflösung von 2,74 Å (Abbildung 2C ) und wurden für die RBC1531-Strukturbestimmung verwendet.

Die Beobachtung einer konservierten MazG-Domäne in der BA1554-Proteinsequenz zeigte die Anwesenheit von NTPase-Aktivität an, die in der Lage war, NTPs zu hydrolysieren. Die NTP-Hydrolyse liefert im allgemeinen Nucleosid-Diphosphat (NDP) und anorganisches Phosphat (Pi) oder Nukleosidmonophosphat (NMP) und Pyrophosphat (PPi). PPi erfordert zusätzliche Pyrophosphatase-Aktivität, um Pi zu ergeben. Pi-Werte können direkt mit Molybdat gemessen werden, das einen blau gefärbten Komplex mit Pi (Molybdat-Pi) bildet, der mit der optischen Dichte bei einer Wellenlänge von 690 nm (OD 690 nm) überwacht werden kann ( Abbildung 3A ). In unserer Studie wurde nach der NTP-Hydrolyse durch rBC1531 nach der Zugabe von Molybdat keine sichtbare blaue Farbe erzeugt (Abbildung 3B ). Wenn jedoch Pyrophosphatase der rBC1531-vermittelten NTP-Hydrolyse r zugesetzt wurdeEaction, die Farbe wechselte zu tiefblau (Abbildung 3B ), was anzeigt, dass rBC1531 NTP-Pyrophosphohydrolase-Aktivität hat. Eine Auftragung der OD 690nm- und NTP-Konzentration wurde unter Verwendung eines nichtlinearen Regressionsverfahrens analysiert, um die kinetischen Parameter (V max von 0,75 und K m von 10 & mgr; M) für das rBC1531-Enzym zu bestimmen ( 3C ).

Abbildung 1
Abbildung 1: SDS-PAGE und Größenausschluss-Chromatographie (SEC) -Analyse. ( A ) SDS-PAGE-Analyse von rBC1531. (Links) Die rBC1531-Elutionsspitzen von der Nickel-Affinitätschromatographie (Spur 2, Ni) und SEC (Spur 3) wurden zusammen mit Proteinstandards (Spur 1, markiert in kDa) analysiert. (Rechts) Analyse der Thrombinverdauung von rBC1531 zur Entfernung der Affinitätsmarke Die Mengen an Thrombin, die zu 50 μg rBC1531 in verschiedenen Reaktionen zugegeben wurden, sind indIn Einheiten über dem Gel angegeben. ( B ) Größen-Ausschluss-Chromatographie (SEC) -Analyse von rBC1531 und die Protein-Standards. (Links) Elutionsprofile von rBC1531 (blau) und Normen (rot). Die Molekulargewichte der Standardproteine ​​sind oberhalb jeder Spitze in kDa dargestellt. Die vertikalen (y) und horizontalen (x) Achsen zeigen die Milli-Absorptionseinheiten (mAU bei 280 nm) bzw. die Retentionsvolumina (mL). (Rechts) Die scheinbare molekulare Größe von rBC1531 wurde unter Verwendung eines linearen Plots für die Molekulargewichte, im Log-Maßstab und Elutionsvolumina von Proteinstandards (R 2 = 0,9934) geschätzt. Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

Figur 2
Abbildung 2: Kristallisation und Röntgenbeugung ( A ) rBC1531 Kristalle in KonditionOn-A, 0,1 M Natriumcitrat (pH 5,5) und 20% PEG 3000. ( B ) rBC1531-Kristalle im Zustand-B, 0,1 M Natriumcacodylat (pH 6,5) und 1,0 M Natriumcitrat. Anfängliche (links) und optimierte (mittlere und rechte) Kristalle werden gezeigt. Für die Röntgenbeugung wurde der optimierte rBC1531-Kristall (rechts, ~ 0,35 mm x ~ 0,35 mm x ~ 0,20 mm) verwendet. Maßstäbe = 100 μm. ( C ) Röntgenbeugungsbild des an der PAL-Strahllinie BL-7A 12 erhaltenen rBC1531-Kristalls. Der Pfeil zeigt einen hochauflösenden Punkt an. Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

Abbildung 3
Abbildung 3: NTPase-Aktivität ( A ) Die Bildung des Molybdän-Pi-Komplexes ist abhängig von der Pi-Konzentration. Die optische Dichte bei 690 nm ist diDirekt mit einer Zunahme der Pi-Werte verbunden. Die Y-Achse und die X-Achse repräsentieren die OD 690nm und die Konzentration (μM) von Pi. ( B ) Farbänderungen bei der Zugabe von Pyrophosphatase. In der ersten Reihe von Vertiefungen wurde keine Pyrophosphatase zugegeben und bildete nicht den blau gefärbten Pi-Komplex. Allerdings besteht die zweite Reihe aus Vertiefungen, in denen die rBC1531-NTP-Reaktionen mit Pyrophosphatase behandelt wurden und eine blaue Farbe entwickelt hatten. OD 690nm- Werte erhöhten sich mit einem Anstieg der NTP-Konzentrationen. ( C ) Michaelis-Menten-Plot der rBC1531-NTP-Reaktionen. Die Y-Achse und die X-Achse repräsentieren die OD 690nm und die Konzentration (0-120 μM) der NTP-Substrate. Die Fehlerbalken stellen die Standardabweichung für drei getrennte Experimente dar. Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren haben nichts zu offenbaren.

Acknowledgments

Die Röntgenbeugungsdatensätze wurden an der Strahllinie 7A des Pohang Accelerator Laboratory (Korea) gesammelt. Diese Studie wurde unterstützt durch die Basic Science Research-Programm durch die National Research Foundation von Korea (NRF), finanziert durch das Ministerium für Wissenschaft, ICT & Future Planning (2015R1A1A01057574 bis MH) verwaltet.

Materials

Name Company Catalog Number Comments
Bacillus cereus ATCC14579 Korean Collection for Tissue Culture 3624
Genomic DNA prep kit GeneAll 106-101 Genomic DNA preparation
Forward primer Macrogen GAAGGATCCGGAAGCAAAAA
CGATGAAAGATATGCA
BamHI site is underlined
Reverse primer Macrogen CTTGTCGACTTATTCTTTCTCT
CCCTCATCAATACGTG
SalI site is underlined
nPfu-Forte Enzynomics P410 PCR polymerase
BamHI Enzynomics R003S
SalI Enzynomics R009S
pET49b expression vector Novagen 71463 Expression vector was modified to add affinity tags and BamHI/SalI sites10
T4 DNA ligase Enzynomics M001S
Dialysis memebrane Thermofisher 18265017
Dry block heater JSR JSBL-02T
LB broth (Luria-Bertani) LPS solution LB-05
LB Agar, Miller (Luria-Bertani) Becton, Dickinson and Company
Kanamycin LPS solution KAN025
Mini-prep kit Favorgen FAPDE300 Plasmid DNA preparation
BL21(DE3) Competent cell Novagen 69450-3CN
Isopropyl β-D-1-thiogalactopyranoside (IPTG) Fisher BioReagents 50-213-378
Sodium chloride Daejung 7548-4100 PBS material
Potassium chloride Daejung 6566-4405 PBS material
Potassium phosphate Bio Basic Inc PB0445 PBS material
Sodium phosphate Bio Basic Inc S0404 PBS material
Imidazole Bio Basic Inc IB0277
Sonicator Sonics VCX 130
Ni-NTA agaros Qiagen 30210 Nickel bead
Rotator Finepcr AG
Precision Plus Protein Dual Color Standards Bio-rad 1610374 SDS-PAGE protein standard
Coonmassie Brilliant Blue R-250 Fisher BioReagents BP101-25 Coomassie staining solution
Methyl alcohol Samchun chemical M0585 Coomassie staining solution
Acetic acid Daejung 1002-4105 Coomassie staining solution
Dialysis memebrane Thermofisher 68035
2-Mercaptoethanol Sigma-aldrich M6250
Thrombin Merckmillipore 605157-1KUCN Prepare aliquots of 20 μL (1 Unit per μL) and store at 70 °C and thaw before use
Superdex 200 16/600 General Electric 28989335 Size exclusion chromatography
Gel filtration standard Bio-rad 151-1901
Centrifugal filter Amicon UFC800396
Crystralization plates Hampton research HR3-083 96-well sitting drop plate
The JCSG core suite I-IV Qiagen 130924-130927 Crystallization secreening solution
Microscope Nikon SMZ745T
Cryschem plates Hampton research HR3-158 24-well sitting drop plate
Inorganic pyrophosphatase Sigma 10108987001
Ammonium molybdate solution Sigma 13106-76-8
L-ascorbic acid Sigma 50-81-7
NTP substrate Startagene 200415-51
Spectrophotometer Biotek SynergyH1 microplate reader
GraphPad Prism 5 GraphPad Prism 5 for Window

DOWNLOAD MATERIALS LIST

References

  1. Ivanova, N., et al. Genome sequence of Bacillus cereus and comparative analysis with Bacillus anthracis. Nature. 423, 87-91 (2003).
  2. Spencer, R. C. Bacillus anthracis. J Clin Pathol. 56, 182-187 (2003).
  3. Deli, A., et al. LmbE proteins from Bacillus cereus are de-N-acetylases with broad substrate specificity and are highly similar to proteins in Bacillus anthracis. FEBS J. 277, 2740-2753 (2010).
  4. Gross, M., Marianovsky, I., Glaser, G. MazG -- a regulator of programmed cell death in Escherichia coli. Mol Microbiol. 59, 590-601 (2006).
  5. Galperin, M. Y., Moroz, O. V., Wilson, K. S., Murzin, A. G. House cleaning, a part of good housekeeping. Mol Microbiol. 59, 5-19 (2006).
  6. Lee, S., et al. Crystal structure of Escherichia coli MazG, the regulator of nutritional stress response. J Biol Chem. 283, 15232-15240 (2008).
  7. Moroz, O. V., et al. Dimeric dUTPases, HisE, and MazG belong to a new superfamily of all-alpha NTP pyrophosphohydrolases with potential "house-cleaning" functions. J Mol Biol. 347, 243-255 (2005).
  8. Robinson, A., et al. A putative house-cleaning enzyme encoded within an integron array: 1.8 A crystal structure defines a new MazG subtype. Mol Microbiol. 66, 610-621 (2007).
  9. Moroz, O. V., et al. The crystal structure of a complex of Campylobacter jejuni dUTPase with substrate analogue sheds light on the mechanism and suggests the "basic module" for dimeric d(C/U)TPases. J Mol Biol. 342, 1583-1597 (2004).
  10. Green, M., Sambrook, J. Molecular cloning: A laboratory Manual. 1, John Inglis. (2012).
  11. Brown, T. A. Gene cloning an introduction. Chapman & Hall. (1986).
  12. Kim, M. I., Hong, M. Crystal structure of the Bacillus-conserved MazG protein, a nucleotide pyrophosphohydrolase. Biochem Biophys Res Commun. 472, 237-242 (2016).
  13. Sheehan, D. Physical biochemistry: Principles and applications. A John Wiley & Sons. (2009).
  14. Lesley, S. A., Wilson, I. A. Protein production and crystallization at the joint center for structural genomics. J Struct Funct Genomics. 6, 71-79 (2005).
  15. Jeon, Y. J., et al. Structural and biochemical characterization of bacterial YpgQ protein reveals a metal-dependent nucleotide pyrophosphohydrolase. J Struct Biol. 195, 113-122 (2016).
Rekombinante Protein Expression, Kristallisation und biophysikalische Studien von a<em&gt; Bacillus</em&gt; -konservierte Nucleotid-Pyrophosphorylase, BcMazG
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Kim, M. I., Lee, C., Hong, M. Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG. J. Vis. Exp. (123), e55576, doi:10.3791/55576 (2017).More

Kim, M. I., Lee, C., Hong, M. Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG. J. Vis. Exp. (123), e55576, doi:10.3791/55576 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter