Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biochemistry

Espressione proteica ricombinante, cristallizzazione e studi biofisici di a doi: 10.3791/55576 Published: May 16, 2017

Summary

Bacillus anthracis è il patogeno obbligato di antrace fatale inalatorio, per cui studi di geni e proteine ​​sono strettamente regolamentati. Un approccio alternativo è quello di studiare geni ortologi. Descriviamo studi biofisicochimici di un B. ortologo di B. anthracis in B. cereus , bc1531, che richiede una minima quantità di apparecchiature sperimentali e mancano gravi preoccupazioni di sicurezza.

Abstract

Per superare le restrizioni e le normative di sicurezza nello studio di geni e proteine ​​da veri agenti patogeni, è possibile studiare i loro omologhi. Bacillus anthracis è un patogeno obbligato che provoca l'antrace fatale inalatorio. Bacillus cereus è considerato un utile modello per studiare B. anthracis a causa della sua stretta correlazione evolutiva. Il cluster gene ba1554 - ba1558 di B. anthracis è altamente conservato con il cluster bc1531 - bc1535 in B. cereus , così come con il cluster bt1364 - bt1368 in Bacillus thuringiensis, indicando il ruolo critico dei geni associati nel genere Bacillus . Questo manoscritto descrive metodi per preparare e caratterizzare un prodotto proteico del primo gene ( ba1554 ) dal cluster di gene in B. anthracis utilizzando una proteina ricombinante del suo ortologo in B. cereus , bc1531.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

L'espressione della proteina ricombinante è ampiamente utilizzata per superare i problemi associati a fonti di proteine ​​naturali, quali limitate quantità di proteine ​​e contaminazioni nocive. Inoltre, negli studi sui geni patogeni e sulle proteine, può essere utilizzato un ceppo di laboratorio alternativo che non richiede ulteriori precauzioni di sicurezza. Ad esempio, Bacillus cereus è un modello utile per studiare Bacillus anthracis a causa della loro stretta relazione evolutiva 1 .

B. anthracis è un patogeno obbligatorio che provoca l'antrace fatale per via inalatoria negli esseri umani e nel bestiame e può essere potenzialmente utilizzato come bioweapon 2 . Pertanto, gli studi di laboratorio su B. anthracis sono strettamente disciplinati dai centri statunitensi per il controllo delle malattie, che richiedono pratiche di livello di biosicurezza 3 (BSL-3), che prevedono che l'area di laboratorio sia segregata con una pressione negativa della stanza. A differenza di B. anthracis B. cereus è classificato come agente BSL-1 e quindi ha minime preoccupazioni di sicurezza. B. cereus è un patogeno opportunistico che, dopo l'infezione, provoca avvelenamenti alimentari che possono essere trattati senza assistenza medica. Tuttavia, poiché B. cereus condivide molti geni critici con B. anthracis , le funzioni delle proteine ​​di B. anthracis possono essere studiate utilizzando gli omologhi corrispondenti di B. cereus 1 .

Il cluster di gene ba1554 - ba1558 di B. anthracis è altamente conservato con il cluster bc1531 - bc1535 Di B. cereus , così come con il cluster bt1364-bt1368 di Bacillus thuringiensis , in termini di organizzazione e sequenza del gene. Inoltre, i primi geni ( ba1554 , bc1531 e bt1364 ) dei rispettivi cluster sono assolutamente conservati ( cioè l' identità della sequenza nucleotidica del 100%), implyiUn ruolo critico del prodotto genico nelle specie di Bacillus . A causa della sua collocazione in questi cluster di geni, ba1554 è stato erroneamente identificato come un regolatore di trascrizione supposto 3 . Tuttavia, l'analisi della sequenza di aminoacidi del prodotto ba1554 indica che appartiene alla famiglia MazG, che ha attività di pirofosfosforrolasi nucleotidica e non è associata all'attività del fattore di trascrizione 4 , 5 . Sebbene le proteine ​​appartenenti alla famiglia MazG siano diverse rispetto alla sequenza e alla lunghezza complessiva, condividono un dominio MazG con un residuo di 100 residui caratterizzato da un motivo EXXE 12-28 EXXD ("X" indica qualsiasi residuo di aminoacidi e il numero Indica il numero di residui X).

Il dominio MazG non sempre rappresenta direttamente una certa attività catalitica. Un membro MazG di Escherichia coli (EcMazG) possiede due domini MazG, ma suIl dominio C-terminale MazG è enzimaticamente attivo 6 . Inoltre, la specificità del substrato degli enzimi MazG varia da non-specifici nucleosid trifosfati (per EcMazG) a specifici dCTP / dATP (per MazG associati all'integrina) e dUTP (per dUTPasi) 6 , 7 , 8 , 9 . Pertanto, sono necessarie analisi biofisico-chimiche della proteina BA1554 per confermare l'attività NTPase e decifrare la sua specificità del substrato.

Qui forniamo un protocollo passo dopo passo che la maggior parte dei laboratori senza un impianto BSL-3 può seguire per caratterizzare il prodotto proteico del gene B. cereus bc1531 , che è un ortologo di B. anthracis ba1554 , a livello molecolare. Brevemente, il ricombinante BC1531 (rBC1531) è stato espresso in E. coli e purificato utilizzando un tag di affinità. Per gli esperimenti cristallografici a raggi X, i cristalliZione delle proteine ​​rBC1531 sono state proiettate e ottimizzate. Per valutare l'attività enzimatica del rBC1531, l'attività di NTPase è stata monitorata in modo colorimetrico per evitare nucleotidi etichettati radioattivamente che sono stati convenzionalmente utilizzati. Infine, le analisi dei dati biofisicochimici ottenuti ci hanno permesso di determinare lo stato di oligomerizzazione e i parametri catalitici di rBC1531, così come ottenere dati di diffrazione dei raggi X dal cristallo rBC1531.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Produzione e purificazione della proteina ricombinante di rBC1531

  1. Preparazione di un plasmide di espressione ricombinante BC1531 (rBC1531)
    1. Preparare il DNA genomico di B. cereus 10 .
    2. Amplificare il gene bc1531 da un template del DNA genomico B. cereus mediante reazione a catena polimerica (PCR), utilizzando primer avanti e indietro (vedi Elenco materiali) per creare siti di enzimi di restrizione Bam HI e Sal I rispettivamente 10 .
    3. Digestare il prodotto PCR e un vettore pET49b modificato (pET49bm) utilizzando Bam HI e Sal I, come descritto 11 .
    4. Mescolare il prodotto PCR digerito e il vettore (rapporto 3: 1) dal punto 1.1.3 utilizzando ligasi di T4 DNA in una reazione di 10 μL, come descritto 11 . Incubare a 18 ° C per 30 min.
    5. Pipettare 3 μL della reazione di legatura in 50 μL di chemicaLe cellule E. coli DH5α competenti in un tubo. Mescolare delicatamente pipettando su e giù e posto sul ghiaccio per 30 minuti. Scossa termica per 45 s a 42 ° C. Aggiungere 1 ml di mezzo Luria-Bertani (LB) e coltivare le cellule mentre si agita vigorosamente (250 rpm, 37 ° C, 45 min).
    6. Prendere 100 μL delle cellule trasformate dal punto 1.1.6 e spargerle sulle piastre LB-agar con 100 μg / mL kanamicina (Kan). Incubare per ~ 18 h a 37 ° C.
    7. Raccogliere le colonie utilizzando una punta sterile e coltivare le cellule in 3 ml di mezzo LB con 100 μg / mL Kan; Agitare energicamente (250 giri / min, 37 ° C, 18 h).
    8. Preparare il DNA del plasmide utilizzando un metodo di lisi alcalino-SDS, come descritto 10 .
    9. Confermare la sequenza nucleotidica del costrutto di espressione rBC1531 utilizzando il sequenziamento del DNA 12 .
  2. Sovrapressione della proteina rBC1531
    1. Ri-trasformare il ceppo E. coli BL21 (DE3) con rBC1531-expPlasmide di rase, come descritto nei passaggi 1.1.5-1.1.6, per sovraespressione.
    2. Selezionare una colonia e svilupparla in 10 ml di mezzo LB contenente 50 μg / mL Kan (LB + Kan); Agitare energicamente per 18 ore a 37 ° C.
    3. Inoculare 10 ml di coltura durante la notte in 1 L di LB + Kan media e crescere a 37 ° C fino a quando il OD 600 (densità ottica a 600 nm) raggiunge ~ 0,7.
    4. Immergere la coltura in acqua ghiacciata per ~ 15 min per raffreddare la temperatura a 18 ° C e aggiungere isopropil β-D-1-tiogalattopiranoside (IPTG) alla coltura a una concentrazione finale di 1 mM per l'espressione della proteina ricombinante. Crescere la coltura a 18 ° C per un ulteriore ~ ​​16-18 h.
  3. Purificazione di rBC1531
    1. Raccogliere le cellule per centrifugazione (5.000 xg, 4 ° C, 30 min). Scartare con attenzione il surnatante in modo da non disturbare le cellule. Riassemblare le cellule in 50 mL di soluzione salina tamponata fosfato (PBS) contenente 10 mM imidazolo.
    2. Lyse le cellule due volte per sonicazione su ghiaccio per evitare il sovratemperatura dei lisati delle cellule (tempo: 2 min 30 s; ciclo: 5 s; ciclo spento: 10 s; ampiezza: 38%).
    3. Eliminare il lisato cellulare per centrifugazione (~ 25.000 xg, 4 ° C, 30 min).
    4. Mescolare 3 mL di branelli di nichel e 60 mL di PBS contenente 10 mM imidazolo e portare a gravità il tampone supplementare per sistemare i branchi di nichel equilibrati in una colonna di vetro di cromatografia di 2,5 x 10 cm.
    5. Pipettare per trasferire il surnatante dal punto 1.3.3 alla colonna con branelli di nichel pre-equilibrati e incubare a 4 ° C per 2 ore su una ruota di filatura a bassa velocità (~ 20 rpm).
    6. Lasciare che il surnatante venga scaricato per gravità e lavare le colonne di nickel nella colonna tre volte con 100 ml di PBS contenente 10 mM imidazolo.
    7. Elute rBC1531 proteina applicando 4 x 5 ml di PBS contenente 250 mM imidazolo.
    8. Prendere 15 μL dell'eluzione dal punto 1.3.7 e farla funzionare sul 15% SDS-PAGE. Visualizzare le bande proteicheIl gel con colorazione blu di Coomassie 10 .
  4. Rimozione dei tag di affinità della proteina rBC1531 mediante proteolisi di trombina
    1. Pipettare le frazioni nel tubo di dialisi (peso molecolare tagliato: 3 kDa) e collocare il tubo in un bicchiere contenente 4 l di tampone compatibile a tamponi di tampone (20 mM HEPES, pH 7.4, 150 mM NaCl e 1,5 mM β-mercaptoetanolo) A 4 ° C per una notte.
    2. Pipettare le frazioni e trasferirle in un tubo conico.
    3. Misurare l'assorbanza a 280 nm e stimare la concentrazione proteica rBC1531, come descritto 13 .
    4. Prendere 50 μg di rBC1531 in un tubo da 0,5 ml e aggiungere varie quantità di trombina ( ossia 2, 1, 0,6 e 0,3 unità). Incubare le reazioni di rBC1531 e trombina a 20 ° C per ~ 3 h per determinare la minima quantità di trombina necessaria per eliminare il tag N-terminale di affinità.
    5. Eseguire le reazioni rBC1531 e trombina su un 15%SDS-PAGE e determinare la minima quantità di trombina ( ad esempio, 0,3 unità di trombina per 50 μg di rBC1531) che digerisce completamente il tag N-terminale di affinità e produce un tag senza rBC1531.
    6. Aggiungere 10 mg di proteina rBC1531 e 60 unità di trombina a un tubo da 15 mL e incubare a 20 ° C per circa 3 ore per la reazione di trombina-proteolisi.
    7. Applicare gli standard di filtrazione del gel a una colonna di cromatografia di esclusione (SEC) per preparare una curva standard dei pesi molecolari e dei volumi di eluizione, come descritto 13 .
    8. Posizionare la proteina rBC1531 digerita da trombina dal punto 1.4.6 in un tubo filtrante centrifugo (peso molecolare tagliato: 3 kDa) e centrifugare a 3.000 g a 4 ° C per ridurre a un volume inferiore a 5 ml.
    9. Applicare la proteina concentrata rBC1531 alla colonna SEC e raccogliere 60 frazioni eluite in 0,5 mL per tubo 13 .
    10. Prendere 15 μL di ciascuna frazione, eseguirli su una SDS-PAGE del 15% e staiN il gel utilizzando la soluzione di colorazione Coomassie (0,15% (w / v) blu brillante Coomassie, 40% (v / v) metanolo e 10% (v / v) acido acetico glaciale) come descritto 10 .
    11. Pipettate le frazioni che contengono rBC1531 e li raccolgono in un tubo.

2. Screening e ottimizzazione di cristallizzazione di rBC1531

  1. Condizioni di screening per la cristallizzazione della proteina rBC1531
    1. Concentrare il rBC1531 dal punto 1.4.11 fino a ~ 18,5 mg / mL utilizzando un tubo filtrante centrifugo, come descritto nel passaggio 1.4.8.
    2. Aggiungere 50 μL di ciascuna soluzione di screening di cristallizzazione (vedere la sezione 2.2) 14 ai pozzetti delle piastre di cristallizzazione a sedere a 96 pozzetti. Posizionare 0,5 μL della soluzione proteica rBC1531 da 18,5 mg / ml su un letto seduto. Mescolare la soluzione proteica con 0,5 μL della soluzione del pozzetto, ripetendo il processo per l'intera piastra.
    3. Coprire la piastra con una pellicola adesiva chiara.Posizionare le piastre a 96 pozzetti a 18 ° C e consentire la diffusione del vapore.
    4. Scansione delle gocce a ingrandimento 20-40X utilizzando un microscopio leggero per monitorare la formazione di cristallo ogni giorno per 2-3 settimane.
    5. Raccogliere i dati di diffrazione dei raggi X utilizzando i cristalli ottenuti con rBC1531 proteina.
  2. Ottimizzazione delle condizioni di cristallizzazione rBC1531
    1. Preparare 500 μl della soluzione di condizione di cristallizzazione iniziale selezionata ( es. 0,1 M sodio cacodilato, pH 6,5 e 1,0 M citrato di sodio) e riempire una piastra di cristallizzazione a 24 pozzetti per la caduta di seduta.
    2. Aggiungere 0,5 μL della soluzione proteica rBC1531 da 18,5 mg / ml a un letto seduto, mescolare con 0,5 μL della soluzione di pozzetto e coprire immediatamente la piastra con un film adesivo chiaro. Mettere la piastra a 18 ° C.
    3. Osservate la crescita del cristallo sotto un microscopio leggero per una settimana.
    4. Ottimizzare varie condizioni di cristallizzazione variando il pH ( es, PH 5,5-6,8) di 0,1 M cacodilato e modificando la concentrazione di sale ( cioè 0,9-1,2 M) di citrato di sodio per ottenere singoli cristalli. Monitorare la crescita del cristallo per ~ 1 settimana e raccogliere i dati di diffrazione dei raggi X 12 .

3. Caratterizzazione dell'attività di trifosfatasi nucleosidica (NTPase) di rBC1531

  1. Validazione dello studio colorimetrico inorganico fosfato-dipendente
    1. Preparare uno stadio di pirofosfato (100 mM) e diluire fino a concentrazioni finali di 0,1, 0,25, 0,5, 1,0, 5,0, 10, 50, 100 e 250 μM in 200 μl di tampone di reazione (20 mM HEPES, pH 7,4, 150 MM NaCl e 2 mM MgCl2) in duplicati a 96 pozzetti. Utilizzare la prima piastra come un controllo (questo non contiene pirofosfatasi). Assicurarsi che la seconda piastra contiene pirofosfatasi come piastra di lavoro, come indicato nella fase 3.1.2.
    2. Aggiungere 0,01 unità di Saccharomyces cerevisiae inorganico pYrofosfatasi (1 μL) ai pozzetti della piastra di lavoro e incubare a 20 ° C per 30-60 minuti.
    3. Preparare la soluzione di acido molibdato mescolando le soluzioni di molibdato di ammonio (0,86% v / v) e acido ascorbico (14% v / v) in un rapporto 7: 3. Aggiungere 16 μL di soluzione di acido molibdato a entrambi i pozzetti di lavoro e di controllo e attendere 15 min.
    4. Leggere la densità ottica a 690 nm (OD 690nm ).
  2. Analisi colorimetrica NTPase
    1. Preparare uno strato di substrato nucleosidico trifosfato (NTP) di 100 mM e diluire fino alla concentrazione desiderata ( es. 0, 0,2, 4,4,11,22,44,88, o 132 μM) in 180 μl di tampone di analisi (20 mM HEPES, PH 7,4, 150 mM NaCl e 2 mM MgCl2).
    2. Aggiungere 20 μg di rBC1531 (1,5 mM) e i substrati NTP dalla fase 3.2.1 fino a 200 μL per reazione in una piastra a 96 pozzetti e pipettare verso l'alto e verso il basso per mescolare bene. Coprire la piastra con il suo coperchio e posizionarla in un incubatore a 37 ° C per 30 minPer eseguire la reazione di idrolisi del substrato.
    3. Trasferire la piastra a un bagno d'acqua di 70 ° C e lasciare riposare per 15 minuti per fermare reazioni catalitiche mediate da rBC1531.
    4. Aggiungere ogni 0.01 unità di S. cerevisiae pirofosfatasi inorganica (1 μL) ad ogni pozzetto della piastra di reazione (dalla fase 3.2.3) e incubare a 20 ° C per 30 min. Aggiungere 16 μL di soluzione di acido molibdato alla piastra di reazione per sviluppare il colore (~ 15 min). Leggete a OD 690nm .
    5. Analizzare utilizzando l'equazione di Michaelis-Menten, come descritto 12 .

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

La caratterizzazione della proteina di interesse in questo studio è iniziata con la preparazione di una quantità sufficiente di proteina B. cereus bc1531 (rBC1531) ricombinante, preferibilmente più di alcuni milligrammi. Il frammento di DNA che codifica la proteina BC1531 è stato preparato mediante PCR utilizzando il DNA genomico di B. cereus come un template, in quanto contiene geni ortologi identici a ba1554 . RBC1531 è stato sovraespresso come una proteina solubile nelle cellule E. coli . La proteina rBC1531 è stata espressa con un tag 6x-Histidine e un sito di scissione trombina al suo N-terminale 12 . Come prima fase di purificazione, rBC1531 è stato purificato mediante cromatografia di affinità di nichel ( Figura 1A ). Successivamente, è stata eseguita una prova di digestione trombinica per determinare la minima quantità di trombina necessaria per la completa digestione del tag di affinità da rBC1531 ( Figura 1A ). Nelle nostre mani, 0,3 unità di trombina era sufFiciente per rimuovere completamente il tag di affinità da rBC1531. Così, durante la scalatura, 10 mg di rBC1531 è stato trattato con 60 unità di trombina per la rimozione di tag. Dopo la digestione della trombina, il rBC1531 senza tag è stato applicato ad una colonna SEC per rimuovere eventuali aggregati solubili e contaminanti a peso molecolare superiore o inferiore. Le frazioni di rBC1531 sono state analizzate mediante SDS-PAGE, i cui risultati suggerivano che il rBC1531 fosse ~ 99% puro ( Figura 1A ). Complessivamente, 1 litro di coltura ha prodotto ~ 8 mg di proteina rBC1531.

Per valutare lo stato oligomerico di rBC1531, è stata eseguita SEC. Una curva lineare standard che correla il valore di log dei pesi molecolari dei campioni con i loro corrispondenti volumi di eluizione è stata tracciata utilizzando i picchi degli standard proteici ( Figura 1B ). RBC1531 è stato eluso ad un volume di eluizione di ~ 84 mL e il suo apparente peso molecolare è stato stimato a ~ 55 kDa. Dato che la molecola calcolata noiLa forza del monomer rBC1531 è ~ 13 kDa, questi risultati indicano che rBC1531 si associa come tetramer.

Purificato rBC1531 è stato sottoposto a screening per la cristallizzazione usando ~ 400 condizioni in un metodo di diffusione del vapore a goccia-goccia. I cristalli rBC1531 sono risultati in ~ 2 giorni in due condizioni: condizione A, 0,1 M citrato di sodio (pH 5,5) e 20% PEG 3000 ( Figura 2A ) e condizione B, 0,1 M sodio cacodilato (pH 6,5) e 1,0 M sodio Citrato ( figura 2B ). Le condizioni di cristallizzazione sono state ottimizzate variando il pH (0,1 M citrato di sodio, pH 5,0-6,0) e la concentrazione di PEG 3000 (18-21% PEG 3000) dalla condizione-A e modificando il pH (0,1 M sodio cacodilato, pH 5.5-6.8) e la concentrazione di sale (0.9-1.2 M citrato di sodio) dalla condizione-B. I cristalli adatti alla diffrazione sono stati ottenuti solo per la condizione-B, mentre i cristalli della condizione-A tendevano ad essere inter-coltivati ​​piuttosto che singolari. Cristalli della condizione-BI raggi X diffrattati ad una risoluzione di 2,74 Å ( figura 2C ) e sono stati utilizzati per la determinazione della struttura rBC1531.

L'osservazione di un dominio MazG conservato nella sequenza proteica BA1554 ha suggerito la presenza di attività NTPase capace di idrolizzare NTPs. L'idrolisi del NTP produce generalmente nucleoside difosfato (NDP) e fosfato inorganico (Pi), o nucleoside monofosfato (NMP) e pirofosfato (PPi). PPi richiede un'attività aggiuntiva di pirofosfatasi per produrre Pi. I livelli di Pi possono essere misurati direttamente utilizzando il molibdato, che forma un complesso blu con Pi (molibdato-Pi) che può essere monitorato utilizzando la densità ottica a una lunghezza d'onda di 690 nm (OD 690nm ) ( Figura 3A ). Nel nostro studio, dopo l'idrolisi di NTP da rBC1531, nessun colore blu visibile è stato prodotto dopo l'aggiunta di molibdato ( Figura 3B ). Tuttavia, quando la pirofosfatasi è stata aggiunta all'idrolisi NTP rBC1531-mediataLa colorazione è cambiata in azzurro intenso ( Figura 3B ), indicando che rBC1531 ha attività di pirofosfoidroloca NTP. Un diagramma di concentrazione di OD 690nm e NTP è stato analizzato utilizzando un metodo di regressione non lineare per determinare i parametri cinetici (V max di 0,75 e K m di 10 μM) per l'enzima rBC1531 ( Figura 3C ).

Figura 1
Figura 1: analisi SDS-PAGE e cromatografia di esclusione di dimensioni (SEC). ( A ) analisi SDS-PAGE di rBC1531. (Left) I picchi di eluizione rBC1531 dalla cromatografia di affinità di nichel (corsia 2, Ni) e SEC (corsia 3) sono stati analizzati insieme a standard proteici (corsia 1, etichettati in kDa). (Destra) Analisi della digestione trombinica di rBC1531 per la rimozione del tag affinità. Le quantità di trombina aggiunta a 50 μg di rBC1531 in diverse reazioni sono indIn unità sopra il gel. ( B ) Analisi di cromatografia di dimensioni-esclusione (SEC) di rBC1531 e delle norme proteiche. (Sinistra) Profili di eluzione di rBC1531 (blu) e standard (rosso). I pesi molecolari delle proteine ​​standard sono mostrati sopra ogni picco, in kDa. Gli assi verticali (y) e orizzontali (x) mostrano rispettivamente le unità di milli-assorbimento (mAU a 280 nm) e i volumi di ritenzione (mL). (Destra) La dimensione molecolare apparente di rBC1531 è stata stimata utilizzando una trama lineare per i pesi molecolari, nella scala dei log e nei volumi di eluizione di standard proteici (R 2 = 0.9934). Clicca qui per visualizzare una versione più grande di questa figura.

figura 2
Figura 2: Cristallizzazione e diffrazione del raggio X. ( A ) cristalli rBC1531 in conditi(PH 5,5) e 20% PEG 3000. ( B ) i cristalli rBC1531 in condizione-B, 0,1 m di sodio cacodilato (pH 6,5) e 1,0 m di sodio citrato. Sono mostrati i cristalli iniziali (sinistro) e ottimizzati (medio e destro). Il cristallo rBC1531 ottimizzato (a destra, ~ 0,35 mm x ~ 0,35 mm x ~ 0,20 mm) è stato utilizzato per la diffrazione dei raggi X. Barre scala = 100 μm. ( C ) immagine di diffrazione del raggio del cristallo rBC1531 ottenuta sul PAL beamline BL-7A 12 . La freccia indica un punto ad alta risoluzione. Clicca qui per visualizzare una versione più grande di questa figura.

Figura 3
Figura 3: attività NTPase. ( A ) La formazione del complesso molibdeno-Pi dipende dalla concentrazione di Pi. La densità ottica a 690 nm è diDirettamente associata all'aumento dei livelli di Pi. L'asse Y e l'asse X rappresentano rispettivamente OD 690nm e concentrazione (μM) di Pi. ( B ) Il colore cambia dopo l'aggiunta di pirofosfatasi. Nella prima fila di pozzi non è stata aggiunta la pirofosfatasi e non ha formato il complesso pi-blu colorato. Tuttavia, la seconda fila è costituita da pozzetti in cui le reazioni rBC1531-NTP sono state trattate con pirofosfatasi e hanno sviluppato un colore blu. I valori di OD 690nm aumentano con l'aumento delle concentrazioni di NTP. ( C ) Michaelis-Menten trama delle reazioni rBC1531-NTP. L'asse Y e l'asse X rappresentano rispettivamente OD 690nm e concentrazione (0-120 μM) di substrati NTP. Le barre di errore rappresentano la deviazione standard per tre esperimenti separati. Clicca qui per visualizzare una versione più grande di questa figura.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Gli autori non hanno niente da rivelare.

Acknowledgments

I set di dati di diffrazione dei raggi X sono stati raccolti nel beamline 7A del laboratorio Accelerator Pohang (Corea). Questo studio è stato sostenuto dal programma di ricerca scientifica di base amministrato dalla Fondazione Nazionale di Ricerca della Corea (NRF), finanziato dal Ministero della Scienza, ICT e pianificazione futura (2015R1A1A01057574 a MH).

Materials

Name Company Catalog Number Comments
Bacillus cereus ATCC14579 Korean Collection for Tissue Culture 3624
Genomic DNA prep kit GeneAll 106-101 Genomic DNA preparation
Forward primer Macrogen GAAGGATCCGGAAGCAAAAA
CGATGAAAGATATGCA
BamHI site is underlined
Reverse primer Macrogen CTTGTCGACTTATTCTTTCTCT
CCCTCATCAATACGTG
SalI site is underlined
nPfu-Forte Enzynomics P410 PCR polymerase
BamHI Enzynomics R003S
SalI Enzynomics R009S
pET49b expression vector Novagen 71463 Expression vector was modified to add affinity tags and BamHI/SalI sites10
T4 DNA ligase Enzynomics M001S
Dialysis memebrane Thermofisher 18265017
Dry block heater JSR JSBL-02T
LB broth (Luria-Bertani) LPS solution LB-05
LB Agar, Miller (Luria-Bertani) Becton, Dickinson and Company
Kanamycin LPS solution KAN025
Mini-prep kit Favorgen FAPDE300 Plasmid DNA preparation
BL21(DE3) Competent cell Novagen 69450-3CN
Isopropyl β-D-1-thiogalactopyranoside (IPTG) Fisher BioReagents 50-213-378
Sodium chloride Daejung 7548-4100 PBS material
Potassium chloride Daejung 6566-4405 PBS material
Potassium phosphate Bio Basic Inc PB0445 PBS material
Sodium phosphate Bio Basic Inc S0404 PBS material
Imidazole Bio Basic Inc IB0277
Sonicator Sonics VCX 130
Ni-NTA agaros Qiagen 30210 Nickel bead
Rotator Finepcr AG
Precision Plus Protein Dual Color Standards Bio-rad 1610374 SDS-PAGE protein standard
Coonmassie Brilliant Blue R-250 Fisher BioReagents BP101-25 Coomassie staining solution
Methyl alcohol Samchun chemical M0585 Coomassie staining solution
Acetic acid Daejung 1002-4105 Coomassie staining solution
Dialysis memebrane Thermofisher 68035
2-Mercaptoethanol Sigma-aldrich M6250
Thrombin Merckmillipore 605157-1KUCN Prepare aliquots of 20 μL (1 Unit per μL) and store at 70 °C and thaw before use
Superdex 200 16/600 General Electric 28989335 Size exclusion chromatography
Gel filtration standard Bio-rad 151-1901
Centrifugal filter Amicon UFC800396
Crystralization plates Hampton research HR3-083 96-well sitting drop plate
The JCSG core suite I-IV Qiagen 130924-130927 Crystallization secreening solution
Microscope Nikon SMZ745T
Cryschem plates Hampton research HR3-158 24-well sitting drop plate
Inorganic pyrophosphatase Sigma 10108987001
Ammonium molybdate solution Sigma 13106-76-8
L-ascorbic acid Sigma 50-81-7
NTP substrate Startagene 200415-51
Spectrophotometer Biotek SynergyH1 microplate reader
GraphPad Prism 5 GraphPad Prism 5 for Window

DOWNLOAD MATERIALS LIST

References

  1. Ivanova, N., et al. Genome sequence of Bacillus cereus and comparative analysis with Bacillus anthracis. Nature. 423, 87-91 (2003).
  2. Spencer, R. C. Bacillus anthracis. J Clin Pathol. 56, 182-187 (2003).
  3. Deli, A., et al. LmbE proteins from Bacillus cereus are de-N-acetylases with broad substrate specificity and are highly similar to proteins in Bacillus anthracis. FEBS J. 277, 2740-2753 (2010).
  4. Gross, M., Marianovsky, I., Glaser, G. MazG -- a regulator of programmed cell death in Escherichia coli. Mol Microbiol. 59, 590-601 (2006).
  5. Galperin, M. Y., Moroz, O. V., Wilson, K. S., Murzin, A. G. House cleaning, a part of good housekeeping. Mol Microbiol. 59, 5-19 (2006).
  6. Lee, S., et al. Crystal structure of Escherichia coli MazG, the regulator of nutritional stress response. J Biol Chem. 283, 15232-15240 (2008).
  7. Moroz, O. V., et al. Dimeric dUTPases, HisE, and MazG belong to a new superfamily of all-alpha NTP pyrophosphohydrolases with potential "house-cleaning" functions. J Mol Biol. 347, 243-255 (2005).
  8. Robinson, A., et al. A putative house-cleaning enzyme encoded within an integron array: 1.8 A crystal structure defines a new MazG subtype. Mol Microbiol. 66, 610-621 (2007).
  9. Moroz, O. V., et al. The crystal structure of a complex of Campylobacter jejuni dUTPase with substrate analogue sheds light on the mechanism and suggests the "basic module" for dimeric d(C/U)TPases. J Mol Biol. 342, 1583-1597 (2004).
  10. Green, M., Sambrook, J. Molecular cloning: A laboratory Manual. 1, John Inglis. (2012).
  11. Brown, T. A. Gene cloning an introduction. Chapman & Hall. (1986).
  12. Kim, M. I., Hong, M. Crystal structure of the Bacillus-conserved MazG protein, a nucleotide pyrophosphohydrolase. Biochem Biophys Res Commun. 472, 237-242 (2016).
  13. Sheehan, D. Physical biochemistry: Principles and applications. A John Wiley & Sons. (2009).
  14. Lesley, S. A., Wilson, I. A. Protein production and crystallization at the joint center for structural genomics. J Struct Funct Genomics. 6, 71-79 (2005).
  15. Jeon, Y. J., et al. Structural and biochemical characterization of bacterial YpgQ protein reveals a metal-dependent nucleotide pyrophosphohydrolase. J Struct Biol. 195, 113-122 (2016).
Espressione proteica ricombinante, cristallizzazione e studi biofisici di a<em&gt; Bacillus</em&gt; -conservato nucleotide pirofosforilasi, BcMazG
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Kim, M. I., Lee, C., Hong, M. Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG. J. Vis. Exp. (123), e55576, doi:10.3791/55576 (2017).More

Kim, M. I., Lee, C., Hong, M. Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG. J. Vis. Exp. (123), e55576, doi:10.3791/55576 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter