Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

दो पूरक सेल तुल्यकालन प्रोटोकॉल द्वारा सेल चक्र-विनियमित जीन अभिव्यक्ति का अध्ययन करना

doi: 10.3791/55745 Published: June 6, 2017
* These authors contributed equally

Summary

हम दो सेल तुल्यकालन प्रोटोकॉल की रिपोर्ट करते हैं जो सेल चक्र के विशिष्ट चरणों से संबंधित घटनाओं का अध्ययन करने के लिए संदर्भ प्रदान करते हैं। हम यह दिखाते हैं कि इस दृष्टिकोण में एक विशिष्ट तंत्रिका के विनियमन का विश्लेषण करने के लिए उपयोगी है, जो कि अघोषित सेल चक्र में या सेल चक्र को प्रभावित करने वाले एजेंटों के संपर्क में है।

Abstract

सेल चक्र की जीन अभिव्यक्ति कार्यक्रम सेल चक्र-निर्भर प्रक्रियाओं और कैंसर जैसी बीमारियों में उनकी भूमिका को समझने के लिए एक महत्वपूर्ण कदम का प्रतिनिधित्व करता है। सेल चक्र-विनियमित जीन अभिव्यक्ति विश्लेषण सेल सिंक्रनाइज़ेशन पर विशिष्ट चरणों में निर्भर करता है। यहां हम दो पूरक सिंक्रनाइज़ेशन प्रोटोकॉल का उपयोग करते हुए एक विधि का वर्णन करते हैं जो सामान्यतः सेल चक्र के दौरान जीन एक्सप्रेशन के आवधिक भिन्नता के अध्ययन के लिए उपयोग किया जाता है। दोनों प्रक्रियाएं एक परिभाषित बिंदु में सेल चक्र को अवरुद्ध रूप से अवरुद्ध करने पर आधारित हैं। हाइड्रोक्स्यूरिया (एचयू) के उपचार के द्वारा सिंक्रनाइज़ेशन प्रोटोकॉल, अंत में G1 / प्रारंभिक एस चरण में सेलुलर गिरफ्तारी की ओर जाता है, और एचयू-मध्यस्थता की गिरफ्तारी से रिहाई एक सेलुलर आबादी प्रदान करती है जो समान रूप से एस और जी 2 / एम के माध्यम से प्रगति कर रही है। थिइमिडीन और नोकोडाज़ोल (ते-एनओसी) के द्वारा सिंक्रनाइज़ेशन प्रोटोकॉल प्रारंभिक माइटोसिस में कोशिकाओं को ब्लॉक करता है, और तेरा-एनओसी मध्यस्थता से गिरफ्तारी से रिलीज जी 1 चरण और एस चरण एन के लिए उपयुक्त एक सिंक्रनाइज़ सेलुलर आबादी प्रदान करता हैअध्ययन की कोशिश करो दोनों प्रक्रियाओं के आवेदन के लिए सेल चक्र वितरण प्रोफाइल की निगरानी की आवश्यकता होती है, जिसे आम तौर पर कोशिकाओं के प्रोपिडियम आयोडाइड (पीआई) धुंधला होने और डीएनए सामग्री के प्रवाह कोशिकीमितीय-मध्यस्थता विश्लेषण के बाद किया जाता है। हम दिखाते हैं कि दो सिंक्रनाइज़ेशन प्रोटोकॉल का संयुक्त उपयोग सेल चक्र ( यानी ई 2 एफ 1 और ई 2 एफ 7) में भिन्न रूप से नियंत्रित जीन के ट्रांसक्रिप्शनल प्रोफाइल को स्पष्ट रूप से निर्धारित करने के लिए एक मजबूत दृष्टिकोण है, और परिणामस्वरूप सेल चक्र में उनकी भूमिका को बेहतर समझने के लिए प्रक्रियाओं। इसके अलावा, हम यह दिखाते हैं कि यह दृष्टिकोण दवा-आधारित चिकित्सा ( यानी मिटोमोसीन सी, एक एंटीकैंसर एजेंट) के अंतराल के तरीकों के अध्ययन के लिए उपयोगी है, क्योंकि यह उन जीनों को भेदभाव करने की अनुमति देता है जो केवल सेल चक्र संबंधी परेशानियों से प्रभावित जीनोटॉक्सिक एजेंट के प्रति संवेदनशील हैं एजेंट द्वारा लगाए गए

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

सेल चक्र के सभी चरणों में संक्रमण एक कसकर विनियमित जीन अभिव्यक्ति कार्यक्रम के साथ जुड़ा हुआ है। यह माना जाता है कि पूरे चक्र के दौरान जीन प्रतिलेखन के "चालू और बंद" जटिल ट्रांसक्रिप्शनल नियामक प्रणालियों के नियंत्रण के अधीन है, न केवल समय पर भी जीन अभिव्यक्ति के स्तर को नियंत्रित करता है। प्रमुख सेल चक्र अवयवों का नियामक कई रोगों के विकास में योगदान के लिए जाना जाता है और ट्यूमोरिजिनेसिस 1 , 2 का एक अच्छी तरह से स्थापित पहचान है। खमीर और स्तनधारी कोशिकाओं में किए गए जीनोम-विस्तृत ट्रांसस्क्रिप्टमिक विश्लेषण से पता चला है कि बड़ी संख्या में जीन कोशिका चक्र में आवधिक जीन अभिव्यक्ति पैटर्न दर्शाती है, यह दर्शाता है कि सेल चक्र के दौरान ट्रांसक्रिप्शनल अस्थिरता एक जीन उत्पाद की अस्थायी आवश्यकता का प्रतिबिंब है एक सटीक चरण 3 , 4 , 5

कोशिका चक्र-विनियमित जीन अभिव्यक्ति के अध्ययन में एक प्रमुख कार्य विशिष्ट कोशिका चक्र चरणों में कोशिकाओं का सिंक्रनाइज़ेशन है। सेल सिंक्रनाइज़ेशन एक विशेष सेल चक्र चरण संक्रमण के लिए जीन अभिव्यक्ति पैटर्न के संघ की व्याख्या में मदद करता है, और इससे कई जीनों के विनियमन और कार्य की बेहतर समझ प्राप्त हुई है। एंटीकैन्सर ड्रग्स की कार्रवाई के तंत्र का अध्ययन करने के लिए सेल सिंक्रनाइज़ेशन भी महत्वपूर्ण है, क्योंकि केमोथरेप्यूटिक एजेंट्स दोनों जीन एक्सप्रेशन के साथ-साथ सेल चक्र कैनेटीक्स 6 , 7 को प्रभावित करने के लिए जाने जाते हैं। फिर भी, यह निर्धारित करना अक्सर मुश्किल होता है कि इन एजेंटों के साथ जीन एक्सरसाइज के मतभेदों के परिणाम उपचार के लिए प्रत्यक्ष प्रतिक्रिया होती है या केवल सेल चक्र प्रोफाइल में होने वाले परिवर्तनों का नतीजा है। इन संभावनाओं के बीच अंतर करने के लिए, जीन अभिव्यक्ति का विश्लेषण कोशिकाओं में किया जाना चाहिए जो कि एस रहे हैंकेमोथेरेप्यूटिक दवा को जोड़ने से पूर्व ynchronized

ताजे पृथक लिम्फोइड कोशिकाओं जैसे कुछ प्राथमिक कोशिकाओं के अपवाद के साथ- जो जी -08 में सिंक्रनाइज़ एक समरूप सेल आबादी का निर्माण होता है, इन विट्रो स्थापित सेल लाइनों में संस्कृति में अतुलनीय रूप से बढ़ता है। नियमित विकास की स्थिति के तहत, ये अतुल्यकालिक साइकिल चालन कक्ष सेल चक्र के सभी चरणों में पाए जाते हैं, लेकिन G1 9 में अधिमान्य रूप से इसलिए, यह संदर्भ विशिष्ट सेल चक्र चरण ( जैसे जी 1, एस आदि) में कार्यात्मक या जीन अभिव्यक्ति विश्लेषण के लिए एक इष्टतम परिदृश्य प्रदान नहीं करता है। गैर-रूपांतरित अमर सेल लाइनें ( जैसे फाइब्रोब्लास्ट्स) तथाकथित शारीरिक तरीकों 10 के साथ सिंक्रनाइज़ किया जा सकता है ये पद्धतियां गैर-रूपांतरित कोशिकाओं के बनाए रखा प्राथमिक सेल सुविधाओं पर आधारित होती हैं, जैसे कि सेल-संपर्क निषेध और वृद्धि कारक निर्भरता ताकि साइक्लिंग जारी रहे। निष्कासनसंपर्क निषेध के साथ सीरम के संयोजन में जी -0 / जी 1 में गिरफ्तार गैर-रूपांतरित कोशिकाओं को प्रस्तुत किया गया है। हालांकि, सिंक्रनाइज़ किए गए सेल चक्र प्रविष्टि और प्रगति में अक्सर उपसंस्कृति की आवश्यकता होती है, जिसमें कोशिकाओं के कृत्रिम टुकड़ी और पुन: चढ़ाना 10 भी शामिल है। सबसे महत्वपूर्ण बात यह है कि, यह पद्धति ट्रांसफॉर्मेड सेल लाइनों के सिंक्रनाइज़ेशन के लिए उपयुक्त नहीं है, जो वर्तमान में उपयोग की जाने वाली सेल लाइनों का विशाल बहुमत है, जो कि सेल संपर्क-मध्यस्थता के विकास की निषेध या विकास कारक वापसी की प्रतिक्रिया की कमी के कारण होती है। इस प्रकार, यह स्पष्ट है कि सेल चक्र के विशिष्ट चरणों में कुशल सेल तुल्यकालन के लिए वैकल्पिक तरीकों की आवश्यकता है। सामान्य शब्दों में, अक्सर उपयोग किए जाने वाले सिंक्रनाइज़ेशन विधियां सेल चक्र के एक परिभाषित बिंदु के क्षणिक रासायनिक या औषधीय अवरोधन पर आधारित होती हैं, आमतौर पर डीएनए संश्लेषण या मैटोटिक स्पिंडल संरचना। डीएनए संश्लेषण के निषेध कोशिकाओं को देर जी 1 या शुरुआती एस चरण में गिरफ्तार करके उन्हें सिंक्रनाइज़ करता है। यह achi हो सकता हैन्युक्लिओटाइड बायोसिंथेसिस 11 , 12 , एफीडिकोलिन का अवरोध करने वाला, डीएनए पॉलीमर 13 , 14 , हाइड्रॉक्स्यूरिया का अवरोध करने वाला , रिबन्यूक्लॉइड रीडक्टेस 15 , 16 का अवरोधक या थाइमिडीन 17 , 18 की अधिक मात्रा के द्वारा यौगिकों के अलावा मिमोसिन के रूप में शामिल किया गया। दूसरी ओर, माइक्रोटुबुल पॉलिमराइजेशन के अवरोधक, जैसे कोलिन्सिसिन या एनकोडाज़ोल, एमटोसिसिक स्पिंडल संरचना को अवरुद्ध करने में सक्षम हैं, जो कि प्रारंभिक एम चरण 1 9 , 20 , 21 में सेल सिंक्रनाइज़ेशन के लिए अग्रणी होते हैं।

इस कार्य में हम एमआरएनए में कोशिका चक्र-विनियमित जीनों की अभिव्यक्ति का अध्ययन करने के लिए क्षणिक रासायनिक अवरोध के आधार पर दो पूरक सिंक्रनाइज़ेशन प्रोटोकॉल शामिल करने वाली विधि का वर्णन करते हैंस्तर। विशिष्ट सेल चक्र प्रक्रियाओं में सेल चक्र जीन की भूमिका को परिभाषित करने के लिए यह विधि मौलिक है। इसके अलावा, यह एंटीकैंसेचर उपचार के प्रभाव का अध्ययन करने के लिए दवा के प्रति संवेदनशील जीनों को सही ढंग से पहचानने और इन दवाओं द्वारा उत्पन्न सेल चक्र की प्रगति में उलझाव से उत्पन्न गलत तरीके को कम करने के लिए सामान्य फ्रेम प्रदान करता है।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. सेल चक्र प्रगति के सेलुलर सिंक्रनाइज़ेशन, रिलीज और मॉनिटरिंग

  1. थिमिडीन- और नोकोडाज़ोल-आधारित (तेर-एनओसी) मैक्रोजस से यू 2 ओएस कोशिकाओं के सिंक्रनाइज़ेशन और रिहाई
    1. आवश्यक सेल संस्कृति माध्यम तैयार करें यू 2ओएस कोशिकाओं को नियमित रूप से 10% (वॉल्यूम / वॉल्यूम) एफबीएस (वैकल्पिक: 1% पेनिसिलिन / स्ट्रेप्टोमाइसिन) से पूरित डीएमईएम-ग्लूटामाइन माध्यम में विकसित किया जाता है। बाँझ परिस्थितियों के तहत सभी मध्यम तैयारी और हेरफेर करें और पूरक के माध्यम से गर्म (अब "पूर्ण माध्यम" के रूप में संदर्भित) गरम करने के लिए 37 डिग्री सेल्सियस से पहले का उपयोग करें।
    2. 10 मिलीलीटर पूर्ण संस्कृति माध्यम में प्रति 100 मिमी डिश में बीज 2 x 10 6 U2OS कोशिकाओं। आवश्यक व्यंजनों की संख्या की गणना करने के लिए, ध्यान रखें कि प्रत्येक 100 मिमी डिश आम तौर पर एक 6-अच्छी तरह से प्लेट (0.2 - 0.25 x 10 6 कोशिकाओं / अच्छी तरह से) के लगभग 5 कुओं के लिए पर्याप्त माइटोटिक कोशिकाओं को प्रदान करता है ( चित्रा देखें) 1 बी ) चयनित समय बिंदु के अनुसार दो कुओं requir हैंप्रयोग में एड (1 अच्छी तरह से आरएनए निकासी के लिए और सेल चक्र निगरानी के लिए 1 अच्छी तरह से) इसके अतिरिक्त, प्रोटीन विश्लेषण के लिए प्रति सप्ताह एक तिहाई अच्छी तरह से एकत्र किया जा सकता है।
      नोट: शाम में प्लेट कोशिकाओं (लगभग 7 बजे) ताकि अगले दिन काम के घंटे के दौरान अगले चरणों को पूरा किया जा सके। एफएसीएस विश्लेषण मुआवजा सेटिंग्स को परिभाषित करने के लिए एसिंक्रोनस से बढ़ते कोशिकाओं के 2 अतिरिक्त कुएं शामिल करें।
    3. कोशिकाओं को 100 मिलीलीटर व्यंजनों को 37 डिग्री सेल्सियस के साथ आर्द्रीकृत वातावरण में 24 घंटे के लिए 5% सीओ 2 से बढ़ाकर संलग्न करें।
    4. थाइमिडीन ब्लॉक के लिए, 3 एमएल एच 2 ओ (या समतुल्य मात्रा) में 145.2 मिलीग्राम थाइमाइडिन पाउडर को भंग करके 200 एमएम थाइमाइडिन स्टॉक समाधान तैयार करें और 0.2 माइक्रोन पीओअर आकार फिल्टर के माध्यम से निस्पंदन के द्वारा समाधान को बाधित करें। थोड़े वार्मिंग से आपकामिडीन भंग हो सकता है प्रत्येक 100 मिमी संस्कृति डिश (अंतिम एकाग्रता 2 मिमी) के लिए ताजा तैयार 200 एमएम स्टॉक के 100 μL जोड़ें। थिइमाइडिन से 37 में 20 घंटे के लिए कोशिकाओं सेते76% सी 5% सीओ 2 के साथ आर्द्रीकृत वातावरण में
      नोट: शाम (लगभग 7 बजे) में कोशिकाओं का उपचार करने के लिए, थाइमिडीन रिलीज करने के लिए समय और अगले दिन नोकोडाज़ोल ब्लॉक करें।
    5. थाइमिडीन ब्लॉक से रिलीज करने के लिए, अगले दिन दोपहर (3 बजे) में होमिडाइन युक्त वृद्धि माध्यम को हटा दें; पूर्व-गर्म 1x पीबीएस के साथ दो बार कोशिकाओं को धो लें और प्रत्येक 100 मिमी डिश के लिए 10 एमएल का पूरा माध्यम जोड़ें। 5 डिग्री सेल्सियस पर 2 डिग्री सेल्सियस के लिए 5% सीओ 2 के साथ आर्मीड वातावरण में सेते हैं।
    6. म्यूटोटिक सेल की गिरफ्तारी के लिए, एनओसीडीज़ोल को 50 एनजी / एमएल (8 बजे) की अंतिम एकाग्रता में जोड़ें। डीएमएसओ में नकोडाज़ोल पाउडर को भंग करके एक स्टॉक समाधान तैयार करें ( जैसे 5 मिलीग्राम / एमएल) और स्टोर -20 डिग्री सेल्सियस पर जमे हुए। नोकोडाज़ोल वाली कोशिकाओं को 10 से 11 घंटे से अधिक नहीं बल्कि 37 डिग्री सेल्सियस पर 5% सीओ 2 के साथ आर्द्रतापूर्ण वातावरण में सेते हैं।
    7. प्रारंभिक एम चरण (मैटोटिक शेक ऑफ) में एनकोडाज़ोल-मध्यस्थता की गिरफ्तारी से रिलीज और कई बार पॉली में नमूनों का संग्रहएनटीएस (6-7 बजे से शुरू)
      1. प्रत्येक प्लेट को मिलाते हुए और नोडोडाज़ोल-युक्त विकास माध्यम को धीरे-धीरे pipetting द्वारा गोल (mitotic) कोशिकाओं को अलग करें प्रत्येक 100 मिमी प्लेट से अलग कोशिकाओं के माध्यम से 50 एमएल बाँझ ट्यूबों, अपकेंद्रित्र (300 xg, 5 मिनट, कमरे के तापमान (आरटी)) में कोशिकाओं को मिलाकर दो बार कोशिकाओं को 1x पीबीएस जोड़कर सेंटीफ्यूगेशन जोड़कर दोहराएं। शीत पीबीएस या पीबीएस प्लस नकोडाज़ोल का उपयोग करने के लिए सूक्ष्म सिकुड़न (चर्चा अनुभाग देखें) से बचने के लिए सिफारिश की गई है।
      2. 10 मील की पूर्ण माध्यम के प्रत्येक 100 मिमी प्लेट में मिलीटिक कोशिकाओं को पुन: Resuspend। 0 एच समय बिंदु (लगभग 0.2-0.25 x 10 प्रति नमूना 6 कोशिकाओं) के लिए आरएएन निष्कर्षण के लिए 2 एमएल और एफएसीएस विश्लेषण के लिए 2 एमएल बचाएं।
      3. 6-अच्छी प्लेटों (2 एमएल / अच्छी तरह से; 0.2-0.25 x 10 6 कोशिकाओं / अच्छी तरह) में बाद के समय बिंदुओं के लिए पुनः प्लेट शेष मैटोटिक कोशिकाएं
        नोट: याद रखें कि 2 कुएं प्रति चयनित समय बिंदु (1 आरएए के लिए और 1 एफएसीएस विश्लेषण के लिए) आवश्यक हैं।
    8. सैल पर नमूने लीजिएEcted समय अंक। सेल चक्र की प्रगति के एक पर्याप्त प्रोफ़ाइल प्राप्त करने के लिए प्रत्येक 1.5 से 3 घंटे की सिफारिश की जाती है।
      1. आरएनए निष्कर्षण के लिए, मध्यम निकालें, 2 एमएल पूर्व गर्म 1x पीबीएस के साथ अच्छी तरह से कुल्ला और अच्छे आरएनए अलगाव अभिकर्मक ( जैसे ट्राइज़ोल) के 1 एमएल को अच्छी तरह से जोड़ें (रसायनों के लिए सुरक्षा कैबिनेट में इस अंतिम चरण को करें) कोशिकाओं को अलग करने और कोशिकाओं को अलग करने के लिए ऊपर और नीचे पिपेट करें, 1.5 एमएल माइक्रोसेंट्रिफ्यूज ट्यूब में सेल lysate स्थानांतरण करें, आरटी पर 5 मिनट और -80 डिग्री सेल्सियस तक का उपयोग करें जब तक आगे उपयोग नहीं किया जाता है।
      2. एफएसीएस विश्लेषण के लिए, 2 एमएल प्री-वार्म 1 एक्स पीबीएस के साथ अच्छी तरह कुल्ला, कोशिकाओं को अलग करने के लिए प्री-वार्मर ट्रिप्सिन-ईडीटीए समाधान (0.3 एमएल / वेल) जोड़ें, ट्रिप्सिन-ईडीटीए ब्लॉक को 1 एमएल पूर्ण माध्यम जोड़कर और प्रत्येक नमूना अलग से जमा करें 15 एमएल ट्यूब
        1. अपकेंद्रित्र कोशिकाओं (300 xg, 5 मिनट, आरटी), सेलुलर गोली बचाने और सतह पर तैरनेवाला त्यागें। कोशिकाओं को ठीक करने के लिए, धीरे-छलनी ट्यूबों द्वारा 1x पीबीएस में ठंडा 70% (वी / वी) इथेनॉल के 1 एमएल में पुन: resuspend कोशिकाओं, और उन्हें ऐप के लिए बर्फ पर रखें4 डिग्री सेल्सियस पर भंडारण करने के लिए 15 मिनट पहले या एफएसीएस द्वारा आगे के विश्लेषण के लिए धुंधला हो जाने के लिए (चरण 1.4 - 1.5 में वर्णित)।
  2. एचयू आधारित सिंक्रनाइज़ेशन और जी 1 / एस सीमा से यू 2 ओएस कोशिकाओं के रिलीज
    1. चरण 1.1 में वर्णित के अनुसार पूर्ण सेल संस्कृति माध्यम तैयार करें।
    2. बीज 0.25 x 10 6 अच्छी तरह से अच्छी तरह प्लेटें (अच्छी तरह से 2 मिलीलीटर पूर्ण संस्कृति माध्यम) में अच्छी तरह से प्रति U2OS कोशिकाओं। प्रयोग के लिए आवश्यक कुओं की संख्या की गणना करने के लिए, ध्यान रखें कि प्रत्येक चयनित समय बिंदु के लिए 2 कुओं की आवश्यकता होगी (1 अच्छी तरह से आरएनए निकासी के लिए और सेल चक्र मॉनिटरिंग के लिए 1 अच्छी तरह से) और अतुल्यकालिक बढ़ते कोशिकाओं के 2 अतिरिक्त कुएं हैं। एफएसीएस विश्लेषण मुआवजा सेटिंग को परिभाषित करने की आवश्यकता है
    3. कोशिकाओं को 6-अच्छी तरह से प्लेटलेटों को रात भर (ओ / एन) 37 डिग्री सेल्सियस पर 5% सीओ 2 के साथ आर्द्रीकृत वातावरण में लेते हुए संलग्न करें।
    4. अगले सुबह कुओं से पूरा माध्यम निकालें और 2 एमएल जोड़ेंपूर्व गर्म एफबीएस मुक्त DMEM-Glutamine मध्यम प्रति अच्छी तरह से। 5% सीओ 2 के साथ आर्द्र वातावरण में 37 डिग्री सेल्सियस पर एक अतिरिक्त 24 घंटे के लिए कोशिकाओं सेते हैं।
      नोट: 2 के अलावा सभी कुओं में यह कदम (FACS सेटिंग्स को परिभाषित करने के लिए सहेजे गए) करें। सीयूआरम निकासी चरण को हटाया जा सकता है अगर कुशल सिंक्रनाइज़ेशन एचयू के साथ कोशिकाओं को बसने से प्राप्त किया जाता है।
    5. एच 1 के साथ जी 1 / एस सेल चक्र गिरफ्तारी
      1. प्रत्येक उपयोग के लिए ताजा एचयू स्टॉक समाधान (500 एमएम) तैयार करें 2 एमएल एच 2 ओ को एचयू पाउडर के 76.06 मिलीग्राम में जोड़ें और अच्छी तरह से भंग होने तक मिश्रण करें। 0.2 माइक्रोन छिद्र आकार के फिल्टर के माध्यम से निस्पंदन के द्वारा समाधान को जीवाणुरहित करें 4 एमएम के अंतिम एचयू एकाग्रता के लिए 400 μL फिल्टर-निष्फल एचयू स्टॉक समाधान के साथ 50 एमएल का पूरा माध्यम मिलाएं।
      2. एफएसीएस सेटिंग्स को परिभाषित करने और एक ताजा तैयार 4 मिमी एचयू युक्त पूर्ण माध्यम (2 एमएल / अच्छी तरह) के साथ बदलने के लिए आवश्यक 2 कुओं को छोड़कर सभी कुओं से माध्यम निकालें।
      3. 24 घंटे के लिए कोशिकाओं सेते हैंएचयू से युक्त माध्यम, आर्द्र वातावरण में 37 डिग्री सेल्सियस पर 5% सीओ 2 के साथ
    6. एचयू-मध्यस्थता की गिरफ्तारी से कोशिकाओं की रिहाई कुओं से एचयू युक्त मध्यम निकालें और कुओं को कुल्ला दो बार पूर्व गर्म 1x पीबीएस (2 एमएल हर बार) के साथ। प्रति मिडिल प्रति मि.ली. प्रति अच्छी तरह जोड़ें 0 एच समय बिंदु (आरएए निकासी के लिए 1 और एफएसीएस द्वारा सेल चक्र गिरफ्तारी सत्यापन के लिए 1) के लिए 2 नमूनों के साथ-साथ 2 नमूने एफएसीएस सेटिंग्स के लिए सहेजे गए हैं। इनक्यूबेटर में शेष कुएं रखें।
    7. सेल चक्र की प्रगति का पर्याप्त वितरण प्राप्त करने के लिए नमूनों को हर 1.5 से 3 घंटे ले लीजिए। हर बार बिंदु पर, 1.1.8.1-1.1.8.2 में वर्णित अनुसार नमूना प्रसंस्करण (आरएनए निकासी के लिए और एफएसीएस विश्लेषण के लिए) करें।
  3. डीएनए हानिकारक एजेंटों के साथ उपचार
    नोट: जब भी उद्देश्य सेल चक्र घटनाओं में एक यौगिक ( जैसे डीएनए हानिकारक एजेंटों) के प्रभाव को स्पष्ट करना है, पहले वर्णित तुल्यकालन पद्धतियों में से कोई भी हो सकता हैजीनोटॉक्सिक एजेंट के साथ कोशिकाओं के उपचार के साथ संयुक्त सिंक्रनाइज़ेशन विधि का चयन करने के लिए, सेल चक्र के चरण को ध्यान में रखना महत्वपूर्ण है जिसे हम विश्लेषण करना चाहते हैं। सामान्य तौर पर, आपका एनओसी प्रक्रिया जी 1 चरण या एस चरण प्रविष्टि में एक यौगिक के प्रभाव का अध्ययन करने के लिए उपयुक्त हो सकती है, जबकि एचयू-मध्यस्थता सिंक्रनाइज़ेशन एस 2 में जी 2 चरण या एमटोसिस के प्रवेश में प्रभाव का अध्ययन करने के लिए अधिक उपयुक्त हो सकता है।
    1. जी 1 चरण या एस चरण प्रविष्टि में जीनोोटोक्सिक एजेंटों के प्रभाव का विश्लेषण
      1. 1.1.2 में बताए अनुसार कोशिकाओं को सिंक्रनाइज़ करें। 1.1.6 के लिए
      2. 1.1.7 में वर्णित के रूप में एनकोडाज़ोल से रिहाई की कोशिकाओं और फिर से प्लेटें। उन्हें आर्द्रयुक्त वातावरण में 37 डिग्री सेल्सियस से 3% के लिए 5% सीओ 2 के साथ सेते हैं ताकि उन्हें एजेंट जोड़ने से पहले संलग्न करें (सेल के आधार पर आवश्यक ऊष्मायन अवधि भिन्न हो सकती है)।
      3. एजेंट जोड़ें और नमूनों को इकट्ठा करें जैसा कि पहले 1.1.8 में वर्णित है।
    2. एसजी में जीनोटॉक्सिक एजेंटों के प्रभाव का विश्लेषण2 चरणों या एम प्रविष्टि
      1. 1.2.2 में बताए गए अनुसार कोशिकाओं को सिंक्रनाइज़ करें। 1.2.5 के लिए
      2. 1.2.6 में वर्णित एचयू के कोशिकाओं को रिलीज़ करें और सीधे एजेंट जोड़ें
      3. नमूने लीजिए जैसा कि पहले 1.8 में वर्णित है।
  4. प्रोपीडियम आयोडाइड (पीआई) धुंधला और एफएसीएस विश्लेषण द्वारा सेल चक्र के माध्यम से सेल तुल्यकालन और प्रगति की निगरानी
    नोट: एफएसीएस सेटिंग्स को परिभाषित करने के लिए आवश्यक उन लोगों के साथ-साथ सभी समय बिंदुओं पर इकट्ठा किए गए नमूनों को एक बार ठीक किया जा सकता है (जैसा कि 1.1.8.2 में उल्लिखित है)। प्रयोग के सभी नमूने के लिए एक साथ एफएसीएस विश्लेषण के बाद पीआई समाधान के साथ धुंधला हो जाना। पीआई दोहरे फंसे हुए डीएनए की प्रमुख नाली में एक उच्च फ्लोरोसेंट सिग्नल का उत्पादन करती है जब 600 एनएम के आसपास एक व्यापक उत्सर्जन चोटी के साथ 535 एनएम पर उत्साहित होता है। चूंकि पीआई डबल-फंसे हुए आरएनए को भी बाध्य कर सकता है, इसलिए इष्टतम डीएनए रिज़ॉल्यूशन के लिए आरएनसी के साथ कोशिकाओं का इलाज करना आवश्यक है।
    1. ताजा बना पीआई धुंधला समाधान तैयार करें एक पीआई स्टॉक समाधान पीबीएस ( जैसे 5 मिलीग्राम / एमएल) में पीआई पाउडर भंग द्वारा तैयार किया जा सकता है। स्टॉक समाधान को 4 डिग्री सेल्सियस (अंधेरे में) में स्टोर करें। धुंधला हो जाना समाधान पीआई (140 माइक्रोग्राम), सोडियम साइट्रेट (38 मिमी) और ट्राइटन एक्स -100 (0.01% वी / वी) से बना है।
    2. एक उपयुक्त सतह ( जैसे ओवन) को 37 डिग्री सेल्सियस तक गर्म करें
    3. अपकेंद्रित्र निश्चित कोशिकाओं (450 xg, 5 मिनट, आरटी), डिकैंट सतह पर तैरनेवाला (इथेनॉल) और 1x पीबीएस के साथ एक बार धो लें
    4. अपकेंद्रित्र कोशिकाओं को फिर से, पीबीएस निकालें और प्रति नमूना पीआई धुंधला हो जाना समाधान के 300 μL (एफएसीएस सेटिंग्स के लिए नमूने में से एक को छोड़कर) इसके बजाय इस नमूना में पीबीएस जोड़ें।
    5. एफएसीएस ट्यूबों (5 एमएल गोल-नीचे पॉलिस्टीरीन ट्यूबों) के लिए कोशिकाओं को स्थानांतरित करें।
    6. प्रत्येक नमूने के लिए 1 μL आरएनस ए जोड़ें, 30 डिग्री के लिए अंधेरे में 30 मिनट के नमूने मिश्रण और सेते हैं। नमूनों को 4 डिग्री सेल्सियस पर अधिकतम 2 से 3 दिनों तक रोशनी से सुरक्षित रखा जा सकता है।
    7. प्रवाह द्वारा नमूनों में डीएनए सामग्री का विश्लेषण करेंcytometry। पीआई-दाग अतुल्यकालिक नमूने के साथ एफएसीएस विश्लेषण मुआवजा सेटिंग्स परिभाषित करें। Autofluorescence के लिए जांच करने के लिए खाली नमूना (पीआई धुंधला समाधान के बिना) का उपयोग करें प्रवाह cytometry द्वारा डीआईएन सामग्री के पीआई धुंधला-मध्यस्थता विश्लेषण की मूल बातें पहले 9 वर्णित हैं
  5. डबल फॉस्फो-एच 3 (एसआर 10) / पीआई धुंधला द्वारा एमटोटिक इंडेक्स का निर्धारण
    नोट: श्वासोच्छवास के दौर से गुजर जाने वाली कोशिकाओं को आसानी से फ्लोरो स्टेटोमेट्री से पता लगाया जा सकता है जो कि सीरिन 10 (पीएच 3) में फास्फो-हिस्टोन एच 3 के लिए विशिष्ट एंटीबॉडी के साथ है। सेल आबादी के डीएनए सामग्री-आधारित वितरण को निर्धारित करने के लिए एक सहकर्मी पीआई धुंधला उपयोगी है। एफएसीएस सेटिंग्स के अनुकूलतम विन्यास के लिए 5 नमूनों की आवश्यकता है: रिक्त, पीआई-केवल, पीएच 3-केवल, माध्यमिक एंटीबॉडी-केवल और डबल स्टीनिंग।
    1. अपकेंद्रित्र निश्चित कोशिकाओं (450 xg, 5 मिनट, 4 डिग्री सेल्सियस) और सतह पर तैरनेवाला त्यागें। 15 एमएल ट्यूबों में धुंधला होने के लिए निम्नलिखित चरणों का वर्णन किया गया है।
    2. कोशिकाओं को 1 जोड़कर धोएंगोली और अपकेंद्रित्र (450 xg, 5 मिनट, 4 डिग्री सेल्सियस) में एमएल पीबीएस-टी (पीबीएस + 0.05% ट्विल -20)। सतह पर तैरनेवाला निकालें
    3. एंटी-पीएच 3 एंटीबॉडी पीबीएस-टी + 3% बीएसए की 100-200 μL में पतला (1: 500) जोड़ें, और आरटी पर 2 घंटे के लिए (या ओ / एन 4 डिग्री सेल्सियस पर) कमाल के साथ सेते हैं।
    4. 2 एमएल पीबीएस-टी (पीबीएस + 0.05% ट्विल -20) और अपकेंद्रित्र (450 xg, 5 मिनट, 4 डिग्री सेल्सियस) जोड़ें। सतह पर तैरनेवाला निकालें
    5. गोली में 2 एमएल पीबीएस-टी जोड़कर एक बार और धोएं, अपकेंद्रित्र और सतह पर तैरनेवाला त्याग दें।
    6. पीबीएस-टी + 3% बीएसए की 100-200 μL में पतला (1: 500) पतला एंटीबॉडी (एंटी-खरगोश एलेक्साफ़्लौर 488) को पीटीएस-टी + 3% बीएसए में मिला और आरटी पर 1 एच के लिए कमाल करने के साथ सेते (या ओ / एन) 4 डिग्री सेल्सियस पर) प्रकाश से नमूनों को सुरक्षित रखें
    7. चरण 1.5.4 में वर्णित के रूप में centrifugation द्वारा पीबीएस-टी (2 एमएल) के साथ दो बार धो लें।
    8. वर्णित के रूप में पीआई धुंधला प्रदर्शन करें (1.4.1 से 1.4.6 कदम)

2. जीन अभिव्यक्ति विश्लेषण के लिए नमूना संग्रह और प्रक्रिया

  1. लेनाआरएनए अलगाव अभिकर्मक में 1.5 मिलीलीटर microcentrifuge नमूनों फ्रीजर के बाहर और उन्हें रसायनों के लिए एक सुरक्षा कैबिनेट के अंदर आरटी पर पिघलना।
  2. प्रत्येक नमूने में क्लोरोफॉर्म के 400 μL जोड़ें और सख्ती से हिलाएं (लेकिन भंवर न करें) जब तक कि पूरा मिश्रण न हो। आरटी पर 5 मिनट के लिए नमूने सेते हैं।
  3. एक बेंचटॉप माइक्रोसेंट्रफ़्यूज में 15 मिनट (≥8,000 xg, 4 डिग्री सेल्सियस) के लिए अपकेंद्रित्र ट्यूब।
  4. जलीय (ऊपरी) चरण को एक नई 1.5 एमएल माइक्रोसेंट्रिफ्यूज ट्यूब में ट्रांसफर कर दें और ट्रांसफ़र्ड वॉल्यूम रजिस्टर करें (प्रक्रिया सरल बनाने के लिए, प्रयोग के सभी नमूनों में समान मात्रा एकत्र करने के लिए सिफारिश की गई है)।
  5. मिश्रण के दौरान जलीय चरण में 100% इथेनॉल के 1 मात्रा धीरे धीरे जोड़ें (बूंद से ड्रॉप)। अपकेंद्रित्र मत करो
  6. वाणिज्यिक आरएनए मिनी प्रस्तुत करने वाले किट के साथ अगले कदम उठाएं प्रत्येक नमूने के 700 μL तक के पिपेट तक, जिसमें 2 एमएल संग्रह ट्यूब (निर्माता द्वारा उपलब्ध कराई गई) में एक स्पिन कॉलम में बनाई गई किसी भी वेग भी शामिल है।
  7. बंद करो15 एस के लिए ढक्कन और अपकेंद्रित्र (≥ 8,000 ग्रा, आरटी) प्रवाह के माध्यम से त्यागें शेष नमूने के साथ पिछले चरण को दोहराएं (यदि कोई हो)
  8. आरएए धोने और क्षीणन के लिए मैन्युफैक्चरिंग निर्देशों का पालन करें (अगले चरण के लिए उचित आरएनए एकाग्रता प्राप्त करने के लिए 30-40 μl न्यूकेले-मुक्त एच 2 ओ में प्रत्येक नमूना नमस्कार करें)।
  9. अवशोषण माप द्वारा आरएनए एकाग्रता और नमूनों की शुद्धता निर्धारित करें ( 2.0-2.1 का एक 260/280 अनुपात आरएनए नमूना की शुद्धता का संकेत देता है)। RT-qPCR विश्लेषण के लिए उपयोग होने तक -80 डिग्री सेल्सियस पर आरएनए नमूनों को स्टोर करें।
  10. सीएनडीए और बाद में मात्रात्मक-पीसीआर में आरएनए रूपांतरण के लिए, प्रति नमूना 1 μg आरएनए लेते हैं और निर्माता के निर्देशों के अनुसार रेट्रोट्रांस्क्रिप्शन प्रतिक्रिया तैयार करते हैं। प्राप्त सीडीएनए नमूनों को 4 डिग्री सेल्सियस (कुछ दिनों तक) या -20 डिग्री सेल्सियस (लंबी अवधि के लिए) पर संग्रहीत किया जा सकता है।
    नोट: वास्तविक समय-पीसीआर के लिए नमूना तैयार करने, प्राइमर डिजाइन और अन्य विचार पूर्व में किया गया हैसघनता से साहित्य 22 , 23 में वर्णित है।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

सेल-सिंक्रनाइज़ेशन के लिए ते-एनओसी और एचयू-आधारित प्रोटोकॉल का योजनाबद्ध प्रतिनिधित्व।

चित्रा 1 सेल चक्र के माध्यम से प्रगति को सत्यापित करने के लिए और जीन अभिव्यक्ति विश्लेषण करने के लिए U2OS सेल तुल्यकालन और बाद के नमूना संग्रह के लिए आवश्यक चरणों का सारांश देता है।

फ़ॉस्फो-एच 3 और पीआई धुंधला सिंक्रनाइज़ेशन विधि का चयन करने के लिए अच्छा मूल्यांकन पैरामीटर हैं।

सुसंस्कृत कोशिकाओं की अंतर्निहित विविधता के कारण प्रत्येक सेल लाइन के लिए सेल तुल्यकालन प्रक्रियाओं का आकलन और अनुकूलित किया जाना चाहिए। म्यूटोसिस में सिंक्रनाइज़ेशन को सामान्यतः तेरा-एनोक प्रोटोकॉल के साथ हासिल किया जाता है, और नोकोडाज़ोल के उपचार के बाद म्यूटोटिक कोशिकाओं के संवर्धन को फॉस्फोरिलेटेड हिस्टोन एच 3 (पीएच 3) के लिए विशिष्ट एंटीबॉडी के साथ मूल्यांकन किया जा सकता है, एक विशिष्ट म्यूटोटिक मार्कर। आईडीई पीएच 3 पॉज़िटिव कोशिकाओं के एनटीफिकेशन में मित्सुशी कोशिकाओं और उन 4 सी-डीएनए सामग्री के बीच भेदभाव करने की अनुमति मिलती है जो कि श्वेत-श्वासनुमा (सभी जिनमें से पीआई धुंधला होकर एक "जी 2" आबादी माना जाता है) से गुज़र रहा है। U2OS कोशिकाओं में आपकी एनोक प्रोटोकॉल 4 सी डीएनए सामग्री (चित्रा 2 ए, ऊपरी बाएं ग्राफ, पीआई धुंधला द्वारा नीली आबादी) के साथ आबादी का एक महत्वपूर्ण संवर्धन करने के लिए नेतृत्व करती है, और इस आबादी में मित्सुशी कोशिकाओं के सापेक्ष अंश नियमित रूप से काफी शुद्ध था (लगभग एसिंक्रोनस कोशिकाओं में 2% की तुलना में 91%)। कोशिकाओं के सिंक्रनाइज़ प्रगति में अगले जी 1 चरण के लिए, एनसीओडीज़ोल के परिणामों से रिहाई, जैसा कि 2 सी डीएनए सामग्री ( चित्रा 2 ए , ऊपरी दायां ग्राफ, पीआई धुंधला द्वारा हरी आबादी) के साथ आबादी के संचय द्वारा निर्धारित किया गया है और पीएच 3 पॉजिटिव माइटोटिक कोशिकाओं ( चित्रा 2 ए , निचला दायां ग्राफ)। इस प्रकार, पीएच 3 धुंधला परिणाम ने U2OS कोशिकाओं के mitotic सिंक्रनाइज़ेशन के लिए तेर-एनओसी प्रोटोकॉल की उपयुक्तता की पुष्टि की।

E_content "fo: keep-together.within-page =" 1 "> जी 1 / एस में यू 2 ओएस कोशिकाओं के सिंक्रनाइज़ेशन को थाइमिडीन और हाइड्रॉक्स्यूरिया के साथ परीक्षण किया गया था, दो व्यापक रूप से इस्तेमाल किए जाने वाले सिंक्रनाइज़र्स। सेल चक्र के विभिन्न चरणों में संवर्धन पीआई धुंधला द्वारा निर्धारित किया गया था एफएसीएस विश्लेषण और कोशिकाओं का प्रतिशत तालिका में संक्षेप ( चित्रा 2 बी )। आपका (2 एमएम) U2OS कोशिकाओं के 24 घंटे का एक्सप्लोरर जी 1 / एस सीमा ( चित्रा 2 बी ) में कोशिकाओं को गिरफ्तार करने में अक्षम था, जबकि एचयू के साथ उपचार या डबल के साथ थिइमिडीन (डीटी) के गोल के परिणामस्वरूप एक संतोषजनक गिरफ्तारी हुई। हालांकि, केवल एचयू-उपचार कोशिकाओं को पूरी तरह से गिरफ्तार कर लिया गया और सेल चक्र के माध्यम से पर्याप्त रूप से प्रगति हुई। इसके विपरीत, डीटी ब्लॉक ने सेल आबादी के एक महत्वपूर्ण अंश में एक स्थायी जी 1 गिरफ्तारी को प्रेरित किया डीटी बनाम 3.1% एचयू-आधारित प्रोटोकॉल के साथ 6 घंटे के समय में जी 1 में 13.3% सेल), जो कि सेल सिंक्रनाइज़ को नकारात्मक रूप से प्रभावित करता है। इस प्रकार, एचयू के संपर्क में उपयुक्त जी 1 / एस सिंक्रनाइज़ेशन मेथU2OS कोशिकाओं के लिए ओडी

ते-एनओसी- और एचयू-आधारित प्रोटोकॉल सेल तुल्यकालन के लिए पूरक हैं।

जैसा कि चित्रा 3 ए (0 एच समय बिंदु) में दिखाया गया है, ते-एनोक प्रोटोकॉल द्वारा इलाज एम-फेज प्रविष्टि (4C डीएनए सामग्री के साथ आबादी, नीले रंग में दिखाया गया) में कुशलता से यू 2 ओएस कोशिकाओं को गिरफ्तार किया गया और एचयू प्रोटोकॉल द्वारा उपचार जी 1 / एस सीमा में गिरफ्तार किए गए कोशिकाओं (2 सी डीएनए सामग्री वाली आबादी, हरे / लाल रंग में दिखाया गया है) दवाओं को हटाने पर, कोशिकाओं को एक सिंक्रनाइज़ फ़ैशन में सेल चक्र के माध्यम से प्रवेश किया और प्रगति की गई। तेरा-एनओसी उपचार से पुनर्प्राप्त की गई कोशिकाओं को पहले जी 1 चरण (हरे रंग की आबादी) में पहले देखा गया था और बाद में जी 1 के माध्यम से और एक समान फैशन में एस चरण तक संक्रमित किया गया था। एचयू उपचार से पुनर्प्राप्त कोशिकाओं एस (लाल रंग की आबादी) और जी 2 / एम के माध्यम से तुल्यकालिक प्रगति की। अगले सेल चक्र के माध्यम से प्रगति सिंकनाइसिटी के नुकसान के लिए सहवर्ती थी। Consequentlवाई, 15 घंटे से अधिक समय अंक इन विश्लेषकों में शामिल नहीं थे क्योंकि इस समय के बिंदु के बाद सिंक्रनाइनिसिस के नुकसान के कारण।

साइक्लिन ई 1 (एक जी 1 / एस साइक्लीन) और साइक्लिन बी 1 (एक जी 2 / एम साइक्लीन) के पश्चिमी ब्लॉट विश्लेषण, जिनके स्तर को सेल चक्र में कसकर नियंत्रित किया जाता है, और mitotic marker pH3 की, ने प्रत्येक के सेल चक्र चरण की पुष्टि की एफएसीएस ( चित्रा 3 बी ) द्वारा विश्लेषण किया गया समय बिंदु जैसा कि अपेक्षित था, एम चरण में कोशिकाओं (ते-एनओसी-सिंक्रनाइज़ किए गए कोशिकाओं के 0 घंटे के समय के अनुरूप) और जी 2 से एम चरण (एचयू-सिंक्रनाइज्ड कोशिकाओं के 9 एच से 12 घंटे के समय बिंदु) में कोशिकाओं ने साइक्लिन बी 1 के नाटकीय संचय दिखाया और cyclin E1 के undetectable स्तर इसके अलावा, साइक्लिन बी 1 के स्तर जी 1 चरण (एनओसीडीज़ोल से रिलीज होने पर 3 एच) में undetectable के लिए कम थे और धीरे-धीरे संचय के रूप में देखा गया था कि कोशिका एस (ते-एनओसी रिलीज के बाद) और जी 2 (एचयू रिलीज के बाद) में बढ़ी है। तारा-एनओसी सिंक्रनाइज़िटी पर 0 घंटे पर कोशिकाओं की मजबूत पीएच 3 लेबलिंगइस समय बिंदु पर मिटिसिस में गिरफ्तार किए गए कोशिकाओं के संवर्धन की पुष्टि की। एचयू से जारी होने के बाद 12 घंटे में पीएच 3 स्तरों पर हल्की वृद्धि से पता चला कि 4 सी डीएनए सामग्री वाले अधिकांश कोशिकाएँ अभी भी जी 2 में थीं, जबकि बीमारियों में कोशिकाओं के अनुपात 15 घंटे के समय में बढ़े थे। इसके विपरीत, साइक्लीन ई 1 के अभिव्यक्ति पैटर्न ने प्रारंभिक जी 1 से एस-चरण प्रविष्टि (ते-एनओसी प्रक्रिया) और जी 2 / एम चरण (एचयू प्रक्रिया) में क्रमिक गायब होने से प्रगतिशील संचय दिखाया।

कोशिका चक्र में भिन्न रूप से विनियमित किए जाने वाले जीनों का अभिव्यक्ति तेरा-एनओसी- और एचयू-आधारित सिंक्रनाइज़ेशन के संयोजन के साथ सही तरीके से विश्लेषण किया जा सकता है।

एक प्रूफ ऑफ अवधारणा के रूप में, सेल चक्र-विनियमित जीन एक्सप्रेशन विश्लेषण को दो सेल सिंक्रनाइज़ेशन विधियों के संयोजन से सर्वोत्तम परख लिया जाता है, दो ई 2 एफ परिवार के सदस्यों की एमआरएनए अभिव्यक्ति सेल चक्र में विभिन्न अभिव्यक्ति कैनेटीक्स के लिए जाने जाते हैं(ई 2 एफ 1 और ई 2 एफ 7) की रिवर्स ट्रांस्क्रिप्टेज़ मात्रात्मक पीसीआर (आरटी-क्यूपीसीआर) द्वारा जांच की गई थी। इस समाप्ति के लिए, चित्रा 1 में समझाया गया था, के रूप में तेरा-एनओसी और एचयू तुल्यकालन प्रोटोकॉल का उपयोग किया गया, और चित्रा 3 ए में दिखाए गए अनुसार प्रवाह कोशिका द्वारा सेल चक्र वितरण की निगरानी की गई। चित्रा 4 सेल चक्र के माध्यम से ई 2 एफ 1 (ऊपरी दो ग्राफ़) और ई 2 एफ 7 (कम दो ग्राफ़) एमआरएनए प्रोफाइल दिखाती है। ई 2 एफ 1 एन्कोडिंग जीन का ट्रांसक्रिप्शनल विनियमन प्रोफाइल तेरा-एनओसी प्रक्रिया के साथ सबसे अच्छा मनाया जाता है, जिससे ई 2 एफ 1 की अभिव्यक्ति धीरे-धीरे प्रारंभिक जी -1 चरण से बढ़ी, जी 1 चरण के अंत में चरम पर पहुंचने के लिए (ते-एनोक रिलीज के बाद 9 घंटे, ग्रीन बैकग्राउंड)। इसके बाद उसके स्तर में कमी आई, एस और जी 2 चरणों (लाल और नीले रंग की पृष्ठभूमि) में प्रवेश के साथ सहवर्ती। इसके विपरीत, ई 2 एफ 7 जीन अभिव्यक्ति कैनेटीक्स एचयू-आधारित सिंक्रनाइज़ेशन (निचला ग्राफ़; लाल पृष्ठभूमि) के बाद सबसे अच्छा पता चला है, जिसमें रिलीज से 6 घंटे में शिखर अभिव्यक्ति के साथ (एस से जी 2 चरण संक्रमण के साथ)। तेरा-Nocदूसरी तरफ, प्रक्रिया, ई 2 एफ 7 की प्रेरण देखने के लिए उपयुक्त थी, लेकिन इसके डाउन्रग्यूलेशन नहीं। नोट, 15 घंटे के समय के बाद के विश्लेषण का विस्तार ई 2 एफ 1 और ई 2 एफ 7 एमआरएनए अभिव्यक्ति प्रोफाइल को पहले के समय बिंदुओं के आधार पर दोहराया गया, हालांकि एमआरएनए विविधता की कमी वाली सीमा (डेटा नहीं दिखाया गया) के साथ। कुल मिलाकर, ये परिणाम न केवल जीन अभिव्यक्ति कैनेटीक्स का मूल्यांकन करने के लिए ठीक तरह से सिंक्रनाइज़ किए गए सेल आबादी के साथ काम करने के महत्व की पुष्टि करते हैं, लेकिन एमआरएनए स्तरों में होने वाले बदलावों का सटीक आयाम भी है।

सेल सिंक्रनाइज़ेशन एंटीकंसर थेरेपी द्वारा प्रभावित जीन एक्सप्रेशन कार्यक्रम की बेहतर समझ प्रदान करता है।

कोशिका चक्र की गतिशीलता के साथ-साथ जीन की अभिव्यक्ति में एंटीट्यूमोर नशीले पदार्थों के माइटोमाइसिन सी (एमएमसी) के प्रभाव का विश्लेषण करने के लिए, यू 2 ओएस कोशिकाओं को पहले एचयू के साथ सिंक्रनाइज़ किया गया था और बाद में एमएमसी के साथ इलाज किया गया था। इस जीनोोटोक्सिक एजेंट को एक्सपोजर ने एक चेकपॉइन को सक्रिय कियाजी 2 के चरण में जो जोखिम के 15 घंटे ( चित्रा 5 ए , निचली पंक्ति, नीली चोटी) के बाद स्पष्ट था। इसके विपरीत, अनुपचारित कोशिकाओं को सामान्यतः इस समय बिंदु ( चित्रा 5 ए , ऊपरी पंक्ति, हरी चोटी) में जी 1 के माध्यम से प्रगति हुई। दीर्घकालिक एमएमसी उपचार (36 एच) ने जी 2 चरण में कोशिकाओं की स्थाई गिरफ्तारी का पता लगाया, जबकि एमएमसी उपचार के बिना कोशिकाओं ने एक सेल चक्र वितरण का प्रदर्शन किया जो एसिंक्रोनस सेल आबादी द्वारा दिखाए गए समान था।

ई 2 एफ 1 और पी 21 सीिप 1 (सीडीकेएन 1 ए) को एमएमसी-इलाज कोशिकाओं ( चित्रा 5 बी) में जीन अभिव्यक्ति विश्लेषण के लिए चुना गया था, उनके अलग-अलग सेल चक्र-निर्भर विनियमन के अनुसार। ई 2 एफ 1 का अभिव्यक्ति जी 1 चरण-आश्रित है, जैसा कि चित्रा 4 में वर्णित है, जबकि पी 21 सीिप 1 अभिव्यक्ति का प्रेरण सेल चक्र गिरफ्तारी / चेकपॉइंट सक्रियण 24 के साथ मिलकर किया गया है। जैसा कि चित्रा 5 बी (ऊपरी बाएं ग्राफ) में दिखाया गया है, ई 2 एफ 1 जीन एक्सप्रेशन कीनेटिक्स एमएमसी की मौजूदगी या अनुपस्थिति में समान थे, क्योंकि कोशिकाएं जी 1 / एस और एस चरण में प्रगति की थीं। एमएमसी के इलाज के दौरान ई 2 एफ 1 जीन अभिव्यक्ति में अंतर एमएमसी के संपर्क में 15 घंटे के बाद मनाया गया और अनुपचारित कोशिकाओं को देखा गया, जिससे एमएमसी-इलाज कोशिकाओं ने नियंत्रण कोशिकाओं ( चित्रा 5 बी, ठोस और डैश्ड लाइनों की तुलना की तुलना में) कम ई 2 एफ 1 एमआरएनए स्तर व्यक्त किया। हालांकि, अभिव्यक्ति में स्पष्ट अंतर के बावजूद, यह निष्कर्ष नहीं लगाया जा सकता है कि एमएमसी ने ई 2 एफ 1 अभिव्यक्ति को हटा दिया है, क्योंकि एमएमसी द्वारा लगाए गए निरंतर जी 2 चरण गिरफ्तारी के कारण एमएमसी के इलाज और अनुपचारित कोशिकाओं के सेल चक्र प्रोफाइल इन बाद के समय बिंदुओं में स्पष्ट रूप से अलग हैं। वास्तव में, एमएमसी-उजागर कोशिकाओं में 15 घंटे के समय के बाद निम्न E2F1 एमआरएनए स्तर शायद ई 2 एफ 1 ट्रांसक्रिप्शनल नियमन में एमएमसी के प्रभाव के बजाय, सेल चक्र गतिशीलता में दवा का एक प्रभाव दर्शाते हैं।

ई 2 एफ 1 के विपरीत, पी 21 सीिप 1 एक एमएमसी-प्रतिक्रियाजनक जीन है। पी के ऊंचा स्तरएचयू-लगाया जी 1 / एस गिरफ्तारी पर 21 सीआईपी 1 का पता चला था, जो एचयू ( चित्रा 5 बी, 0 एच समय बिंदु) द्वारा जी 1 चेकपॉइंट सक्रियण को इंगित करता है और इसके बाद गैर-एमएमसी वाले इलाज कक्षों में इसकी अभिव्यक्ति कम हो जाती है, जो कि जारी किए जाने के बाद एक अघोषित सेल चक्र की प्रगति के अनुरूप है गिरफ़्तार करना। इसके विपरीत, एमएमसी उपचार में पी 21 सीिप 1 एमआरएनए स्तर ( चित्रा 5 बी , ऊपरी दायां ग्राफ, ठोस रेखा) का नेतृत्व किया गया जबकि कोशिकाओं को जी 2 चरण (एमएमसी एक्सपोजर 9 एच) में जमा किया गया था। इस तथ्य के बावजूद कि सेल चक्र प्रोफाइल नियंत्रण और एमएमसी के इलाज कक्षों में 9 घंटे के समय के समान थे, जीन अभिव्यक्ति विश्लेषण एक मौलिक अंतर दिखाता है। एमएमसी ने उजागर किए गए कोशिकाओं को एक सक्रिय जी 2 चेकपॉइंट प्रदर्शित किया, जो कि पी 21 सीिप 1 अभिव्यक्ति के प्रेरण से सिद्ध हुआ, जबकि अनुपचारित कोशिकाएं पी 2 के सीपी 1 स्तरों के साथ जी 2 के माध्यम से अप्रभावी संक्रमण से गुजर रही थीं।

प्रवाह साइटमैट्री विश्लेषण ( फाईजीर 5 ए) और RT-qPCR ( चित्रा 5 बी , ऊपरी रेखांकन) से उत्पन्न होने वाले डेटा को प्रत्येक चयनित जीन ( चित्रा 4 बी , निचला रेखांकन) के लिए एक ग्राफ़ में जोड़ा गया था। एमआरएनए अभिव्यक्ति के स्तर जहां सलाखों की सापेक्ष ऊँचाई के रूप में दिखाया गया है, जबकि प्रत्येक नमूने के लिए कोशिकाओं का सेल चक्र वितरण रंगों के अनुपात से स्पष्ट किया गया था: जी 2 चरण (2 सी डीएनए सामग्री) के लिए हरे, जी 2 चरण (4 सी डीएनए सामग्री) और लाल रंग के लिए नीले एस चरण (मध्यवर्ती डीएनए सामग्री) के लिए ग्राफ़िकल प्रतिनिधित्व की यह संयुक्त विधि कोशिका चक्र वितरण और जीन अभिव्यक्ति का विश्लेषण करने के लिए उपयोगी हो सकती है।

संक्षेप में, एक संस्कृति तुल्यकालन पद्धति के साथ मिलकर जीन अभिव्यक्ति विश्लेषण ने एक जीनोोटोक्सिक एजेंट-प्रतिसादी जीन ( पी 21 सीिप 1 ) की पहचान करने की अनुमति दी और उस प्रस्ताव को आगे बढ़ाया कि ई 2 एफ 1 अभिव्यक्ति में इलाज किए गए कोशिकाओं के बीच इलाज किया गया और एजेंट के साथ अनुपचारित अप्रत्यक्ष था, औरसंभवतः कोशिकाओं के सेल चक्र वितरण में अंतर से संबंधित है

आकृति 1
चित्रा 1: दो पूरक सेल तुल्यकालन प्रोटोकॉल का अवलोकन: थिइमिडीन-नोकोडाज़ोल और हाइड्रोक्स्यूरिया। ( ) स्तनधारी कोशिका चक्र के ग्राफ़िकल प्रतिनिधित्व जो उस बिंदु को इंगित करता है जिस पर कोशिका चक्र की गिरफ्तारी सेल सिंक्रनाइज़ेशन विधियों द्वारा प्राप्त की जाती है। तेरा-एनओसी-आधारित प्रक्रिया जल्दी एमिटोसिस (एम) में कोशिकाओं को ब्लॉक करती है जबकि एचयू G1 / एस सीमा पर कोशिकाओं को ब्लॉक करती है। ( बी ) सेल-सिंक्रनाइज़ेशन के ते-एनओसी प्रोटोकॉल के योजनाबद्ध प्रतिनिधित्व। यूआईओएस कोशिकाओं में आम तौर पर जीन एक्सप्रेशन विश्लेषण और सेल चक्र मॉनिटरिंग के लिए उपयोग किए गए चरणों को दिखाया गया है। ( सी ) सेल तुल्यकालन के एचयू-आधारित प्रोटोकॉल के योजनाबद्ध प्रतिनिधित्व यूएन में जीन एक्सपीसिशन विश्लेषण और सेल चक्र मॉनिटरिंग के लिए आम तौर पर उपयोग किए गए चरणों को दिखाया गया है2OS कोशिकाओं सीरम भुखमरी को छोड़ने वाला एक छोटा तुल्यकालन प्रक्रिया भी लागू किया जा सकता है अगर इष्टतम सिंक्रनाइज़ेशन एचयू के 24 घंटे के एक्सपोजर द्वारा पहले ही हासिल किया गया है। इस आंकड़े के एक बड़े संस्करण को देखने के लिए कृपया यहां क्लिक करें

चित्र 2
चित्रा 2: उपयुक्त सिंक्रनाइज़ेशन विधियों का आकलन ( ) एसिंक्रोनस और तेरा-एनोक सिंक्रनाइज़ किए गए यू 2ओएस सेल संस्कृतियों को प्रत्येक मामले में मित्सुशी कोशिकाओं के अंश का आकलन करने के लिए पीएच 3 धुंधला के अधीन किया गया था। एक साथ पीआई धुंधला कोशिकाओं की डीएनए सामग्री की निगरानी की अनुमति दी। एसिंक्रोनस आबादी में केवल 4 सी डीएनए सामग्री (नीला में) वाले कोशिकाओं का न्यूनतम अंश माइटोसिस मार्कर के लिए सकारात्मक था। इसके विपरीत, तेरा-एनोक प्रोटोकॉल कुशलतापूर्वक एयूयूMitosis में mulated कोशिकाओं (पीएच 3 धुंधला के लिए सकारात्मक) और nocodazole (3 ह समय बिंदु) को हटाने पर अगले जी 1 चरण (हरे रंग में) के लिए उचित प्रगति की अनुमति दी। प्रत्येक चरण में कोशिकाओं का प्रतिशत तालिका में संक्षेप किया जाता है और पीआई हिस्टोग्राम में नियोजित उन लोगों के अनुसार रंगों के साथ लेबल किया जाता है: 2 सी डीएनए सामग्री कोशिकाओं (जी 1) के लिए हरे, 4 सी डीएनए सामग्री (जी 2 और एम कोशिकाओं सहित और के रूप में नामित हिस्टोग्राम में जी 2, आंकड़े को आसान बनाने के लिए, और मध्यवर्ती डीएनए सामग्री (एस) वाले कोशिकाओं के लिए लाल। ( बी ) थिमीडीन और एचयू को यू 2 ओएस कोशिकाओं में उनके सेल चक्र सिंक्रनाइज़ेशन दक्षता के लिए मूल्यांकन किया गया। कोशिकाओं को थाइमाइडिन (एक या दो राउंड), या 24 घंटे के लिए एचयू के साथ, और सेल तुल्यकालन की जांच पीआई धुंधला और एफएसीएस विश्लेषण द्वारा की गई थी। शिखर सम्मेलन का उपयोग एफएसीएस डेटा विश्लेषण के लिए किया गया था। कृपया इस आंकड़े के एक बड़े संस्करण को देखने के लिए यहां क्लिक करें।

चित्र तीन
चित्रा 3: आपका एनओसी- और एचयू-मध्यस्थता सिंक्रनाइज़ेशन के बाद कोशिकाओं के समान प्रगति के लिए टेम्पोरल फ़्रेम को रेखांकित करना। ( ) U2OS कोशिकाओं को ते-एनओसी प्रोटोकॉल (ऊपरी पंक्ति) या एचयू प्रोटोकॉल (निचली पंक्ति) द्वारा जी 1 / एस संक्रमण में एम चरण में सिंक्रनाइज़ किया गया था। रसायनों से जारी होने के बाद प्रत्येक 3 घंटे कोशिकाओं की डीएनए सामग्री के पीआई धुंधला और एफएसीएस विश्लेषण द्वारा सेल चक्र की प्रगति की निगरानी की गई थी। शिखर सम्मेलन का उपयोग एफएसीएस डेटा विश्लेषण के लिए किया गया था। तेर-एनओसी-मध्यस्थता से प्राप्त हुई गिरफ्तारी से जारी कक्षों में 3 घंटे के बाद प्रारंभिक G1 चरण में तुल्यकालिक रूप से प्रवेश किया गया और बाद के समय बिंदुओं पर समान रूप से एस चरण तक प्रगति हुई। एसयू और जी 2 चरणों के माध्यम से समन्वयित एचयू-मध्यस्थता गिरफ्तारी से जारी कोशिकाओं। रिहाई के बाद कोशिकाओं को एकत्रित किए गए कोशिकाओं में सेल तुल्यकालन की सीमाओं का प्रतिनिधित्व किया गया था, क्योंकि अगले चरण की प्रगति केवल प्राप्त होती थीआबादी के एक अंश से घ। ( बी ) सेल सिंक्रनाइज़ेशन को हर 3 घंटे में प्रोटीन नमूनों को इकट्ठा करके और 15 घंटे तक रिलीज होने के बाद पश्चिमी ब्लोट विश्लेषण द्वारा मॉनिटर किया गया था। साइक्लिन ई 1 (सीसीएनई 1) की अभिव्यक्ति कैनेटीक्स, मुख्य रूप से एस चरण, साइक्लीन बी 1 (सीसीएनबी 1) के माध्यम से जमा हुआ एक साइक्लिन, मुख्य रूप से जी 2 से एम चरण और पीएच 3 से मौजूद है, मैटोटिक कोशिकाओं के लिए एक मार्कर, फ्लो साइटमैट्री द्वारा मनाया गया पुष्टि कोशिका चक्र वितरण प्रोफाइल एक्टिन बी (एक्टब) का प्रयोग अंतर्जात लोडिंग कंट्रोल के रूप में किया गया था क्योंकि इसका स्तर सेल चक्र-निर्भर नहीं है। (जैसा कि मिट्सेलेना एट अल से संशोधित किया गया है 8 ) इस आंकड़े के एक बड़े संस्करण को देखने के लिए कृपया यहां क्लिक करें

चित्रा 4
चित्रा 4: सेल चक्र चरण-निर्भर का अध्ययन टी परिपूरक सेल तुल्यकालन पद्धतियों द्वारा E2F परिवार के सदस्यों का ट्रांसक्रिप्शन U2OS कोशिकाओं को ते-एनओसी प्रोटोकॉल द्वारा जी 2 / एम में या एच 1 के उपचार द्वारा जी 1 / एस में गिरफ्तार किया गया था, और आरएनए निष्कर्षण के लिए नमूने एकत्र किए गए थे और एफएसीएस विश्लेषण हर 3 घंटे तक गिरफ्तारी से मुक्त होने पर 15 घंटे तक प्राप्त किया गया था। आरटी-क्यूपीसीआर द्वारा जीन अभिव्यक्ति विश्लेषण ने एक ई 2 एफ 1 अभिव्यक्ति प्रोफाइल को मुख्य रूप से जी 1 (ऊपरी बाएं ग्राफ) तक सीमित कर दिया जबकि ई 2 एफ 7 जीन एक्सप्रेशन प्रोफाइल को एस चरण में स्थानांतरित कर दिया गया था, जी 2 चरण (निचले दाएं ग्राफ) के माध्यम से क्रमिक डाउन्र्र्यूलेशन के साथ। एमबीएनए स्तरों में सापेक्ष परिवर्तनों की गणना करने के लिए टीबीपी को अंतर्जात गैर-सेल चक्र-विनियमित जीन के रूप में इस्तेमाल किया गया था और परिणाम को मूल मूल्यों और मानक विचलन (एसडी) के रूप में दर्शाया गया था। कोशिका चक्र के माध्यम से प्रगति कोशिकाओं की डीएनए सामग्री के पीआई धुंधला और एफएसीएस विश्लेषण द्वारा निर्धारित किया गया था। सेल चक्र चरण ग्राफ़ में पृष्ठभूमि रंग के रूप में प्रस्तुत किया गया था: काला (जल्दी में विसर्जित होने पर गिरफ्तारी), हरा (जी 1 चरण), लाल (एस चरण) और नीले (जी 2 चरण)।.com / files / ftp_upload / 55745 / 55745fig4large.jpg "target =" _ blank "> कृपया इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्रा 5
चित्रा 5: जीन एक्सप्रेशन और सेल साइकिल प्रगति पर एमएमसी का प्रभाव। यू 2ओएस कोशिकाओं का इलाज एचयू के साथ 24 घंटे के लिए किया गया था, और एमएमसी (250 एनएम) एचयू-मध्यस्थताकृत जी 1 / एस गिरफ्तारी से जारी होने के तुरंत बाद जोड़ा गया था। एफएसीएस विश्लेषण और जीन अभिव्यक्ति विश्लेषण के नमूने निर्धारित समय बिंदु पर एकत्र किए गए थे। ( ) सेल चक्र के माध्यम से प्रगति को शिखर सम्मेलन सॉफ्टवेयर द्वारा डीआईए सामग्री के पीआई धुंधला और एफएसीएस विश्लेषण द्वारा निर्धारित किया गया था। एमएमसी ने एस चरण (लाल आबादी) और जी 2 चरण (नीली आबादी) में स्थायी गिरफ्तारी में प्रगति में एक उदार विलंब को प्रेरित किया, जैसा कि जी 1 (हरी आबादी) में कोशिकाओं की अनुपस्थिति के अनुसार दिखाया गया है कि उपचार के 15 घंटे (कम पंक्ति) के बाद गैर-इलाज (ऊपरी पंक्ति) कोशिकाओं ( बी ) ई 2 एफ 1 और पी 21 सीपी 1 जीन एक्सपीसिशन विश्लेषण में एमएमसी इलाज या अनुपचारित कोशिकाओं को एमआरएनए स्तर पर RT-qPCR द्वारा किया गया था। ऑक्सीए 1 एल को अंतर्जात गैर-एमएमसी-प्रतिक्रियाजनक जीन के रूप में इस्तेमाल किया गया था और परिणाम को मूल मूल्यों और एसडी के रूप में दर्शाया गया था। एचयू से जारी होने और एमएमसी के अतिरिक्त होने के बाद ऊपरी रेखांकन चयनित जीनों के रिश्तेदार एमआरएनए स्तर का प्रतिनिधित्व करता है। निचला रेखांकन एफएसीएस विश्लेषण और आरटी- qPCR द्वारा प्राप्त आंकड़ों को मिलाते हैं। इस आंकड़े के एक बड़े संस्करण को देखने के लिए कृपया यहां क्लिक करें

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

सेल चक्र में क्षणिक और विशिष्ट भूमिकाओं में शामिल ठीक धुन विनियमित जीनों का विश्लेषण एक समान सेल आबादी की आवश्यकता है। कई शोधकर्ता नियमित रूप से इन उद्देश्यों के लिए लंबे समय से स्थापित ट्यूमर सेल लाइनों का उपयोग करते हैं, और सिंक्रोनस (या आंशिक रूप से तुल्यकालिक) सेल आबादी प्राप्त करने के लिए कई तरह के तरीकों को विकसित किया गया है, जिसका लक्ष्य निर्धारित कोशिका चक्र चरणों में संभवतः कई कोशिकाओं को जमा करना है। इसके अलावा, अच्छी तरह से स्थापित सिंक्रनाइज़ेशन दृष्टिकोणों को बेहतर बनाने और अनुकूलित करने के लिए मजबूत प्रयास किए गए हैं। फिर भी, सभी सिंक्रनाइज़ेशन प्रोटोकॉल में कमियां हैं, जो कि सेल संस्कृतियों की विविधता के लिए, सिंक्रनाइज़ेशन प्रक्रियाओं के उप-दक्षता के लिए, या दूसरे के बीच में सेल फ़ंक्शन में रासायनिक फ़र्क़ों वाले माध्यमिक प्रभावों के कारण हो सकते हैं। सेल सिंक्रनाइज़ेशन प्रोटोकॉल लागू करते समय इन सीमाओं को ध्यान में रखा जाना चाहिए शोधकर्ताओं को उनके विशिष्ट के लिए सबसे उपयुक्त सिंक्रनाइज़ेशन विधियों की पहचान करने की आवश्यकता हैआईसी कोशिका प्रकार या प्रयोग यहां तक ​​कि अलग-अलग सेल लाइनों को उसी तरीके से खेती भी करते हैं, जिसके परिणामस्वरूप सिंक्रनाइज़ेशन दरें कई कारणों से भिन्न हो सकती हैं। एक ओर, सेल चक्र की लंबाई चयनित सेल लाइन के आधार पर भिन्न हो सकती है; दूसरी ओर, एक ही अवरोध करनेवाला प्रत्येक सेल लाइन 25 के विशेष लक्षणों के कारण विभिन्न सेल लाइनों पर विपरीत प्रभाव हो सकता है। इसके अलावा, चयनित अवरोधक एकाग्रता और एक्सपोज़र समय को प्रत्येक सेल लाइन में समायोजित किया जाना चाहिए ताकि गैर-वांछनीय साइड-विषाक्तता 26 से बचने या उससे कम किया जा सके। इन सभी पहलुओं के अनुकूलन के बाद भी, किसी दिए गए सेल चक्र चरण में कोशिकाओं का 100% संचय प्राप्त नहीं किया जाता है, और रासायनिक 27 को हटाने के बाद असिंक्रनाइज धीरे-धीरे बढ़ जाता है। इस प्रकार, यह समझना महत्वपूर्ण है कि सिंक्रनाइज़ेशन पद्धतियों को किसी विशेष समय सीमा में सबसे अच्छा आंशिक सेल आबादी संपन्नताओं पर प्राप्त होता है।

इस डब्ल्यू में ओर्क दो सिंक्रनाइज़ेशन प्रक्रियाओं (ते-एनओसी और एचयू) को U2OS कोशिकाओं में उनके उपयोग के लिए अनुकूलित किया गया है, जिनमें से दोनों का उपयोग सेल सिंक्रनाइज़ेशन एलेल्स 28 , 29 , 30 के लिए बड़े पैमाने पर किया जाता है। एम चरण में कोशिकाओं को गिरफ्तार करने के लिए, थाइमिडीन और नकोडाज़ोल का संयोजन यू 2 ओएस कोशिकाओं में कुशलतापूर्वक काम करता है। नोकोडाजोल की साइटोटॉक्सिक प्रकृति को देखते हुए, यह केवल अत्यधिक अवरुद्ध कोशिका आबादी को प्राप्त करने के लिए जोखिम का समय और इस अवरोधक की मात्रा निर्धारित करना महत्वपूर्ण था, लेकिन इष्टतम सेल अस्तित्व भी। थाइमिडाइन (या सैद्धांतिक रूप से किसी भी अन्य इसी तरह के यौगिक जैसे कि हाइड्रोक्स्यूरिया) के पूर्व जोखिम से जी 1 और एस चरणों में सेल आबादी का संवर्धन हुआ, जिससे आवश्यक नोकडाज़ोल एक्सपोज़र समय कम हो गया। जी 1 / एस में कोशिकाओं को गिरफ्तार करने के लिए, कई संभावनाओं को माना जाता है, जिसमें डबल थेइमिडीन ब्लॉक शामिल है, एक विधि जो कई सेल लाइनों के सिंक्रनाइज़ेशन में बहुत कुशल है"> 31 , 32. हालांकि, थाइमिडीन को अपने निराशाजनक परिणाम को यू 2 ओएस में छोड़ दिया गया था। थाइमाइडिन उपचार के एक दौर में केवल एक अंश कोशिकाओं को गिरफ्तार किया गया था, जबकि थिइमिडीन के दो दौर में कुशलतापूर्वक जी 1 / एस में अधिकांश कोशिकाओं को अवरुद्ध किया गया था, लेकिन एक जी 1 थिइमिडीन से रिलीज होने के बाद जनसंख्या को बनाए रखा गया था और कोशिका चक्र की प्रगति समान रूप से आगे नहीं बढ़ी थी। इसके विपरीत, हाइड्रोक्स्यूरिया उपचार में जी 1 / एस अवरोधन परिणाम और एस के माध्यम से कोशिकाओं के समान प्रगति और जी 2 में प्रदान किया गया था।

जीन अभिव्यक्ति को बेहतर ढंग से व्याख्या करने के लिए, सेल चक्र चरण वितरण की जांच की जानी चाहिए, जब सेल सिंक्रनाइज़ेशन प्रयोगों का प्रदर्शन किया जाए ( उदाहरण के लिए प्रोपीडियम आयोडाइड स्टेनिंग या पीएच 3 लेबलिंग द्वारा एफएसीएस विश्लेषण के बाद, या सेल चक्र चरण-विशिष्ट प्रोटीन के प्रतिरक्षकों द्वारा) 16 , 33 , 34 परिणाम है। एक गलत सिंक्रनाइज़ेशन efficieसेल चक्र के माध्यम से प्रगति में ncy या मामूली अंतर-प्रायोगिक मतभेद गलत निष्कर्ष तक पहुंच सकते हैं उदाहरण के लिए, एनकोडाज़ोल उपचार कुछ शर्तों के तहत मित्सुशीय चेकपॉइंट फ़ंक्शन की विफलता के कारण जाना जाता है। इससे 4 सी डीएनए सामग्री वाली कोशिकाओं की आबादी बढ़ जाती है, लेकिन mitotic मार्करों के लिए नकारात्मक 34 कि "mitotic डिवीजन" और एक 4C सामग्री 35 के साथ interphase करने के लिए रिटर्न देता है। कोशिकाओं के इस सबसेट का उद्भव, जो एंटी-फॉस्फो-एच 3 एंटीबॉडी ( चित्रा 2 ए देखें) के साथ immunostaining द्वारा पता लगाया जा सकता है को कोकोडज़ोल वॉशिंग चरण के लिए ठंड पीबीएस के इस्तेमाल से कम किया जा सकता है। रासायनिक अवरोधकों के उपयोग से संबंधित एक अन्य प्रभाव है जो सेल तुल्यकालन को प्रभावित करता है, इन यौगिकों 36 , 37 , एक तंत्र के संपर्क के साथ चेकपॉइंट सक्रियण है, जिसके द्वारा कोशिका सक्रिय रूप से कोशिका चक्र के माध्यम से प्रगति को तब तक पकड़ लेता है जब तक कि यहसुनिश्चित करें कि उस सटीक बिंदु (जैसे सही डीएनए प्रतिकृति, स्पिंडल असेंबली) से पहले प्रक्रियाएं 38 को हल कर लेती हैं। एक सिंक्रनाइज़ेशन विधि के लिए पर्याप्त होने के लिए, गिरफ्तारी न केवल कुशल लेकिन पूरी तरह से प्रतिवर्ती होना चाहिए। इस प्रकार, सेल चक्र अवरोधकों के रिलीज होने के बाद, यह विश्लेषण करना महत्वपूर्ण है कि अवरोधक के प्रभाव को वापस कर दिया गया है, उदाहरण के लिए, चेकपॉइंट मार्करों जैसे पी 21 सीआईपी की अभिव्यक्ति का विश्लेषण करके। चित्रा 5 बी से पता चलता है कि हाइड्रोक्साइरिया-सिंक्रनाइज़ किए गए U2OS कोशिकाओं ने चेकपॉइंट को कुशलता से हल किया क्योंकि पी 21 सीआईपी स्तर रिलीज़ होने के बाद बेसल अभिव्यक्ति में घटा दिए गए थे।

यू 2 ओएस कोशिकाओं में, सेल चक्र गिरफ्तारी पर संवर्धन प्रतिशत सेल सिंक्रनाइज़ेशन 29 , 30 , 3 9 पर अन्य अध्ययनों द्वारा की गई श्रेणी के भीतर आती है: 4 सी डीएनए सामग्री (पीआई धुंधला हो जाना) के साथ लगभग 85% कोशिकाओं और लगभगथिइमाइडिन-नकोडाज़ोल उपचार पर एमटोसिस (पीएच 3 पॉज़िटिव लेबलिंग) में से 90%, और हाइड्रोक्स्यूरिया उपचार के बाद लगभग 80-90% जी 1 / एस कोशिकाओं में। सेल चक्र गिरफ्तारी से जारी होने से आम तौर पर अगले एक या दो चरणों में एक समान तरीके से उचित प्रगति होती है, हालांकि सिंक्रनाइज़ेशन को कई घंटों के बाद हमेशा खो दिया जाता है और कोशिकाओं को एक सिंक्रनाइज़ तरीके से पूरे सेल डिवीजन चक्र को पूरा करने में असमर्थ होते हैं। इसलिए, सेल चक्र के सभी चरणों की पूरी तस्वीर प्राप्त करने के लिए, इस काम में प्रस्तावित प्रोटोकॉल सेल चक्र के विभिन्न हिस्सों से दो सिंक्रनाइज़ेशन विधियों का उपयोग करता है। जैसा कि चित्रा 3 ए में दिखाया गया है, प्रत्येक व्यक्ति के प्रोटोकॉल ने एक पूरे सेल चक्र पर समरूपता सुनिश्चित नहीं किया। तेर-एनओसी-आधारित सिंक्रनाइज़ेशन जी 1 से एस चरणों में होने वाली प्रक्रियाओं के लिए उचित फ्रेम प्रदान करता है, जबकि एचयू से जारी कोशिकाओं एस और जी 2 / एम के दौरान होने वाली घटनाओं के विश्लेषण के लिए उपयुक्त थे। चयनित दो प्रक्रियाओं की पूरकताओंएस ई 2 एफ प्रतिलेखन कारक परिवार ( चित्रा 4 ) के दो सदस्यों के विश्लेषण द्वारा दिखाया गया था, इस विचार का समर्थन करते हुए कि सेल चक्र के विभिन्न चरणों में सिंक्रनाइज़ करने वाली दो विधियों का संयोजन सेल चक्र-विनियमित जीन अभिव्यक्ति पैटर्न और बेहतर उनकी शारीरिक भूमिका को समझने के लिए

सेल सिंक्रनाइज़ेशन प्रक्रियाओं का एक सम्मोहक अनुप्रयोग संभावित चिकित्सीय एजेंटों के प्रभाव का मूल्यांकन करने पर केंद्रित है। फार्मास्यूटिकल यौगिकों का असर, जैसे कि एंटीम्युमर गतिविधि वाले लोगों को अक्सर अतुल्यकालिक सेल आबादी में अध्ययन किया जाता है। इन सेटिंग्स के अंतर्गत, सेल की मृत्यु, सेल चक्र गिरफ्तारी या जनसंपर्क 7 , 40 जैसे कई प्रक्रियाओं को शामिल करने में चयनित दवा के निहितार्थ को निर्धारित करना संभव है। हालांकि, सटीक आणविक घटनाओं की पहचान करने के लिए अतुल्यकालिक सेल सेटिंग का चयन करनाऐसी प्रक्रियाओं से अपूर्ण या आंशिक गलत निष्कर्ष हो सकते हैं। इस बिंदु, जिसे अक्सर अनदेखी की जाती है, को ई 2 एफ 1 और पी 21 सीिप 1 जीन अभिव्यक्ति ( चित्रा 5 ) पर केमोथेरेप्यूटिक औषध एमएमसी के प्रभाव का विश्लेषण करके वर्तमान कार्य में सचित्र किया गया है। कुल मिलाकर, जीनोटॉक्सिक एजेंटों के साथ सेल सिंक्रोनाइजेशन और उपचार का संयोजन एक उपयुक्त संदर्भ प्रदान करता है जिसमें जीनटॉक्सिक एजेंट के प्रति उत्तरदायी जीन की अभिव्यक्ति का अध्ययन किया जाता है और एजेंट द्वारा लगाए गए सेल चक्र की परेशानी से प्रभावित उन लोगों से भेदभाव किया जाता है।

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखकों के पास खुलासे के लिए कुछ भी नहीं है।

Acknowledgments

हम उपयोगी चर्चाओं और तकनीकी सहायता के लिए जुबियागा और Altmeyer प्रयोगशालाओं के सदस्यों को धन्यवाद करते हैं। यह काम स्पैनिश मंत्रालय (एसएएफ2015-67562-आर, मिनएको / फेडर, यूई), बास्क सरकार (आईटी 634-13 और केके-2015/8 9) और बास्क देश यूपीवी / ईएचयू विश्वविद्यालय से अनुदान द्वारा समर्थित था ( UFI11 / 20)।

Materials

Name Company Catalog Number Comments
DMEM, high glucose, GutaMAX supplement Thermo Fisher Scientific 61965-059
FBS, qualified, E.U.-approved, South America origin Thermo Fisher Scientific 10270-106
Penicillin-Streptomycin (10,000 U/mL) Thermo Fisher Scientific 15140-122
0.25% Trypsin-EDTA (1x), phenol red Thermo Fisher Scientific 25200-072
Thymidine SIGMA T1895-5G Freshly prepared. Slight warming might help dissolve thymidine.
Nocodazole SIGMA M-1404 Stock solution in DMSO stored at -20 ºC in small aliquots
Hydroxyurea SIGMA H8627 Freshly prepared
Mitomycin C from Streptomyces caespitosus SIGMA M4287 1.5 mM stock solution in sterile H2O protected from light and stored at 4 ºC
Dimethyl sulfoxide SIGMA D2650
Propidium iodide SIGMA P4170 Stock solution in sterile PBS at 5 mg/ml, stored at 4 º C protected from light.
PBS pH 7.6 Home made
Ethanol PANREAC A3678,2500
Chloroform SIGMA C2432
Sodium Citrate PANREAC 131655
Triton X-100 SIGMA T8787
RNAse A Thermo Fisher Scientific EN0531
TRIzol Reagent LifeTechnologies 15596018
RNeasy Mini kit QIAGEN 74106
High-Capacity cDNA Reverse Transcription Kit Thermo Fisher Scientific 4368814
Anti-Cyclin E1 antibody Cell Signaling 4129 1:1000 dilution in 5% milk, o/n, 4 ºC
Anti-Cyclin B1 antibody Cell Signaling 4135 1:1000 dilution in 5% milk, o/n, 4 ºC
Anti-β-actin SIGMA A-5441 1:3000 dilution in 5 % milk, 1 hr, RT
Anti-pH3 (Ser 10) antiboty Millipore 06-570 Specified in the protocol
Secondary anti-rabbit AlexaFluor 488 antibody Invitrogen R37116 Specified in the protocol
Secondary anti-mouse-HRP antibody Santa Cruz Biotechnology sc-3697 1:3000 dilution in 5 % milk, 1 hr, RT
Forward E2F1 antibody (human)                    TGACATCACCAACGTCCTTGA Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse E2F1 antibody (human)                    CTGTGCGAGGTCCTGGGTC Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward E2F7 antibody (human)                    GGAAAGGCAACAGCAAACTCT Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse E2F7 antibody (human)                    TGGGAGAGCACCAAGAGTAGAAGA Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward p21Cip1 antibody (human)                    AGCAGAGGAAGACCATGTGGAC Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse p21Cip1 antibody (human)                    TTTCGACCCTGAGAGTCTCCAG Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward TBP antibody (human) reference gene                     Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse TBP antibody (human)                     Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward Oxa1L antibody (human) reference gene   CACTTGCCAGAGATCCAGAAG                  Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse Oxa1L  antibody (human)    CACAGGGAGAATGAGAGGTTTATAG                 Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Power SYBRGreen PCR Master Mix Thermo Fisher Scientific 4368702
FACS Tubes  Sarstedt 551578
MicroAmp Optical 96-Well Reaction Plate Thermo Fisher Scientific N8010560
Corning 100 mm TC-Treated Culture Dish Corning
Corning Costar cell culture plates 6 well Corning 3506
Refrigerated Bench-Top Microcentrifuge Eppendorf 5415 R
Refrigerated Bench-Top Centrifuge Jouan CR3.12 Jouan 743205604
NanoDrop Lite Spectrophotometer Thermo Scientific ND-LITE-PR
BD FACSCalibur Flow Cytometer BD Bioscience
QuantStudio 3 Real-Time PCR System Thermo Fisher Scientific A28567

DOWNLOAD MATERIALS LIST

References

  1. Beato, M., Sánchez-Aguilera, A., Piris, M. A. Cell cycle deregulation in B-cell lymphomas. Blood. 101, (4), 1220-1235 (2003).
  2. Chen, H. Z., Tsai, S. Y., Leone, G. Emerging roles of E2Fs in cancer: an exit from cell cycle control. Nat Rev Cancer. 9, (11), 785-797 (2009).
  3. Cho, R. J., et al. Transcriptional regulation and function during the human cell cycle. Nat Genet. 27, (1), 48-54 (2001).
  4. Peña-Diaz, J., et al. Transcription profiling during the cell cycle shows that a subset of Polycomb-targeted genes is upregulated during DNA replication. Nucleic Acids Res. 41, (5), 2846-2856 (2013).
  5. Grant, G. D., et al. Identification of cell cycle-regulated genes periodically expressed in U2OS cells and their regulation by FOXM1 and E2F transcription factors. Mol Biol Cell. 24, (23), 3634-3650 (2013).
  6. Minderman, H., et al. In vitro and in vivo irinotecan-induced changes in expression profiles of cell cycle and apoptosis-associated genes in acute myeloid leukemia cells. Mol Cancer Ther. 4, (6), 885-900 (2005).
  7. McKenna, E., Traganos, F., Zhao, H., Darzynkiewicz, Z. Persistent DNA damage caused by low levels of mitomycin C induces irreversible cell senescence. Cell Cycle. 11, (16), 3132-3140 (2012).
  8. Infante, A., et al. E2F2 represses cell cycle regulators to maintain quiescence. Cell Cycle. 7, (24), 3915-3927 (2008).
  9. Cecchini, M. J., Amiri, M., Dick, F. A. Analysis of cell cycle position in mammalian cells. J Vis Exp. (59), (2012).
  10. Schorl, C., Sedivy, J. M. Analysis of cell cycle phases and progression in cultured mammalian cells. Methods. 41, (2), 143-150 (2007).
  11. Lalande, M. A reversible arrest point in the late G1 phase of the mammalian cell cycle. Exp Cell Res. 186, (2), 332-339 (1990).
  12. Park, S. Y., et al. Mimosine arrests the cell cycle prior to the onset of DNA replication by preventing the binding of human Ctf4/And-1 to chromatin via Hif-1α activation in HeLa cells. Cell Cycle. 11, (4), 761-766 (2012).
  13. Ikegami, S., et al. Aphidicolin prevents mitotic cell division by interfering with the activity of DNA polymerase-alpha. Nature. 275, (5679), 458-460 (1978).
  14. Baranovskiy, A. G., et al. Structural basis for inhibition of DNA replication by aphidicolin. Nucleic Acids Res. 42, (22), 14013-14021 (2014).
  15. Adams, R. L., Lindsay, J. G. Hydroxyurea reversal of inhibition and use as a cell-synchronizing agent. J Biol Chem. 242, (6), 1314-1317 (1967).
  16. Mitxelena, J., Apraiz, A., Vallejo-Rodríguez, J., Malumbres, M., Zubiaga, A. M. E2F7 regulates transcription and maturation of multiple microRNAs to restrain cell proliferation. Nucleic Acids Res. (2016).
  17. Bootsma, D., Budke, L., Vos, O. Studies on synchronous division of tissue culture cells initiated by excess thymidinE. Exp Cell Res. 33, 301-309 (1964).
  18. Galgano, P. J., Schildkraut, C. L. G1/S Phase Synchronization using Double Thymidine Synchronization. CSH Protoc. (2), (2006).
  19. Edwin Taylor, W. Kinetics of inhibition and the binding of h3-colchicine. J Cell Biol. 25, 145-160 (1965).
  20. Zieve, G. W., Turnbull, D., Mullins, J. M., McIntosh, J. R. Production of large numbers of mitotic mammalian cells by use of the reversible microtubule inhibitor nocodazole. Nocodazole accumulated mitotic cells. Exp Cell Res. 126, (2), 397-405 (1980).
  21. Matsui, Y., Nakayama, Y., Okamoto, M., Fukumoto, Y., Yamaguchi, N. Enrichment of cell populations in metaphase, anaphase, and telophase by synchronization using nocodazole and blebbistatin: a novel method suitable for examining dynamic changes in proteins during mitotic progression. Eur J Cell Biol. 91, (5), 413-419 (2012).
  22. Nolan, T., Hands, R. E., Bustin, S. A. Quantification of mRNA using real-time RT-PCR. Nat Protoc. 1, (3), 1559-1582 (2006).
  23. Thornton, B., Basu, C. Real-time PCR (qPCR) primer design using free online software. Biochem Mol Biol Educ. 39, (2), 145-154 (2011).
  24. Abbas, T., Dutta, A. p21 in cancer: intricate networks and multiple activities. Nat Rev Cancer. 9, (6), 400-414 (2009).
  25. Kung, A. L., Sherwood, S. W., Schimke, R. T. Cell line-specific differences in the control of cell cycle progression in the absence of mitosis. Proc Natl Acad Sci U S A. 87, (24), 9553-9557 (1990).
  26. Borel, F., Lacroix, F. B., Margolis, R. L. Prolonged arrest of mammalian cells at the G1/S boundary results in permanent S phase stasis. J Cell Sci. 115 (Pt. 14, 2829-2838 (2002).
  27. Knehr, M., et al. A critical appraisal of synchronization methods applied to achieve maximal enrichment of HeLa cells in specific cell cycle phases). Exp Cell Res. 217, (2), 546-553 (1995).
  28. Zhu, W., Giangrande, P. H., Nevins, J. R. E2Fs link the control of G1/S and G2/M transcription. EMBO J. 23, (23), 4615-4626 (2004).
  29. Whitcomb, E. A., Dudek, E. J., Liu, Q., Taylor, A. Novel control of S phase of the cell cycle by ubiquitin-conjugating enzyme H7. Mol Biol Cell. 20, (1), 1-9 (2009).
  30. Bruinsma, W., Macurek, L., Freire, R., Lindqvist, A., Medema, R. H. Bora and Aurora-A continue to activate Plk1 in mitosis. J Cell Sci. 127, 801-811 (2014).
  31. Thomas, D. B., Lingwood, C. A. A model of cell cycle control: effects of thymidine on synchronous cell cultures. Cell. 5, (1), 37-42 (1975).
  32. Whitfield, M. L., et al. Identification of genes periodically expressed in the human cell cycle and their expression in tumors. Mol Biol Cell. 13, (6), 1977-2000 (2002).
  33. Lim, S., Cdks Kaldis, P. cyclins and CKIs: roles beyond cell cycle regulation. Development. 140, (15), 3079-3093 (2013).
  34. Tapia, C., et al. Two mitosis-specific antibodies, MPM-2 and phospho-histone H3 (Ser28), allow rapid and precise determination of mitotic activity. Am J Surg Pathol. 30, (1), 83-89 (2006).
  35. Andreassen, P. R., Martineau, S. N., Margolis, R. L. Chemical induction of mitotic checkpoint override in mammalian cells results in aneuploidy following a transient tetraploid state. Mutat Res. 372, (2), 181-194 (1996).
  36. Wei, F., Xie, Y., He, L., Tao, L., Tang, D. ERK1 and ERK2 kinases activate hydroxyurea-induced S-phase checkpoint in MCF7 cells by mediating ATR activation. Cell Signal. 23, (1), 259-268 (2011).
  37. Kubota, S., et al. Activation of the prereplication complex is blocked by mimosine through reactive oxygen species-activated ataxia telangiectasia mutated (ATM) protein without DNA damage. J Biol Chem. 289, (9), 5730-5746 (2014).
  38. Hartwell, L. H., Weinert, T. A. Checkpoints: controls that ensure the order of cell cycle events. Science. 246, (4930), 629-634 (1989).
  39. St-Denis, N. A., Derksen, D. R., Litchfield, D. W. Evidence for regulation of mitotic progression through temporal phosphorylation and dephosphorylation of CK2alpha. Mol Cell Biol. 29, (8), 2068-2081 (2009).
  40. Min, A., et al. RAD51C-deficient cancer cells are highly sensitive to the PARP inhibitor olaparib. Mol Cancer Ther. 12, (6), 865-877 (2013).
दो पूरक सेल तुल्यकालन प्रोटोकॉल द्वारा सेल चक्र-विनियमित जीन अभिव्यक्ति का अध्ययन करना
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Apraiz, A., Mitxelena, J., Zubiaga, A. Studying Cell Cycle-regulated Gene Expression by Two Complementary Cell Synchronization Protocols. J. Vis. Exp. (124), e55745, doi:10.3791/55745 (2017).More

Apraiz, A., Mitxelena, J., Zubiaga, A. Studying Cell Cycle-regulated Gene Expression by Two Complementary Cell Synchronization Protocols. J. Vis. Exp. (124), e55745, doi:10.3791/55745 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter