Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Estudando a expressão de genes regulada pelo ciclo celular por dois protocolos complementares de sincronização de células

doi: 10.3791/55745 Published: June 6, 2017
* These authors contributed equally

Summary

Relatamos dois protocolos de sincronização de células que fornecem um contexto para estudar eventos relacionados a fases específicas do ciclo celular. Mostramos que essa abordagem é útil para analisar a regulação de genes específicos em um ciclo celular não perturbado ou após a exposição a agentes que afetam o ciclo celular.

Abstract

O programa de expressão gênica do ciclo celular representa um passo crítico para a compreensão dos processos dependentes do ciclo celular e seu papel em doenças como o câncer. A análise de expressão de genes regulada pelo ciclo celular depende da sincronização celular em fases específicas. Aqui descrevemos um método que utiliza dois protocolos de sincronização complementares que é comumente usado para estudar a variação periódica da expressão gênica durante o ciclo celular. Ambos os procedimentos são baseados no bloqueio transitório do ciclo celular em um ponto definido. O protocolo de sincronização pelo tratamento com hidroxiureia (HU) leva à prisão celular na fase final G1 / início da S e a liberação da prisão mediada por HU fornece uma população celular progredindo uniformemente através de S e G2 / M. O protocolo de sincronização pelo tratamento com timidina e nocodazol (Thy-Noc) bloqueia as células na mitosis precoce e a liberação da prisão mediada por Thy-Noc fornece uma população celular sincronizada adequada para a fase G1 e a fase S-enTente estudos. A aplicação de ambos os procedimentos requer o monitoramento dos perfis de distribuição do ciclo celular, que normalmente é realizado após a coloração do iodeto de propídio (PI) das células e a análise mediada por citometria de fluxo do conteúdo de DNA. Mostramos que o uso combinado de dois protocolos de sincronização é uma abordagem robusta para determinar claramente os perfis transcricionais de genes que são diferencialmente regulados no ciclo celular ( ie E2F1 e E2F7) e, conseqüentemente, ter uma melhor compreensão de seu papel no ciclo celular Processos. Além disso, mostramos que essa abordagem é útil para o estudo de mecanismos subjacentes a terapias baseadas em drogas ( ou seja, mitomicina C, um agente anticancerígeno), porque permite discriminar genes que respondem ao agente genotóxico daqueles que são exclusivamente afetados por perturbações do ciclo celular Imposto pelo agente.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

A transição através de todas as fases do ciclo celular é acoplada a um programa de expressão de genes bem regulado. Este coordenado "ligado e desligado" da transcrição de genes ao longo do ciclo celular acredita estar sob o controle de sistemas regulatórios transcricionais complexos, regulando não apenas o tempo, mas também os níveis de expressão gênica. É sabido que a desregulamentação dos principais componentes do ciclo celular contribui para o desenvolvimento de várias doenças e é uma marca bem estabelecida da tumorigênese 1 , 2 . As análises transcriptômicas do genoma realizadas em células de leveduras e mamíferos revelaram que um grande número de genes exibem padrões periódicos de expressão gênica no ciclo celular, sugerindo que a flutuação da transcrição durante o ciclo celular é um reflexo do requisito temporal de um determinado produto de gene Em uma fase precisa 3 , 4 , 5 .

Uma tarefa importante no estudo da expressão de genes regulados pelo ciclo celular é a sincronização de células em fases específicas do ciclo celular. A sincronização celular ajuda a interpretar a associação de um padrão de expressão genética a uma transição de fase específica do ciclo celular e levou a uma melhor compreensão da regulação e função de vários genes. A sincronização celular também é importante para estudar o mecanismo de ação de fármacos anticancerígenos, já que os agentes quimioterapêuticos afetam tanto a expressão gênica como a cinética do ciclo celular 6 , 7 . No entanto, muitas vezes é difícil determinar se as diferenças de expressão gênica resultantes do tratamento com esses agentes são uma resposta direta ao tratamento ou são apenas a conseqüência de mudanças nos perfis do ciclo celular. Para distinguir entre essas possibilidades, a expressão gênica deve ser analisada em células que foram sE sincronizado antes da adição do medicamento quimioterapêutico.

Com a exceção de algumas células primárias, como células linfóides recém-isoladas - que constituem uma população de células homogêneas sincronizadas em G0 8 -, as linhas celulares estabelecidas in vitro crescem de forma assíncrona em cultura. Sob condições de crescimento regulares, essas células de ciclagem assíncrona são encontradas em todas as fases do ciclo celular, mas preferencialmente em G1 9 . Portanto, esse contexto não fornece um cenário ótimo para análises de expressão funcional ou genética em uma fase específica do ciclo celular ( por exemplo , G1, S, etc.). As linhas celulares imortalizadas não transformadas ( por exemplo, fibroblastos) podem ser sincronizadas com os chamados métodos fisiológicos 10 . Esses métodos são baseados nos recursos de células primárias retidos das células não transformadas, como a inibição do contato celular e a dependência do fator de crescimento para continuar a andar de bicicleta. RemoçãoDe soro em combinação com inibição de contato torna as células não transformadas presas em G0 / G1. No entanto, a entrada e progressão sincronizada do ciclo celular muitas vezes requer subcultura, o que também envolve o desprendimento artificial das células e re-chapeamento 10 . Mais importante ainda, este método não é adequado para a sincronização de linhas celulares transformadas, a grande maioria das linhas celulares estabelecidas atualmente em uso, caracterizada por falta de inibição do crescimento mediada por contato celular ou resposta à retirada do fator de crescimento. Assim, é claro que são necessários métodos alternativos para a sincronização celular eficiente em fases específicas do ciclo celular. Em termos gerais, os métodos de sincronização mais utilizados são baseados em inibição química ou farmacológica transitória de um ponto definido do ciclo celular, tipicamente síntese de DNA ou formação de fuso mitótico. A inibição da síntese do DNA sincroniza as células prendendo-as no final da fase G1 ou inicial S. Isso pode ser achiEvitado pela adição de compostos como a mimosina, um inibidor da biossíntese de nucleótidos 11 , 12 , a afidicolina, um inibidor das polimerases de ADN 13 , 14 , a hidroxiureia, um inibidor da ribonucleótido redutase 15 , 16 ou por quantidades excessivas de timidina 17 , 18 . Por outro lado, os inibidores da polimerização de microtúbulos, como a colchicina ou o nocodazol, são capazes de bloquear a formação de fuso mitótico, levando à sincronização celular no início da fase M 19 , 20 , 21 .

Neste trabalho descrevemos um método envolvendo dois protocolos de sincronização complementares baseados na inibição química transitória para estudar a expressão de genes regulados pelo ciclo celular no mRNAnível. Este método é fundamental para definir o papel dos genes do ciclo celular em processos específicos do ciclo celular. Além disso, fornece um quadro geral para estudar o impacto de tratamentos anticancerígenos, a fim de detectar com precisão os genes sensíveis a drogas e minimizar as interpretações erradas derivadas de perturbações na progressão do ciclo celular gerada por esses medicamentos.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Sincronização, liberação e monitoramento celular da progressão do ciclo celular

  1. Timidina e nocodazol (Thy-Noc) sincronização e liberação de células U2OS da mitose
    1. Prepare o meio de cultura celular necessário. As células U2OS são cultivadas rotineiramente em meio DMEM-Glutamina complementado com 10% (vol / vol) de FBS (opcional: 1% de penicilina / estreptomicina). Execute toda a preparação e manipulação do meio em condições estéreis e aquecer o meio complementado (a partir de agora referido como "meio completo") a 37 ° C antes de usar.
    2. Semente 2 x 10 6 células U2OS por placa de 100 mm em 10 mL de meio de cultura completo. Para calcular o número de pratos necessários, tenha em conta que cada prato de 100 mm geralmente fornece células mitóticas suficientes para re-colocar aproximadamente 5 poços de uma placa de 6 poços (0,2-0,25 x 10 6 células / poço) (ver Figura 1B ). Dois poços por ponto de tempo selecionado são requeridosEd no experimento (1 poço para extração de RNA e 1 poço para monitorização do ciclo celular). Além disso, um terceiro poço pode ser coletado por ponto de tempo para análise de proteínas.
      NOTA: células de placa à noite (cerca de 7 da noite) para que as etapas subsequentes possam ser realizadas durante o horário de trabalho nos dias seguintes. Inclua 2 poços adicionais de células de crescimento assíncrono para definir as configurações de compensação de análise FACS.
    3. Deixe as células se juntarem incubando pratos de 100 mm a 37 ° C numa atmosfera humidificada com 5% de CO 2 durante 24 h.
    4. Para o bloqueio de timidina, preparar uma solução de reserva de timidina 200 mM dissolvendo 145,2 mg de pó de timidina em 3 mL de H 2 O (ou quantidades equivalentes) e esterilizar a solução por filtração através de um filtro de tamanho de poro de 0,2 μm. Um leve aquecimento pode ajudar a dissolver a timidina. Adicione 100 μL do estoque 200 mM recentemente preparado a cada prato de cultura de 100 mm (concentração final de 2 mM). Incubar células com timidina durante 20 h a 37ºC76; C em uma atmosfera humidificada com 5% de CO 2 .
      NOTA: Tratar celas à noite (cerca de 7 horas), ter tempo para realizar a liberação de timidina e nocodazol no dia seguinte.
    5. Para libertar do bloqueio de timidina, remova o meio de crescimento contendo timidina na tarde do dia seguinte (3 horas); Lavar as células duas vezes com 1x PBS pré-aquecido e adicionar 10 mL de meio completo a cada prato de 100 mm. Incubar células durante 5 h a 37 ° C numa atmosfera humidificada com 5% de CO 2 .
    6. Para a prisão de células mitóticas, adicione nocodazol a uma concentração final de 50 ng / mL (8 horas). Prepare uma solução de reserva dissolvendo o pó de nocodazol em DMSO ( por exemplo, 5 mg / mL) e armazene congelado a -20 ° C. Incubar células com nocodazol por não mais de 10 a 11 h a 37 ° C numa atmosfera humidificada com 5% de CO 2 .
    7. Liberação da prisão mediada por nocodazol na fase M inicial (mitotic shake-off) e coleta de amostras em várias vezes poiNts (a partir das 6-7 da manhã).
      1. Descarte as células arredondadas (mitóticas) agitando cada placa e pipetando suavemente o meio de crescimento contendo nocodazol. Colete o meio com células separadas de cada placa de 100 mm em tubos estéreis de 50 mL, centrifugue (300 xg, 5 min, temperatura ambiente (RT)) e lave duas vezes por adição de 1x PBS seguido por centrifugação. O uso de PBS frio ou PBS plus nocodazole é recomendado para evitar deslizamento mitótico (ver seção de Discussão).
      2. Ressuspender as células mitóticas recolhidas de cada placa de 100 mm em 10 mL de meio completo. Economize 2 mL para extração de RNA e 2 mL para análise FACS para o ponto de tempo de 0 h (aproximadamente 0,2-0,25 x 10 6 células por amostra).
      3. Replaca as células mitóticas restantes para pontos de tempo subsequentes em placas de 6 poços (2 mL / poço, 0,2-0,25 x 10 6 células / poço).
        NOTA: Lembre-se de que são necessários 2 poços por ponto de tempo selecionado (1 para RNA e 1 para análise FACS).
    8. Coletar amostras no selPontos de tempo. Todas as 1,5 a 3 h são recomendadas para obter um perfil adequado da progressão do ciclo celular.
      1. Para extração de RNA, remova o meio, enxague bem com 2 mL de pré-aquecimento 1x PBS e adicione 1 mL de reagente de isolamento de RNA adequado ( por exemplo, TRIzol) no poço (execute este último passo em um gabinete de segurança para produtos químicos). Pipetar para cima e para baixo para separar e lisar células, transferir lisado celular para um tubo de microcentrífuga de 1,5 mL, incubar 5 min na RT e armazenar o tubo a -80 ° C até o uso posterior.
      2. Para a análise FACS, enxágue bem com 2 mL de pré-aquecimento 1x PBS, adicione solução de tripsina-EDTA pré-aquecida (0,3 mL / poço) para separar as células, bloqueie a tripsina-EDTA adicionando 1 mL de meio completo e colete cada amostra separadamente Tubo de 15 mL.
        1. Células de centrifugação (300 xg, 5 min, RT), salve o sedimento celular e descarta o sobrenadante. A fim de consertar células, ressuspenda as células em 1 mL de etanol refrigerado a 70% (v / v) em 1x PBS por tubos suavemente vórtex e coloque-os no gelo para o aplicativoCerca de 15 min antes de armazenar a 4 ° C ou a coloração para posterior análise por FACS (descrito nos passos 1.4 - 1.5).
  2. Sincronização baseada em HU e liberação de células U2OS do limite G1 / S
    1. Prepare o meio completo de cultura de células como descrito no passo 1.1.
    2. Semente 0,25 x 10 6 células U2OS por poço em placas de 6 poços (2 mL de meio de cultura completo por poço). Para calcular o número de poços necessários para o experimento, tenha em conta que serão necessários 2 poços por ponto de tempo selecionado (1 poço para extração de RNA e 1 poço para monitoração do ciclo celular) e que 2 poços adicionais de células de crescimento assíncrono são Precisava definir as configurações de compensação de análise FACS.
    3. As células se ligam por incubação de placas de 6 poços durante a noite (O / N) a 37 ° C numa atmosfera humidificada com 5% de CO 2 .
    4. Remova o meio completo dos poços na manhã seguinte e adicione 2 mLDe meio DMEM-Glutamina pré-aquecido sem FBS por poço. Incubar células durante mais 24 h a 37 ° C em uma atmosfera humidificada com 5% de CO 2 .
      NOTA: Execute esta etapa em todos os poços, exceto para 2 (aqueles salvos para definir configurações FACS). O passo de retirada de soro pode ser omitido se a sincronização eficiente for conseguida simplesmente incubando células com HU.
    5. Parada do ciclo celular G1 / S com HU.
      1. Prepare uma solução de reserva fresca de HU (500 mM) antes de cada uso. Adicione 2 mL de H 2 O a 76,06 mg de pó de HU e misture até dissolver completamente. Esterilize a solução por filtração através de um filtro de tamanho de poro de 0,2 μm. Misture 50 mL de meio completo com 400 μL de solução de reserva de HU esterilizada por filtro para uma concentração final de HU de 4 mM.
      2. Remova o meio de todos os poços, exceto dos 2 poços necessários para a definição das configurações de FACS e substitua-os por um meio completo contendo 2 mM de HU preparado recentemente (2 mL / poço).
      3. Incube células por 24 h emMeio contendo HU a 37 ° C numa atmosfera humidificada com 5% de CO 2 .
    6. Liberação de células da prisão mediada por HU. Remova o meio contendo HU dos poços e enxágue os poços duas vezes com 1x PBS pré-aquecido (2 mL a cada vez). Adicione 2 mL de meio completo por poço. Coletar 2 amostras para o ponto de tempo de 0 h (1 para extração de RNA e 1 para verificação de parada de ciclo celular por FACS), bem como 2 amostras salvas para configurações de FACS. Coloque os poços remanescentes na incubadora.
    7. Coletar amostras a cada 1,5 a 3 h para obter uma distribuição adequada da progressão do ciclo celular. Em cada ponto de tempo, execute um processamento de amostra (para extração de RNA e análise FACS) conforme descrito em 1.1.8.1-1.1.8.2.
  3. Tratamento com agentes prejudiciais ao DNA
    NOTA: Sempre que o objetivo é elucidar o efeito de um composto ( por exemplo , agentes prejudiciais ao DNA) nos eventos do ciclo celular, qualquer um dos métodos de sincronização descritos anteriormente pode serCombinado com o tratamento de células com o agente genotóxico. Para selecionar o método de sincronização, é importante considerar a fase do ciclo celular que gostaríamos de analisar. Em geral, o procedimento de Thy-Noc pode ser adequado para estudar o efeito de um composto em fase G1 ou entrada de fase S, enquanto a sincronização mediada por HU pode ser mais adequada para estudar o impacto nas fases S a G2 ou na entrada na mitose.
    1. Análise do efeito de agentes genotóxicos na fase G1 ou na entrada da fase S
      1. Sincronize células como descrito em 1.1.2. Para 1.1.6.
      2. Libere as células do nocodazol e re-placa-as como descrito em 1.1.7. Incubar a 37 ° C em uma atmosfera humidificada com 5% de CO 2 por 3 h para permitir que eles se apeguem antes do agente de adição (o período de incubação requerido pode variar de acordo com a linha celular).
      3. Adicione agente e colete amostras como descrito anteriormente em 1.1.8.
    2. Análise do efeito de agentes genotóxicos em SG2 fases ou M entrada
      1. Sincronize as células conforme descrito em 1.2.2. Para 1.2.5.
      2. Libere células da HU conforme descrito em 1.2.6. E adicione imediatamente agente.
      3. Coletar amostras como descrito anteriormente em 1.8.
  4. Monitoramento da sincronização celular e progressão através do ciclo celular por coloração com iodeto de propídio (PI) e análise FACS
    NOTA: As amostras coletadas em todos os pontos de tempo juntamente com as necessárias para definir as configurações FACS podem ser armazenadas a 4 ° C uma vez que foram corrigidas (conforme mencionado em 1.1.8.2). Execute manchas com solução PI seguida de análise FACS para todas as amostras da experiência simultaneamente. O PI intercala no sulco principal do DNA de cadeia dupla produzindo um sinal altamente fluorescente quando excitado a 535 nm com um amplo pico de emissão em torno de 600 nm. Como o PI também pode se ligar ao ARN de cadeia dupla, é necessário tratar as células com RNase para uma resolução de DNA ideal.
    1. Prepare uma solução de coloração com fraco fraco. Uma solução de reserva de PI pode ser preparada por dissolução de pó PI em PBS ( por exemplo, 5 mg / mL). Armazene a solução de reserva a 4 ° C (na escuridão). A solução de coloração é composta por PI (140 μM), citrato de sódio (38 mM) e Triton X-100 (0,01% v / v).
    2. Aquecer uma superfície apropriada ( por exemplo, forno) a 37 ° C.
    3. Centrifugar células fixas (450 xg, 5 min, RT), decantar o sobrenadante (etanol) e lavar uma vez com 1x PBS.
    4. Centrifugar as células novamente, remover PBS e adicionar 300 μL de solução de coloração PI por amostra (exceto para uma das amostras para configurações FACS, adicionar PBS a esta amostra).
    5. Transferir células para Tubos FACS (5 mL de tubos de poliestireno de fundo redondo).
    6. Adicione 1 μL de RNase A a cada amostra, misture e incuba as amostras durante 30 min na escuridão a 37 ° C. As amostras podem ser armazenadas protegidas da luz a 4 ° C por um período máximo de 2 a 3 dias.
    7. Analisar o conteúdo de DNA em amostras por fluxoCitometria. Defina as configurações de compensação de análise FACS com amostra assíncrona manchada com PI. Use amostra em branco (sem solução de coloração PI) para verificar a autofluorescência. Os conceitos básicos da análise mediada por picoterapia de DNA do conteúdo de DNA por citometria de fluxo foram descritos anteriormente 9 .
  5. Determinação do índice mitótico por coloração fosfo-H3 (Ser 10) / PI
    NOTA: As células que sofrem mitosis podem ser facilmente detectadas por citometria de fluxo com anticorpos específicos para fosfo-histona H3 em Serina 10 (pH3). Uma coloração concomitante de PI é útil para determinar a distribuição baseada em conteúdo de DNA da população de células. São necessárias 5 amostras para as configurações ótimas das configurações de FACS: em branco, somente para PI, apenas para pH3, anticorpo secundário e colorações duplas.
    1. Centrifugar células fixas (450 xg, 5 min, 4 ° C) e descartar o sobrenadante. As seguintes etapas são descritas para realizar a coloração em tubos de 15 mL.
    2. Lavar as células adicionando 1ML de PBS-T (PBS + 0,05% de Tween-20) ao sedimento e centrífuga (450 xg, 5 min, 4 ° C). Retire o sobrenadante.
    3. Adicionar anticorpo anti-pH3 diluído (1: 500) em 100-200 μL de PBS-T + 3% BSA e incubar com balanço durante 2 h à TA (ou O / N a 4 ° C).
    4. Adicione 2 mL de PBS-T (PBS + 0,05% Tween-20) e centrifugação (450 xg, 5 min, 4 ° C). Retire o sobrenadante.
    5. Lave mais uma vez adicionando 2 mL de PBS-T ao sedimento, centrifugando e descarte o sobrenadante.
    6. Adicionar anticorpo secundário (AlexaFluor 488 anti-coelho no caso do anticorpo pH3 selecionado) diluído (1: 500) em 100-200 μL de PBS-T + 3% de BSA e incubar com balanço durante 1 h à TA (ou O / N A 4 ° C). Proteja as amostras da luz.
    7. Lavar duas vezes com PBS-T (2 mL) por centrifugação como descrito no passo 1.5.4.
    8. Execute a coloração PI como descrito (passos 1.4.1 a 1.4.6).

2. Recolha e Processo de Amostras para Análise de Expressão Genética

  1. Levar1,5 mL de amostras de microcentrífuga no reagente de isolamento de ARN do congelador e deixá-los descongelar à temperatura ambiente dentro de um armário de segurança para produtos químicos.
  2. Adicione 400 μL de clorofórmio a cada amostra e agite vigorosamente (mas não vortex) até completar a mistura. Incubar amostras por 5 min à TA.
  3. Centrifugação de tubos por 15 min (≥8,000 xg, 4 ° C) em uma microcentrífuga de bancada.
  4. Transfira a fase aquosa (superior) para um novo tubo de microcentrífuga de 1,5 mL e registre o volume transferido (para simplificar o procedimento, recomenda-se coletar volumes iguais em todas as amostras da experiência).
  5. Adicione 1 volume de etanol 100% lentamente (gota a gota) à fase aquosa enquanto se mistura. Não centrifugue.
  6. Execute os próximos passos com o kit de preparação de RNA mini comercial. Pipetar até 700 μL de cada amostra, incluindo qualquer precipitado que tenha se formado, em uma coluna de rotação em um tubo de coleta de 2 mL (fornecido pelo fabricante).
  7. Feche oTampa e centrífuga (≥ 8,000 g, RT) por 15 s. Descarte o fluxo contínuo. Repita a etapa anterior com a amostra restante (se houver).
  8. Siga as instruções dos fabricantes para a lavagem e eluição do ARN (eluir cada amostra em 30 a 40 μl de H 2 O isento de nuclease para obter uma concentração apropriada de ARN para o próximo passo).
  9. Determine a concentração de ARN e a pureza das amostras por medidas de absorvência (uma razão de 260/280 de 2,0-2,1 indica boa pureza da amostra de ARN). Armazene amostras de ARN a -80 ° C até uso para análise de RT-qPCR.
  10. Para a conversão de ARN em cDNA e subsequente PCR quantitativa, tome 1 μg de RNA por amostra e prepare a reação retrotranscriptase de acordo com as instruções do fabricante. As amostras de cDNA obtidas podem ser armazenadas a 4 ° C (por alguns dias) ou a -20 ° C (por períodos de tempo mais longos).
    NOTA: A preparação de amostras, o design do primer e outras considerações para PCR em tempo real foram exDetalhadamente descrito na literatura 22 , 23 .

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Representação esquemática dos protocolos Thy-Noc e HU para sincronização celular.

A Figura 1 resume as etapas necessárias para a sincronização de células U2OS e posterior coleta de amostras, a fim de verificar a progressão através do ciclo celular e realizar análises de expressão gênica.

A coloração de Phospho-H3 e PI são bons parâmetros de avaliação para selecionar métodos de sincronização.

Os procedimentos de sincronização celular devem ser avaliados e otimizados para cada linha celular devido à heterogeneidade inerente das células cultivadas. A sincronização na mitose é geralmente alcançada com o protocolo Thy-Noc e o enriquecimento de células mitóticas após o tratamento com nocodazol pode ser avaliado com anticorpos específicos para a histona H3 fosforilada (pH3), um marcador mitótico típico. Ide A ratificação de células positivas a pH3 permite discriminações entre células mitóticas e aquelas com um conteúdo de 4C-DNA que não sofrem mitosis (todas as quais são consideradas uma população "G2" por coloração PI). Nas células U2OS, o protocolo Thy-Noc conduz a um enriquecimento significativo de uma população com conteúdo de DNA 4C (Figura 2A, gráfico superior esquerdo, população azul por coloração PI) e a fração relativa de células mitóticas nesta população era rotineiramente bastante pura (aproximadamente 91% em comparação com 2% em células assíncronas). A liberação de nocodazol resulta em uma progressão sincronizada das células para a próxima fase G1, conforme determinado pelo acúmulo de uma população com conteúdo de DNA 2C ( Figura 2A , gráfico superior direito, população verde por coloração PI) e o quase desaparecimento de mitotica positiva pH3 Células ( Figura 2A , gráfico inferior direito). Assim, os resultados de coloração pH3 confirmaram a adequação do protocolo Thy-Noc para a sincronização mitótica de células U2OS.

E_content "fo: keep-together.within-page =" 1 "> A sincronização de células U2OS em G1 / S foi testada com timidina e hidroxiureia, dois sinônimo de ampliação amplamente utilizados. O enriquecimento em diferentes fases do ciclo celular foi determinado pela coloração PI e Análise FACS e porcentagem de células resumidas em uma tabela ( Figura 2B ). Uma exposição de 24 h de células U2OS a Thy (2mM) foi ineficiente na prisão de células no limite G1 / S ( Figura 2B ), enquanto o tratamento com HU ou com um duplo O rato de timidina (DT) resultou em uma parada satisfatória, no entanto, apenas as células tratadas com HU recuperaram completamente da prisão e progrediram adequadamente através do ciclo celular. Por outro lado, o bloqueio de DT induziu uma parada permanente de G1 em uma fração significativa da população celular ( 13,3% das células em G1 a 6 h ponto de tempo com DT versus 3,1% com protocolo baseado em HU), o que afetou negativamente a sincronia celular. Assim, a exposição à HU é recomendada como uma metanfeta de sincronização G1 / S apropriadaOd para células U2OS.

Os protocolos baseados em Thy-Noc e HU são complementares para a sincronização celular.

Conforme mostrado na Figura 3A (ponto horário de 0 h), o tratamento pelo protocolo Thy-Noc prendeu eficientemente as células U2OS na entrada em fase M (população com conteúdo de DNA 4C, mostrada em azul) e tratamento por células do protocolo HU no limite G1 / S (População com conteúdo de DNA de 2C, mostrada em verde / vermelho). Após a remoção dos medicamentos, as células entraram e progrediram através do ciclo celular de forma sincronizada. As células recuperadas do tratamento de Thy-Noc foram observadas pela primeira vez na fase G1 precoce (população em verde) e, posteriormente, passaram pela G1 e até a fase S de forma uniforme. As células recuperadas do tratamento HU progrediram de forma síncrona através de S (população em vermelho) e G2 / M. A progressão através do próximo ciclo celular foi concomitante à perda de sincronicidade. ConsequentementeNão foram incluídos pontos de tempo em mais de 15 horas nessas análises devido à perda de sincronia após esse ponto de tempo.

Análise de Western Blot de Cyclin E1 (uma ciclina G1 / S) e Cyclin B1 (uma ciclina G2 / M), duas proteínas cujos níveis estão bem regulados no ciclo celular e do marcador mitótico pH3 confirmaram a fase do ciclo celular de cada uma Ponto de tempo analisado pelo FACS ( Figura 3B ). Como esperado, as células na fase M (correspondente ao ponto de tempo de 0 h das células sincronizadas com Thy-Noc) e as células na fase G2 a M (9 h a 12 h ponto horário das células sincronizadas com HU) mostraram uma acumulação dramática de ciclina B1 E níveis indetectáveis ​​de ciclina E1. Além disso, os níveis de ciclina B1 foram baixos a indetectáveis ​​na fase G1 (3 h após a liberação do nocodazol) e acumulação gradual foi observada à medida que as células progrediram através de S (após a liberação de Thy-Noc) e em G2 (após a liberação de HU). Etiquetagem robusta do pH3 das células às 0 h após a sincronização Thy-NocConfirmou o enriquecimento de células presas na mitose neste momento. Um leve aumento nos níveis de pH3 às 12 h após a libertação da HU revelou que a maioria das células com conteúdo de DNA 4C ainda estava em G2 enquanto que a proporção de células na mitose aumentou no ponto de tempo de 15 h. Em contrapartida, o padrão de expressão da ciclina E1 mostrou uma acumulação progressiva desde o início da fase G1 até a fase S (procedimento Thy-Noc) e o desaparecimento gradual na fase G2 / M (procedimento HU).

A expressão de genes que são regulados diferencialmente no ciclo celular pode ser analisada com precisão com uma combinação de sincronização baseada em Thy-Noc e HU.

Como prova de conceito, a análise de expressão de genes regulada pelo ciclo celular é melhor avaliada por uma combinação de dois métodos de sincronização celular, a expressão de mRNA de dois membros da família E2F conhecidos por ter diferentes cinéticas de expressão no ciclo celular(E2F1 e E2F7) foram examinadas por PCR quantitativa de transcriptase reversa (RT-qPCR). Para este fim, os protocolos de sincronização de Thy-Noc e HU foram utilizados, conforme resumido na Figura 1 , e a distribuição do ciclo celular foi monitorada por citometria de fluxo como mostrado na Figura 3A . A Figura 4 mostra os perfis de mRNA E2F1 (dois grafos superiores) e E2F7 (dois graus inferiores) através do ciclo celular. O perfil de regulação da transcrição do gene que codifica E2F1 foi melhor observado com o procedimento Thy-Noc, pelo que a expressão de E2F1 começou a aumentar gradualmente da fase G1 precoce para atingir um pico na fase G1 tardia (9 h após a liberação Thy-Noc, fundo verde). Os seus níveis diminuíram posteriormente, concomitante com uma entrada nas fases S e G2 (fundos vermelhos e azuis). Em contraste, a cinética de expressão do gene E2F7 foi melhor detectada após a sincronização baseada em HU (gráfico inferior, fundo vermelho), com uma expressão de pico a 6 h da liberação (correspondente à transição de fase S para G2). Thy-NocProcedimento, por outro lado, era adequado para observar a indução de E2F7, mas não a sua downregulation. Destaca-se que a extensão da análise além dos perfis de expressão de mRNA de E2F1 e E2F7 reproduzidos em pontos de tempo anteriores de 15 h, embora com uma variação diminuída de variação de mRNA (dados não mostrados). No total, esses resultados confirmam a importância de trabalhar com uma população celular corretamente sincronizada para avaliar não apenas a cinética de expressão gênica, mas também a amplitude precisa das mudanças nos níveis de mRNA.

A sincronização celular fornece uma melhor compreensão do programa de expressão gênica impactado pela terapia anticancerígena.

Para analisar o efeito do fármaco antitumoral mitomicina C (MMC) na dinâmica do ciclo celular, bem como na expressão gênica, as células U2OS foram primeiro sincronizadas com HU e posteriormente tratadas com MMC. A exposição a este agente genotóxico ativou um checkpoinT na fase G2 que ficou evidente após 15 h de exposição ( Figura 5A , linha inferior, pico azul). Em contraste, as células não tratadas progrediram normalmente através de G1 neste ponto de tempo ( Figura 5A , linha superior, pico verde). O tratamento a longo prazo com MMC (36 h) revelou uma prisão permanente de células na fase G2, enquanto que as células sem tratamento com MMC exibiram uma distribuição do ciclo celular semelhante à mostrada pela população de células assíncronas.

E2F1 e p21 Cip1 (CDKN1A) foram escolhidos para análise de expressão de genes em células tratadas com MMC ( Figura 5B ), dada a sua diferente regulação dependente do ciclo celular. A expressão de E2F1 é dependente da fase G1, como descrito na Figura 4 , enquanto que a indução da expressão de p21 Cip1 é acoplada à ativação do paragem / vigília do ciclo celular 24 . Conforme mostrado na Figura 5B (gráfico superior esquerdo), expressão do gene E2F1 kiNetics foram semelhantes na presença ou na ausência de MMC, à medida que as células avançavam através de G1 / S e na fase S. As diferenças na expressão do gene E2F1 entre células tratadas e não tratadas com MMC foram observadas após 15 h de exposição a MMC, pelo que as células tratadas com MMC expressaram níveis mais baixos de mRNA de E2F1 do que as células de controle ( Figura 5B , comparar linhas sólidas e tracejadas). No entanto, apesar da clara diferença de expressão, não se pode concluir que a MMC reduz a expressão de E2F1, porque os perfis do ciclo celular de células tratadas e não tratadas com MMC são claramente diferentes nestes pontos de tempo posteriores, devido a uma parada de fase G2 sustentada imposta pela MMC. De fato, os baixos níveis de ARNm de E2F1 após o ponto de tempo de 15 horas em células expostas a MMC provavelmente refletem o efeito do medicamento na dinâmica do ciclo celular, em vez de um efeito de MMC na regulação transcricional E2F1.

Em contraste com E2F1, p21 Cip1 é um gene responsivo ao MMC. Níveis elevados de p21 Cip1 foram detectados na prisão G1 / S impostas pela HU, indicando a ativação do ponto de controle G1 por HU ( Figura 5B , ponto horário de 0 h) e sua expressão diminuiu a partir de então em células não tratadas com MMC, consistente com uma progressão do ciclo celular não perturbada após a liberação de prender. Em contrapartida, o tratamento com MMC conduziu a níveis elevados de mRNA C21 de p21 ( Figura 5B , gráfico superior direito, linha contínua) enquanto as células estavam acumulando na fase G2 (9 h de exposição MMC). Apesar de os perfis do ciclo celular serem semelhantes no ponto de tempo de 9 horas no controle e células tratadas com MMC, a análise de expressão gênica mostra uma diferença fundamental. As células expostas ao MMC mostraram um ponto de controle G2 ativado, evidenciado pela indução da expressão de p21 Cip1 , enquanto as células não tratadas passaram por uma transição não perturbeada através de G2, com baixos níveis de C21 de p21.

Dados obtidos por análise de citometria de fluxo ( FiGure 5A) e dados resultantes de RT-qPCR ( Figura 5B , gráficos superiores) foram combinados em um único gráfico para cada um dos genes selecionados ( Figura 4B , gráficos inferiores). Os níveis de expressão de mRNA, quando mostrado como altura relativa das barras, enquanto a distribuição do ciclo celular das células para cada amostra foi ilustrada com a proporção de cores: verde para fase G1 (conteúdo de DNA 2C), azul para fase G2 (conteúdo de DNA 4C) e vermelho Para a fase S (conteúdo de DNA intermediário). Este método combinado de representação gráfica pode ser útil para interpretar a distribuição do ciclo celular e as análises de expressão gênica.

Em resumo, a análise de expressão de genes acoplada a um método de sincronização de cultura permitiu a identificação de um gene genéxico responsivo a agente (p21 Cip1 ) e levou a propor que as alterações observadas na expressão de E2F1 entre células tratadas e não tratadas com o agente fossem indiretas ePossivelmente relacionado às diferenças na distribuição do ciclo celular das células.

figura 1
Figura 1: Visão Geral de Dois Protocolos de Sincronização de Células Complementares: Timidina-Nocodazole e Hydroxyurea. ( A ) Representação gráfica do ciclo celular de mamífero indicando os pontos em que a parada do ciclo celular é alcançada por métodos de sincronização celular. O procedimento baseado em Thy-Noc bloqueia as células na mitosis precoce (M), enquanto a HU bloqueia as células no limite G1 / S. ( B ) Representação esquemática do protocolo Thy-Noc de sincronização celular. São apresentadas as etapas normalmente utilizadas para análise de expressão gênica e monitoramento do ciclo celular em células U2OS. ( C ) Representação esquemática do protocolo baseado em HU da sincronização celular. São apresentados os passos tipicamente utilizados para análise de expressão de genes e monitorização de ciclo celular em UCélulas 2OS. Um procedimento de sincronização mais curto que elimina a fome do soro também pode ser aplicado se a sincronização ideal já for alcançada por uma exposição de 24 h à HU. Clique aqui para ver uma versão maior desta figura.

Figura 2
Figura 2: Avaliação de Métodos de Sincronização Adequados. ( A ) As culturas de células U2OS sincronizadas assíncronas e Thy-Noc foram submetidas a coloração pH3 para avaliar a fração de células mitóticas em cada caso. A coloração simultânea de PI permitiu o monitoramento do conteúdo de DNA das células. Na população assíncrona, apenas uma fração mínima de células com conteúdo de DNA 4C (em azul) foi positiva para o marcador de mitose. Em contraste, o protocolo Thy-Noc eficientemente accuCélulas moneadas na mitose (positivo para a coloração pH3) e permitiu uma progressão adequada para a próxima fase G1 (em verde) após a remoção do nocodazol (3 h ponto do tempo). A porcentagem de células em cada fase é resumida na tabela e marcada com cores de acordo com aqueles empregados nos histogramas de PI: verde para células de conteúdo de DNA de 2C (G1), azul para células com conteúdo de DNA de 4C (incluindo células G2 e M e nomeadas como G2 nos histogramas para simplificar a figura e vermelho para células com conteúdo de DNA intermediário (S). ( B ) A timidina ea HU foram avaliadas quanto à eficiência de sincronização do ciclo celular em células U2OS. As células foram tratadas com timidina (uma ou duas). Rodadas), ou com HU por 24 h, e a sincronização celular foi examinada pela coloração PI e análise FACS. Cimeira foi usada para análise de dados FACS. Clique aqui para ver uma versão maior dessa figura.

Figura 3
Figura 3: Descrevendo o quadro temporal para a progressão uniforme das células após a sincronização mediada por Thy-Noc e HU. ( A ) As células U2OS foram sincronizadas na fase M pelo protocolo Thy-Noc (linha superior) ou na transição G1 / S pelo protocolo HU (linha inferior). A progressão do ciclo celular foi monitorada por coloração PI e análise FACS do conteúdo de DNA das células a cada 3 h após a libertação de substâncias químicas. Summit foi usado para análise de dados FACS. As células liberadas da prisão mediada por Thy-Noc entraram de forma síncrona na fase G1 precoce após 3 h, e progrediram uniformemente até a fase S em pontos de tempo subseqüentes. As células liberadas da prisão mediada por HU passaram de forma síncrona através das fases S e G2. As células coletadas 15 h após o lançamento representaram os limites para a sincronização celular, já que a progressão para a próxima fase foi apenas alcançadaD por uma fração da população. ( B ) A sincronização celular foi monitorada por análise Western Blot coletando amostras de proteínas a cada 3 h e até 15 h após a liberação. Cinética de expressão de Cyclin E1 (CCNE1), uma ciclina predominantemente acumulada através da fase S, ciclina B1 (CCNB1), principalmente presente de G2 a M fase e pH3, um marcador para células mitóticas, perfis de distribuição de ciclo celular corroborados observados por citometria de fluxo. A Actina B (ACTB) foi utilizada como um controle de carga endógeno porque seus níveis não dependem do ciclo celular. (Modificado de Mitxelena et al ., 8 ). Clique aqui para ver uma versão maior desta figura.

Figura 4
Figura 4: Estudo do fator de fase do ciclo celular T Transcrição de membros da família E2F por métodos complementares de sincronização celular. As células U2OS foram presas em G2 / M pelo protocolo Thy-Noc ou em G1 / S por tratamento HU, e amostras foram coletadas para extração de RNA e análise FACS a cada 3 h até 15 h após a liberação da prisão. A análise de expressão de genes por RT-qPCR revelou um perfil de expressão de E2F1 circunscrito principalmente a G1 (gráfico superior esquerdo), enquanto o perfil de expressão do gene E2F7 foi deslocado para a fase S, com uma downreguation gradual através da fase G2 (gráfico inferior direito). O TBP foi utilizado como gene endógeno não regulado pelo ciclo celular para calcular variações relativas nos níveis de mRNA e os resultados foram representados como valores médios e desvio padrão (SD). A progressão através do ciclo celular foi determinada pela coloração PI e análise FACS do conteúdo de DNA das células. As fases do ciclo celular foram representadas como cores de fundo em gráficos: preto (prisão na mitose precoce), verde (fase G1), vermelho (fase S) e azul (fase G2)..com / files / ftp_upload / 55745 / 55745fig4large.jpg "target =" _ blank "> Clique aqui para ver uma versão maior desta figura.

Figura 5
Figura 5: Impacto da MMC na Expressão Genética e Progresso do Ciclo Celular. As células U2OS foram tratadas com HU por 24 h, e MMC (250 nM) foi adicionado imediatamente após a libertação da prisão G1 / S mediada por HU. Amostras para análise FACS e análise de expressão gênica foram coletadas em pontos de tempo indicados. ( A ) A progressão através do ciclo celular foi determinada pela coloração PI e análise FACS do conteúdo de DNA pelo software Summit. A MMC induziu um atraso moderado na progressão através da fase S (população vermelha) e uma parada permanente na fase G2 (população azul), como mostrado pela ausência de células em G1 (população verde) após 15 h de tratamento (linha inferior) em comparação Para não-Células tratadas (linha superior). ( B ) E2F1 e p21 Análise de expressão do gene Cip1 em células tratadas ou não tratadas com MMC foi realizada no nível de mRNA por RT-qPCR. Oxa1L foi utilizado como um gene endógeno não responsivo a MMC e os resultados foram representados como valores médios e SD. Os gráficos superiores representam os níveis relativos de mRNA dos genes selecionados após a liberação da HU e a adição de MMC. Gráficos inferiores combinam dados obtidos por análise FACS e RT-qPCR. Clique aqui para ver uma versão maior desta figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

A análise de genes regulados por ajuste fino envolvidos em papéis temporários e temporários no ciclo celular requer uma população celular uniforme. Muitos pesquisadores usam rotineiramente linhas de células tumorais estabelecidas há muito tempo para esses propósitos e uma variedade de métodos foram desenvolvidos para obter populações celulares síncronas (ou parcialmente síncronas), com o objetivo de acumular o maior número possível de células em fases definidas do ciclo celular. Além disso, esforços intensos foram realizados para melhorar e otimizar abordagens de sincronização bem estabelecidas. No entanto, todos os protocolos de sincronização têm inconvenientes, que podem ser atribuídos à heterogeneidade das culturas celulares, a eficiência subóptima dos procedimentos de sincronização ou a efeitos secundários que os sincronizadores químicos têm na função celular, entre outros. Essas limitações devem ser levadas em consideração ao aplicar protocolos de sincronização celular. Os pesquisadores precisam identificar os métodos de sincronização mais adequados para seus específicosTipo de célula ou experiência. Mesmo cultivando linhas celulares diferentes exatamente da mesma maneira, as taxas de sincronização resultantes podem variar devido a vários motivos. Por um lado, o comprimento do ciclo celular pode variar dependendo da linha celular selecionada; Por outro lado, o mesmo inibidor pode ter efeitos contrastantes em linhas celulares diferentes devido a características particulares de cada linha celular 25 . Além disso, a concentração de inibidor e o tempo de exposição selecionados devem ser sempre ajustados em cada linha celular, a fim de evitar ou minimizar a toxicidade lateral não desejável 26 . Mesmo após a otimização de todos esses aspectos, 100% de acumulação de células em uma determinada fase do ciclo celular nunca é alcançada, e a assincronia aumenta gradualmente após a remoção do produto químico 27 . Assim, é importante entender que os métodos de sincronização obtêm, na melhor das hipóteses, enriquecimentos parciais da população de células em um determinado período de tempo.

Neste w Dois procedimentos de sincronização (Thy-Noc e HU) foram otimizados para sua utilização em células U2OS, ambas usadas extensivamente para ensaios de sincronização celular 28 , 29 , 30 . Para prender células na fase M, uma combinação de timidina e nocodazol funcionou eficientemente em células U2OS. Dada a natureza citotóxica do nocodazol, foi importante determinar o tempo de exposição e a dose deste inibidor, a fim de obter não apenas uma população celular altamente sincronizada, mas também a sobrevivência celular ideal. A exposição prévia a timidina (ou teoricamente qualquer outro composto similar, como a hidroxiureia) levou a um enriquecimento da população de células em fases G1 e S, diminuindo desse modo o tempo de exposição necessário ao nocodazol. Para a prisão de células em G1 / S, foram consideradas várias possibilidades, incluindo o bloqueio de timidina dupla, um método que é muito eficiente na sincronização de várias linhas de células"31 , 32. No entanto, a timidina foi descartada devido aos resultados decepcionantes em U2OS. Uma rodada de tratamento com timidina prendeu apenas uma fração de células, enquanto que duas rodadas de tratamento com timidina bloquearam de forma eficiente a maioria das células em G1 / S, mas um G1 A população foi mantida após a libertação da timidina e a progressão do ciclo celular não ocorreu uniformemente. Em contraste, o tratamento com hidroxiureia proporcionou bons resultados de bloqueio G1 / S e progressão uniforme das células através de S e em G2.

A distribuição da fase do ciclo celular deve ser examinada sempre que realizam experiências de sincronização celular ( por exemplo, por coloração com iodeto de propídio ou marcação pH3 seguida de análise FACS ou por imunotransferência de proteínas específicas de fase de ciclo celular) 16 , 33 , 34 , a fim de melhor interpretar a expressão gênica resultados. Uma eficiência de sincronização incorretaNcy ou pequenas diferenças inter-experimentais na progressão através do ciclo celular podem levar a conclusões erradas. Por exemplo, o tratamento com nocodazol é conhecido por causar falha na função mitocítica de controle sob certas condições. Isso dá origem a uma população de células com conteúdo de DNA 4C, mas negativa para marcadores mitóticos 34 que "desliza" a divisão mitótica e retorna à interfase com um conteúdo de 4C 35 . O surgimento deste subconjunto de células, que pode ser detectado por imunocoloração com anticorpos anti-fosfo-H3 (ver Figura 2A ) pode ser minimizado pelo uso de PBS frio para as etapas de lavagem de nocodazol. Outro efeito associado ao uso de inibidores químicos que afetam a sincronia celular é a ativação do ponto de controle associada à exposição a esses compostos 36 , 37 , um mecanismo pelo qual a célula bloqueia ativamente a progressão através do ciclo celular até que ele possaAssegure-se de que os processos anteriores a esse ponto preciso (por exemplo, replicação correta do DNA, montagem do fuso) sejam resolvidos 38 . Para que um método de sincronização seja adequado, a prisão deve ser não apenas eficiente, mas também completamente reversível. Assim, após a liberação de inibidores do ciclo celular, é importante analisar se os efeitos do inibidor foram revertidos, por exemplo, analisando a expressão de marcadores de ponto de controle, como P21 CIP . A Figura 5B mostra que as células U2OS sincronizadas com hidroxiureia resolveram eficientemente o ponto de controle, porque os níveis de P21 CIP foram reduzidos a expressão basal após a liberação.

Em células U2OS, as percentagens de enriquecimento após a prisão do ciclo celular estão dentro do intervalo relatado por outros estudos sobre sincronização celular 29 , 30 , 39 : cerca de 85% das células com conteúdo de DNA 4C (coloração PI) e aproximaçãoAproximadamente 90% daqueles em mitosis (rótulo positivo ao pH3) após o tratamento com timidina-nocodazol e cerca de 80-90% das células G1 / S após o tratamento com hidroxiureia. A liberação da interrupção do ciclo celular normalmente gera uma progressão adequada através da próxima uma ou duas fases de maneira uniforme, embora a sincronização seja invariavelmente perdida após várias horas e as células não conseguirem completar um ciclo de divisão celular inteira de forma sincronizada. Portanto, para obter uma imagem completa de todas as fases do ciclo celular, o protocolo proposto neste trabalho faz uso de dois métodos de sincronização de diferentes partes do ciclo celular. Conforme mostrado na Figura 3A , cada protocolo individual não assegurou sincronia em todo um ciclo celular. A sincronização baseada em Thy-Noc forneceu um quadro apropriado para os processos que ocorrem em fases G1 a S, enquanto que as células liberadas da HU eram adequadas para a análise de eventos ocorrendo durante S e G2 / M. As complementaridades dos dois procedimentos selecionadosForam demonstrados pela análise de dois membros da família de fatores de transcrição E2F ( Figura 4 ), apoiando a idéia de que a combinação de dois métodos que se sincronizam em diferentes fases do ciclo celular é uma abordagem poderosa para estabelecer com precisão a expressão de genes regulada pelo ciclo celular Padrões e para melhor compreender o seu papel fisiológico.

Uma aplicação convincente dos procedimentos de sincronização celular concentra-se na avaliação do impacto de possíveis agentes terapêuticos. O efeito de compostos farmacêuticos, como aqueles com atividade antitumoral, é freqüentemente estudado em populações de células assíncronas. Sob estas configurações, é possível determinar a implicação do medicamento selecionado na indução de vários processos, como morte celular, parada do ciclo celular ou senescência 7 , 40 . No entanto, a seleção de configurações de células assíncronas para identificação de eventos moleculares precisos que regulamTais processos podem levar a conclusões incompletas ou parcialmente erradas. Este ponto, muitas vezes negligenciado, foi ilustrado no presente trabalho, analisando o efeito do fármaco quimioterápico MMC sobre E2F1 e expressão do gene C21 de p21 ( Figura 5 ). Em geral, a combinação de sincronização celular e tratamento com agentes genotóxicos fornece um contexto adequado para estudar a expressão de genes que respondam ao agente genotóxico e discriminar aqueles afetados pelas perturbações do ciclo celular impostas pelo agente.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Os autores não têm nada a revelar.

Acknowledgments

Agradecemos aos membros dos laboratórios Zubiaga e Altmeyer por discussões úteis e suporte técnico. Este trabalho foi apoiado por doações do Ministério espanhol (SAF2015-67562-R, MINECO / FEDER, UE), do governo basco (IT634-13 e KK-2015/89) e da Universidade do País Basco UPV / EHU ( UFI11 / 20).

Materials

Name Company Catalog Number Comments
DMEM, high glucose, GutaMAX supplement Thermo Fisher Scientific 61965-059
FBS, qualified, E.U.-approved, South America origin Thermo Fisher Scientific 10270-106
Penicillin-Streptomycin (10,000 U/mL) Thermo Fisher Scientific 15140-122
0.25% Trypsin-EDTA (1x), phenol red Thermo Fisher Scientific 25200-072
Thymidine SIGMA T1895-5G Freshly prepared. Slight warming might help dissolve thymidine.
Nocodazole SIGMA M-1404 Stock solution in DMSO stored at -20 ºC in small aliquots
Hydroxyurea SIGMA H8627 Freshly prepared
Mitomycin C from Streptomyces caespitosus SIGMA M4287 1.5 mM stock solution in sterile H2O protected from light and stored at 4 ºC
Dimethyl sulfoxide SIGMA D2650
Propidium iodide SIGMA P4170 Stock solution in sterile PBS at 5 mg/ml, stored at 4 º C protected from light.
PBS pH 7.6 Home made
Ethanol PANREAC A3678,2500
Chloroform SIGMA C2432
Sodium Citrate PANREAC 131655
Triton X-100 SIGMA T8787
RNAse A Thermo Fisher Scientific EN0531
TRIzol Reagent LifeTechnologies 15596018
RNeasy Mini kit QIAGEN 74106
High-Capacity cDNA Reverse Transcription Kit Thermo Fisher Scientific 4368814
Anti-Cyclin E1 antibody Cell Signaling 4129 1:1000 dilution in 5% milk, o/n, 4 ºC
Anti-Cyclin B1 antibody Cell Signaling 4135 1:1000 dilution in 5% milk, o/n, 4 ºC
Anti-β-actin SIGMA A-5441 1:3000 dilution in 5 % milk, 1 hr, RT
Anti-pH3 (Ser 10) antiboty Millipore 06-570 Specified in the protocol
Secondary anti-rabbit AlexaFluor 488 antibody Invitrogen R37116 Specified in the protocol
Secondary anti-mouse-HRP antibody Santa Cruz Biotechnology sc-3697 1:3000 dilution in 5 % milk, 1 hr, RT
Forward E2F1 antibody (human)                    TGACATCACCAACGTCCTTGA Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse E2F1 antibody (human)                    CTGTGCGAGGTCCTGGGTC Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward E2F7 antibody (human)                    GGAAAGGCAACAGCAAACTCT Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse E2F7 antibody (human)                    TGGGAGAGCACCAAGAGTAGAAGA Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward p21Cip1 antibody (human)                    AGCAGAGGAAGACCATGTGGAC Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse p21Cip1 antibody (human)                    TTTCGACCCTGAGAGTCTCCAG Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward TBP antibody (human) reference gene                     Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse TBP antibody (human)                     Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward Oxa1L antibody (human) reference gene   CACTTGCCAGAGATCCAGAAG                  Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse Oxa1L  antibody (human)    CACAGGGAGAATGAGAGGTTTATAG                 Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Power SYBRGreen PCR Master Mix Thermo Fisher Scientific 4368702
FACS Tubes  Sarstedt 551578
MicroAmp Optical 96-Well Reaction Plate Thermo Fisher Scientific N8010560
Corning 100 mm TC-Treated Culture Dish Corning
Corning Costar cell culture plates 6 well Corning 3506
Refrigerated Bench-Top Microcentrifuge Eppendorf 5415 R
Refrigerated Bench-Top Centrifuge Jouan CR3.12 Jouan 743205604
NanoDrop Lite Spectrophotometer Thermo Scientific ND-LITE-PR
BD FACSCalibur Flow Cytometer BD Bioscience
QuantStudio 3 Real-Time PCR System Thermo Fisher Scientific A28567

DOWNLOAD MATERIALS LIST

References

  1. Beato, M., Sánchez-Aguilera, A., Piris, M. A. Cell cycle deregulation in B-cell lymphomas. Blood. 101, (4), 1220-1235 (2003).
  2. Chen, H. Z., Tsai, S. Y., Leone, G. Emerging roles of E2Fs in cancer: an exit from cell cycle control. Nat Rev Cancer. 9, (11), 785-797 (2009).
  3. Cho, R. J., et al. Transcriptional regulation and function during the human cell cycle. Nat Genet. 27, (1), 48-54 (2001).
  4. Peña-Diaz, J., et al. Transcription profiling during the cell cycle shows that a subset of Polycomb-targeted genes is upregulated during DNA replication. Nucleic Acids Res. 41, (5), 2846-2856 (2013).
  5. Grant, G. D., et al. Identification of cell cycle-regulated genes periodically expressed in U2OS cells and their regulation by FOXM1 and E2F transcription factors. Mol Biol Cell. 24, (23), 3634-3650 (2013).
  6. Minderman, H., et al. In vitro and in vivo irinotecan-induced changes in expression profiles of cell cycle and apoptosis-associated genes in acute myeloid leukemia cells. Mol Cancer Ther. 4, (6), 885-900 (2005).
  7. McKenna, E., Traganos, F., Zhao, H., Darzynkiewicz, Z. Persistent DNA damage caused by low levels of mitomycin C induces irreversible cell senescence. Cell Cycle. 11, (16), 3132-3140 (2012).
  8. Infante, A., et al. E2F2 represses cell cycle regulators to maintain quiescence. Cell Cycle. 7, (24), 3915-3927 (2008).
  9. Cecchini, M. J., Amiri, M., Dick, F. A. Analysis of cell cycle position in mammalian cells. J Vis Exp. (59), (2012).
  10. Schorl, C., Sedivy, J. M. Analysis of cell cycle phases and progression in cultured mammalian cells. Methods. 41, (2), 143-150 (2007).
  11. Lalande, M. A reversible arrest point in the late G1 phase of the mammalian cell cycle. Exp Cell Res. 186, (2), 332-339 (1990).
  12. Park, S. Y., et al. Mimosine arrests the cell cycle prior to the onset of DNA replication by preventing the binding of human Ctf4/And-1 to chromatin via Hif-1α activation in HeLa cells. Cell Cycle. 11, (4), 761-766 (2012).
  13. Ikegami, S., et al. Aphidicolin prevents mitotic cell division by interfering with the activity of DNA polymerase-alpha. Nature. 275, (5679), 458-460 (1978).
  14. Baranovskiy, A. G., et al. Structural basis for inhibition of DNA replication by aphidicolin. Nucleic Acids Res. 42, (22), 14013-14021 (2014).
  15. Adams, R. L., Lindsay, J. G. Hydroxyurea reversal of inhibition and use as a cell-synchronizing agent. J Biol Chem. 242, (6), 1314-1317 (1967).
  16. Mitxelena, J., Apraiz, A., Vallejo-Rodríguez, J., Malumbres, M., Zubiaga, A. M. E2F7 regulates transcription and maturation of multiple microRNAs to restrain cell proliferation. Nucleic Acids Res. (2016).
  17. Bootsma, D., Budke, L., Vos, O. Studies on synchronous division of tissue culture cells initiated by excess thymidinE. Exp Cell Res. 33, 301-309 (1964).
  18. Galgano, P. J., Schildkraut, C. L. G1/S Phase Synchronization using Double Thymidine Synchronization. CSH Protoc. (2), (2006).
  19. Edwin Taylor, W. Kinetics of inhibition and the binding of h3-colchicine. J Cell Biol. 25, 145-160 (1965).
  20. Zieve, G. W., Turnbull, D., Mullins, J. M., McIntosh, J. R. Production of large numbers of mitotic mammalian cells by use of the reversible microtubule inhibitor nocodazole. Nocodazole accumulated mitotic cells. Exp Cell Res. 126, (2), 397-405 (1980).
  21. Matsui, Y., Nakayama, Y., Okamoto, M., Fukumoto, Y., Yamaguchi, N. Enrichment of cell populations in metaphase, anaphase, and telophase by synchronization using nocodazole and blebbistatin: a novel method suitable for examining dynamic changes in proteins during mitotic progression. Eur J Cell Biol. 91, (5), 413-419 (2012).
  22. Nolan, T., Hands, R. E., Bustin, S. A. Quantification of mRNA using real-time RT-PCR. Nat Protoc. 1, (3), 1559-1582 (2006).
  23. Thornton, B., Basu, C. Real-time PCR (qPCR) primer design using free online software. Biochem Mol Biol Educ. 39, (2), 145-154 (2011).
  24. Abbas, T., Dutta, A. p21 in cancer: intricate networks and multiple activities. Nat Rev Cancer. 9, (6), 400-414 (2009).
  25. Kung, A. L., Sherwood, S. W., Schimke, R. T. Cell line-specific differences in the control of cell cycle progression in the absence of mitosis. Proc Natl Acad Sci U S A. 87, (24), 9553-9557 (1990).
  26. Borel, F., Lacroix, F. B., Margolis, R. L. Prolonged arrest of mammalian cells at the G1/S boundary results in permanent S phase stasis. J Cell Sci. 115 (Pt. 14, 2829-2838 (2002).
  27. Knehr, M., et al. A critical appraisal of synchronization methods applied to achieve maximal enrichment of HeLa cells in specific cell cycle phases). Exp Cell Res. 217, (2), 546-553 (1995).
  28. Zhu, W., Giangrande, P. H., Nevins, J. R. E2Fs link the control of G1/S and G2/M transcription. EMBO J. 23, (23), 4615-4626 (2004).
  29. Whitcomb, E. A., Dudek, E. J., Liu, Q., Taylor, A. Novel control of S phase of the cell cycle by ubiquitin-conjugating enzyme H7. Mol Biol Cell. 20, (1), 1-9 (2009).
  30. Bruinsma, W., Macurek, L., Freire, R., Lindqvist, A., Medema, R. H. Bora and Aurora-A continue to activate Plk1 in mitosis. J Cell Sci. 127, 801-811 (2014).
  31. Thomas, D. B., Lingwood, C. A. A model of cell cycle control: effects of thymidine on synchronous cell cultures. Cell. 5, (1), 37-42 (1975).
  32. Whitfield, M. L., et al. Identification of genes periodically expressed in the human cell cycle and their expression in tumors. Mol Biol Cell. 13, (6), 1977-2000 (2002).
  33. Lim, S., Cdks Kaldis, P. cyclins and CKIs: roles beyond cell cycle regulation. Development. 140, (15), 3079-3093 (2013).
  34. Tapia, C., et al. Two mitosis-specific antibodies, MPM-2 and phospho-histone H3 (Ser28), allow rapid and precise determination of mitotic activity. Am J Surg Pathol. 30, (1), 83-89 (2006).
  35. Andreassen, P. R., Martineau, S. N., Margolis, R. L. Chemical induction of mitotic checkpoint override in mammalian cells results in aneuploidy following a transient tetraploid state. Mutat Res. 372, (2), 181-194 (1996).
  36. Wei, F., Xie, Y., He, L., Tao, L., Tang, D. ERK1 and ERK2 kinases activate hydroxyurea-induced S-phase checkpoint in MCF7 cells by mediating ATR activation. Cell Signal. 23, (1), 259-268 (2011).
  37. Kubota, S., et al. Activation of the prereplication complex is blocked by mimosine through reactive oxygen species-activated ataxia telangiectasia mutated (ATM) protein without DNA damage. J Biol Chem. 289, (9), 5730-5746 (2014).
  38. Hartwell, L. H., Weinert, T. A. Checkpoints: controls that ensure the order of cell cycle events. Science. 246, (4930), 629-634 (1989).
  39. St-Denis, N. A., Derksen, D. R., Litchfield, D. W. Evidence for regulation of mitotic progression through temporal phosphorylation and dephosphorylation of CK2alpha. Mol Cell Biol. 29, (8), 2068-2081 (2009).
  40. Min, A., et al. RAD51C-deficient cancer cells are highly sensitive to the PARP inhibitor olaparib. Mol Cancer Ther. 12, (6), 865-877 (2013).
Estudando a expressão de genes regulada pelo ciclo celular por dois protocolos complementares de sincronização de células
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Apraiz, A., Mitxelena, J., Zubiaga, A. Studying Cell Cycle-regulated Gene Expression by Two Complementary Cell Synchronization Protocols. J. Vis. Exp. (124), e55745, doi:10.3791/55745 (2017).More

Apraiz, A., Mitxelena, J., Zubiaga, A. Studying Cell Cycle-regulated Gene Expression by Two Complementary Cell Synchronization Protocols. J. Vis. Exp. (124), e55745, doi:10.3791/55745 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter