Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

دراسة الخلية التعبير عن تنظيم دورة الجينات من قبل اثنين من بروتوكولات التزامن الخلية التكميلية

doi: 10.3791/55745 Published: June 6, 2017
* These authors contributed equally

Summary

نحن تقرير بروتوكولات مزامنة الخلية التي توفر سياق لدراسة الأحداث المتعلقة مراحل محددة من دورة الخلية. وتبين لنا أن هذا النهج مفيد لتحليل تنظيم جينات محددة في دورة الخلية غير المضطربة أو عند التعرض للعوامل التي تؤثر على دورة الخلية.

Abstract

يمثل برنامج التعبير الجيني لدورة الخلية خطوة حاسمة لفهم العمليات المعتمدة على دورة الخلية ودورها في أمراض مثل السرطان. وينظم تحليل التعبير الجيني خلية تنظيم دورة على تزامن الخلية في مراحل محددة. نحن هنا وصف طريقة باستخدام اثنين من بروتوكولات التزامن التكميلية التي تستخدم عادة لدراسة الاختلاف الدوري للتعبير الجيني خلال دورة الخلية. ويستند كلا الإجراءين على عرقلة عابرة دورة الخلية في نقطة واحدة محددة. بروتوكول التزامن من قبل العلاج هيدروكسي يوريا (هو) يؤدي إلى الاعتقال الخلوي في أواخر G1 / مرحلة مبكرة S، والإفراج عن اعتقال بوساطة هو يوفر السكان الخلوية تتقدم بشكل موحد من خلال S و G2 / M. بروتوكول التزامن من قبل ثيميدين و نوكودازول (ثي-نوك) خلايا كتل العلاج في الانقسام المبكر، والإفراج عن ثي-نوك بوساطة اعتقال يوفر السكان الخلوية متزامنة مناسبة ل G1 المرحلة و S المرحلة إنحاول الدراسات. تطبيق كلا الإجراءين يتطلب رصد ملامح توزيع دورة الخلية، والتي يتم تنفيذها عادة بعد بروديبيوم يوديد (بي) تلطيخ الخلايا وتدفق الخلوي تحليل بوساطة محتوى الحمض النووي. وتبين لنا أن الجمع بين استخدام اثنين من بروتوكولات التزامن هو نهج قوي لتحديد واضح ملامح النسخي من الجينات التي تنظم بشكل مختلف في دورة الخلية ( أي E2F1 و E2F7)، وبالتالي للحصول على فهم أفضل لدورها في دورة الخلية العمليات. وعلاوة على ذلك، وتبين لنا أن هذا النهج هو مفيد لدراسة الآليات الكامنة وراء العلاجات القائمة على المخدرات ( أي ميتوميسين C، عامل مضاد للسرطان)، لأنه يسمح للتمييز الجينات التي تستجيب لعامل السمية الجينية من تلك المتضررة فقط من اضطرابات دورة الخلية التي يفرضها الوكيل.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

يقترن الانتقال من خلال جميع مراحل دورة الخلية إلى برنامج التعبير الجيني منظم بإحكام. ويعتقد أن هذا التنسيق "داخل وخارج" من النسخ الجيني في جميع أنحاء دورة الخلية لتكون تحت سيطرة النظم التنظيمية النسخي المعقدة، وتنظيم ليس فقط توقيت ولكن أيضا مستويات التعبير الجيني. ومن المعروف أن إزالة الضوابط من مكونات دورة الخلية الرئيسية للمساهمة في تطوير العديد من الأمراض وهو سمة راسخة جيدا من الأورام 1 ، 2 . كشفت التحاليل ترانسكريبتوميك على نطاق الجينوم التي أجريت في الخميرة وخلايا الثدييات أن عددا كبيرا من الجينات تظهر أنماط التعبير الجيني الدوري في دورة الخلية، مما يشير إلى أن التذبذب النسخي خلال دورة الخلية هو انعكاس للمتطلبات الزمنية لمنتج معين الجينات في مرحلة دقيقة 3 ، 4 ، 5 .

وهناك مهمة رئيسية في دراسة التعبير الجيني تنظيم دورة الخلية هو تزامن الخلايا في مراحل دورة الخلية محددة. تزامن الخلية يساعد على تفسير ارتباط نمط التعبير الجيني إلى مرحلة معينة مرحلة الانتقال الخلية، وقد أدى إلى فهم أفضل لتنظيم ووظيفة العديد من الجينات. تزامن الخلية هو أيضا مهم لدراسة آلية عمل الأدوية المضادة للسرطان، كما هي معروفة وكلاء العلاج الكيميائي لتؤثر على كل من التعبير الجيني وكذلك حركية دورة الخلية 6 ، 7 . ومع ذلك، فإنه غالبا ما يكون من الصعب تحديد ما إذا كانت الاختلافات التعبير الجيني الناتجة عن العلاج مع هذه العوامل هي استجابة مباشرة للعلاج أو هي مجرد نتيجة للتغيرات في ملامح دورة الخلية. للتمييز بين هذه الاحتمالات، يجب تحليل التعبير الجيني في الخلايا التي تم قينكرونيزد قبل إضافة الدواء العلاج الكيميائي.

وباستثناء بعض الخلايا الأولية مثل الخلايا اللمفاوية المعزولة حديثا، والتي تشكل خلية متجانسة من السكان متزامنة في G08 -، في المختبر أنشئت خطوط الخلايا تنمو بشكل غير متزامن في الثقافة. في ظل ظروف النمو العادية، يتم العثور على هذه الخلايا الدراجات غير متزامنة في جميع مراحل دورة الخلية ولكن، بشكل تفضيلي في G1 9 . ولذلك، فإن هذا السياق لا يوفر سيناريو الأمثل لتحليل وظيفي أو التعبير الجيني في مرحلة دورة الخلية محددة (على سبيل المثال G1، S الخ). خطوط الخلايا الخلود غير المتحولة ( مثل الخلايا الليفية) يمكن أن تكون متزامنة مع ما يسمى الأساليب الفسيولوجية 10 . وتستند هذه الأساليب على ميزات الخلية الأولية الاحتفاظ الخلايا غير المحولة، مثل تثبيط الاتصال الخلية وعامل الاعتماد الاعتماد من أجل مواصلة ركوب الدراجات. إزالةمن المصل في تركيبة مع تثبيط الاتصال يجعل الخلايا غير المحولة القبض على G0 / G1. ومع ذلك، متزامن دخول دورة الخلية والتقدم غالبا ما يتطلب ثقافة فرعية، والذي ينطوي أيضا انفصال الاصطناعي من الخلايا وإعادة طلاء 10 . الأهم من ذلك، هذه الطريقة ليست مناسبة لمزامنة خطوط الخلايا المحولة، فإن الغالبية العظمى من خطوط الخلايا المعمول بها في الوقت الحاضر في الاستخدام، تتميز لعدم وجود خلية الاتصال بوساطة تثبيط النمو أو الاستجابة لانسحاب عامل النمو. وبالتالي، فمن الواضح أن هناك حاجة إلى أساليب بديلة لتزامن الخلايا كفاءة في مراحل محددة من دورة الخلية. وبصفة عامة، فإن أساليب المزامنة الأكثر استخداما تعتمد على تثبيط كيميائي أو دوائي عابر لنقطة واحدة محددة من دورة الخلية، وعادة ما تكون تخليق الحمض النووي أو تشكيل المغزل الانقسامي. تثبيط تخليق الحمض النووي تزامن الخلايا عن طريق اعتقالهم في أواخر G1 أو مرحلة S في وقت مبكر. هذا يمكن أن يكون أتشيالتي تم تثبيتها من خلال إضافة مركبات مثل ميموسين، مثبط من النيوكليوتيدات الحيوي 11 ، 12 ، أفيديكولين، مثبط من بوليمراتس الحمض النووي 13 ، 14 ، هيدروكسيوريا، مثبط ريبوكتاز ريبونوكليوتيد 15 ، 16 أو كميات زائدة من ثيميدين 17 ، 18 . من ناحية أخرى، مثبطات البلمرة أنيبيب، مثل الكولشيسين أو نوكودازول، قادرة على منع تشكيل المغزل الانقسامية مما يؤدي إلى تزامن الخلية في وقت مبكر M المرحلة 19 ، 20 ، 21 .

في هذا العمل وصفنا طريقة تنطوي على اثنين من بروتوكولات التزامن التكميلية على أساس تثبيط الكيميائية عابرة لدراسة التعبير عن الجينات تنظيم دورة الخلية في مرنامستوى. هذه الطريقة أساسية لتحديد دور الجينات دورة الخلية في عمليات دورة الخلية محددة. وعلاوة على ذلك، فإنه يوفر إطارا عاما لدراسة تأثير العلاجات المضادة للسرطان من أجل الكشف بدقة عن الجينات التي تستجيب المخدرات والتقليل من التفسيرات الخاطئة المستمدة من الاضطرابات في تطور دورة الخلية الناتجة عن هذه الأدوية.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. الخلوية التزامن والإفراج عن ورصد دورة الخلية التقدم

  1. Thymidine- و نوكودازول القائم (ثي-نوك) تزامن والإفراج عن خلايا U2OS من ميتوسيس
    1. إعداد المطلوبة وسط ثقافة الخلية. وتزرع الخلايا U2OS بشكل روتيني في وسط دمم الجلوتامين تكمل مع 10٪ (فول / فول) فبس (اختياري: 1٪ البنسلين / الستربتومايسين). تنفيذ جميع التحضير المتوسطة والتلاعب تحت ظروف معقمة والاحماء تكملة المتوسطة (من الآن فصاعدا المشار إليها باسم "المتوسطة كاملة") إلى 37 درجة مئوية قبل استخدامها.
    2. البذور 2 × 10 6 خلايا U2OS لكل 100 ملم طبق في 10 مل وسط ثقافة كاملة. من أجل حساب عدد الأطباق اللازمة، تأخذ في الاعتبار أن كل طبق 100 ملم عادة ما يوفر ما يكفي من الخلايا الانقسامية لإعادة لوحة حوالي 5 آبار من لوحة 6 جيدا (0.2 - 0.25 × 10 6 خلايا / جيدا) (انظر الشكل 1B ). اثنين من الآبار في نقطة زمنية مختارة هي ريكيرإد في التجربة (1 جيدا لاستخراج الحمض النووي الريبي و 1 جيدا لرصد دورة الخلية). بالإضافة إلى ذلك، بئر ثالث يمكن جمعها في نقطة زمنية لتحليل البروتين.
      ملاحظة: خلايا اللوحة في المساء (حوالي 7 مساء) بحيث الخطوات اللاحقة يمكن القيام بها خلال ساعات العمل في الأيام التالية. قم بتضمين بئرين إضافيين للخلايا المتنامية بشكل غير متزامن لتحديد إعدادات تعويض تحليل فاكس.
    3. اسمحوا الخلايا تعلق عن طريق احتضان أطباق 100 ملم في 37 درجة مئوية في جو مرطب مع 5٪ كو 2 لمدة 24 ساعة.
    4. لكتلة ثيميدين، وإعداد 200 ملي محلول ثيميدين الأسهم عن طريق إذابة 145.2 ملغ ثيميدين مسحوق في 3 مل H 2 O (أو ما يعادلها من المبالغ) وتعقيم الحل عن طريق الترشيح من خلال مرشح حجم المسام 0.2 ميكرون. قد يساعد الاحترار الطفيف على حل الثيميدين. إضافة 100 ميكرولتر من الأسهم الطازجة 200 ملم لكل طبق الثقافة 100 ملم (التركيز النهائي 2 ملم). احتضان الخلايا مع ثيميدين لمدة 20 ساعة في 3776؛ C في جو مرطب مع 5٪ كو 2 .
      ملاحظة: علاج الخلايا في المساء (حوالي 7 مساء)، لديك الوقت لأداء كل من الإفراج ثيميدين وكتلة نوكودازول في اليوم التالي.
    5. للافراج عن كتلة ثيميدين، وإزالة ثيميدين تحتوي على المتوسطة النمو في فترة ما بعد الظهر من اليوم التالي (3 مساء). غسل الخلايا مرتين مع ما قبل تحسنت 1X بس وإضافة 10 مل من المتوسطة كاملة إلى كل طبق 100 ملم. احتضان الخلايا لمدة 5 ساعات عند 37 درجة مئوية في جو مرطب مع 5٪ كو 2 .
    6. للاعتقال الخلية الانقسامية، إضافة نوكودازول إلى تركيز النهائي من 50 نانوغرام / مل (8 مساء). إعداد حل الأسهم عن طريق إذابة مسحوق نوكودازول في دمسو (على سبيل المثال 5 ملغ / مل) وتخزينها المجمدة في -20 درجة مئوية. احتضان الخلايا مع نوكودازول لمدة لا تزيد عن 10 - 11 ساعة عند 37 درجة مئوية في جو مرطب مع 5٪ كو 2 .
    7. الإفراج عن اعتقال بوساطة نوكودازول في مرحلة M في وقت مبكر (الانقسام الهزالي قبالة) وجمع العينات في عدة مرات البوينتس (ابتداء من الساعة 6 صباحا).
      1. فصل تقريب (الانقسامية) الخلايا عن طريق هز كل لوحة و بيبتينغ بلطف النمو التي تحتوي على نوكودازول. جمع المتوسطة مع خلايا منفصلة من كل 100 ملم لوحة في 50 مل أنابيب معقمة، وأجهزة الطرد المركزي (300 x ج، 5 دقائق، درجة حرارة الغرفة (رت)) وغسل الخلايا مرتين عن طريق إضافة برنامج تلفزيوني 1X تليها الطرد المركزي. ينصح استخدام برنامج تلفزيوني بارد أو برنامج تلفزيوني زائد نوكودازول لتجنب الانقسام الانقسامي (انظر قسم المناقشة).
      2. ريسوسبيند الخلايا الانقسامية تجمع من كل لوحة 100 ملم في 10 مل من المتوسطة كاملة. حفظ 2 مل لاستخراج الحمض النووي الريبي و 2 مل للتحليل فاكس لنقطة الوقت 0 ساعة (حوالي 0.2-0.25 × 10 6 خلايا لكل عينة).
      3. إعادة لوحة الخلايا الانقسامية المتبقية لنقاط زمنية لاحقة في لوحات 6 جيدا (2 مل / حسنا، 0.2-0.25 × 10 6 خلايا / جيدا).
        ملاحظة: تذكر أنه مطلوب 2 بئر في نقطة زمنية محددة (1 ل رنا و 1 لتحليل فاكس).
    8. جمع العينات في سيلإكتد نقاط الوقت. ويوصى كل 1.5 إلى 3 ح من أجل الحصول على لمحة كافية من دورة الخلية التقدم.
      1. لاستخراج الحمض النووي الريبي، وإزالة المتوسطة، وشطف جيدا مع 2 مل قبل الحارة 1X برنامج تلفزيوني وإضافة 1 مل من مناسبة كاشف عزل الحمض النووي الريبي (على سبيل المثال تريزول) في البئر (تنفيذ هذه الخطوة الأخيرة في مجلس الوزراء سلامة للمواد الكيميائية). ماصة صعودا وهبوطا لفصل وخلايا ليز، ونقل خلية المحللة إلى أنبوب ميكروسنتريفوج 1.5 مل، احتضان 5 دقائق في رت وتخزين أنبوب في -80 درجة مئوية حتى مزيد من الاستخدام.
      2. لتحليل فاكس، شطف جيدا مع 2 مل قبل الحارة 1X برنامج تلفزيوني، إضافة قبل تحسنت تريبسين-إدتا الحل (0.3 مل / جيدا) لفصل الخلايا، ومنع التربسين إدتا عن طريق إضافة 1 مل المتوسطة كاملة وجمع كل عينة في منفصلة أنبوب 15 مل.
        1. خلايا الطرد المركزي (300 x ج، 5 دقائق، رت)، وحفظ بيليه الخلوية وتجاهل طاف. من أجل إصلاح الخلايا، الخلايا ريسوسبيند في 1 مل من المبردة 70٪ (الخامس / الخامس) الإيثانول في برنامج تلفزيوني 1X بواسطة أنابيب فورتيكسينغ بلطف، ووضعها على الجليد للتطبيقحوالي 15 دقيقة قبل التخزين في 4 درجات مئوية أو تلطيخ لمزيد من التحليل من قبل فاكس (الموصوفة في الخطوات 1.4 - 1.5).
  2. تزامن القائم على هو وإطلاق خلايا U2OS من حدود G1 / S
    1. إعداد كامل ثقافة زراعة الخلايا كما هو موضح في الخطوة 1.1.
    2. بذور 0.25 × 10 6 خلايا U2OS لكل بئر في 6 لوحات جيدا (2 مل وسط ثقافة كاملة لكل بئر). من أجل حساب عدد الآبار اللازمة للتجربة، تأخذ في الاعتبار أنه سيكون مطلوبا 2 بئر في نقطة زمنية مختارة (1 بئر لاستخراج الحمض النووي الريبي و 1 بئر لرصد دورة الخلية) وأن 2 بئر إضافية من الخلايا المتنامية بشكل غير متزامن تحتاج إلى تحديد إعدادات تعويض تحليل فاكس.
    3. السماح للخلايا تعلق عن طريق احتضان لوحات 6 جيدا بين عشية وضحاها (O / N) عند 37 درجة مئوية في جو مرطب مع 5٪ كو 2 .
    4. إزالة المتوسطة كاملة من الآبار صباح اليوم التالي وإضافة 2 ملمن قبل تحسنت فبس خالية دمم الجلوتامين المتوسطة لكل بئر. احتضان الخلايا لمدة 24 ساعة إضافية عند 37 درجة مئوية في جو مرطب مع 5٪ كو 2 .
      ملاحظة: قم بتنفيذ هذه الخطوة في جميع الآبار باستثناء 2 (تلك المحفوظة لتعريف إعدادات فاكس). يمكن حذف خطوة انسحاب المصل إذا تم تحقيق التزامن الفعال عن طريق ببساطة احتضان الخلايا مع هو.
    5. G1 / S اعتقال دورة الخلية مع هو.
      1. إعداد الطازجة حل الأسهم هو (500 ملم) قبل كل استخدام. إضافة 2 مل H 2 O إلى 76.06 ملغ من مسحوق هو وتخلط حتى يذوب تماما. تعقيم الحل عن طريق الترشيح من خلال 0.2 ميكرون مرشح حجم المسام. مزيج 50 مل من المتوسطة كاملة مع 400 ميكرولتر من مرشح تعقيم هو حل الأسهم لتركيز النهائي هو من 4 ملم.
      2. إزالة المتوسطة من جميع الآبار باستثناء من اثنين من الآبار اللازمة لتحديد إعدادات نظام مراقبة الأصول الميدانية واستبدالها مع الطازجة 4 ملي هو يحتوي على المتوسطة الكاملة (2 مل / بئر).
      3. احتضان الخلايا لمدة 24 ساعة فيهو التي تحتوي على المتوسطة عند 37 درجة مئوية في جو مرطب مع 5٪ كو 2 .
    6. الافراج عن الخلايا من اعتقال بوساطة هو. إزالة المتوسطة التي تحتوي على هو من الآبار وشطف الآبار مرتين مع برنامج تلفزيوني قبل تحسنت 1X بس (2 مل في كل مرة). إضافة 2 مل من المتوسطة كاملة لكل بئر. جمع 2 عينات لنقطة الوقت 0 ساعة (1 لاستخراج الحمض النووي الريبي و 1 للتحقق من دورة الخلية التحقق من قبل فاكس) فضلا عن 2 عينات حفظها لإعدادات فاكس. مكان الآبار المتبقية في الحاضنة.
    7. جمع عينات كل 1.5 إلى 3 ساعة من أجل الحصول على توزيع كاف من دورة الخلية التقدم. في كل نقطة زمنية، إجراء معالجة العينات (لاستخراج الحمض النووي الريبي وتحليل فاكس) كما هو موضح في 1.1.8.1-1.1.8.2.
  3. العلاج مع العوامل الضارة دنا
    ملاحظة: كلما كان الهدف هو توضيح تأثير مركب (على سبيل المثال عوامل دنا الضارة) في أحداث دورة الخلية، يمكن لأي من أساليب المزامنة الموصوفة سابقا أن تكونجنبا إلى جنب مع علاج الخلايا مع وكيل السمية الجينية. من أجل اختيار طريقة التزامن، من المهم النظر في مرحلة من دورة الخلية التي نود أن تحليلها. بشكل عام، قد يكون الإجراء ثي-نوك مناسب لدراسة تأثير مركب في مرحلة G1 أو مرحلة S دخول بينما المزامنة بوساطة هو قد تكون أكثر ملاءمة لدراسة تأثير في S إلى G2 مراحل أو في دخول إلى الانقسام.
    1. تحليل تأثير العوامل السمية الجينية في مرحلة G1 أو دخول المرحلة S
      1. مزامنة الخلايا كما هو موضح في 1.1.2. إلى 1.1.6.
      2. إطلاق الخلايا من نوكودازول وإعادة لوحة لهم كما هو موضح في 1.1.7. احتضان لهم عند 37 درجة مئوية في جو مرطب مع 5٪ كو 2 لمدة 3 ساعات للسماح لهم إرفاق قبل إضافة عامل (فترة الحضانة المطلوبة قد تختلف اعتمادا على خط الخلية).
      3. إضافة وكيل وجمع العينات كما هو موضح سابقا في 1.1.8.
    2. تحليل تأثير العوامل السامة في سغ2 مراحل أو M دخول
      1. مزامنة الخلايا كما هو موضح في 1.2.2. إلى 1.2.5.
      2. الافراج عن الخلايا من هو كما هو موضح في 1.2.6. وإضافة وكيل على الفور.
      3. جمع العينات كما هو موضح سابقا في 1.8.
  4. رصد تزامن الخلية والتقدم من خلال دورة الخلية بواسطة يوديد بروبيديوم (بي) تلطيخ وتحليل فاكس
    مالحظة: يمكن تخزين العينات التي يتم جمعها في كل األوقات جنبا إلى جنب مع العينات المطلوبة لتحديد إعدادات فاكس عند درجة حرارة 4 مئوية بمجرد أن تكون ثابتة) كما هو مذكور في 1.1.8.2 (. أداء تلطيخ مع حل بي تليها تحليل فاكس لجميع العينات من التجربة في وقت واحد. بي يقحم في الأخدود الرئيسي من الحمض النووي المزدوج تقطعت بهم السبل إنتاج إشارة الفلورسنت عالية عندما متحمس في 535 نانومتر مع ذروة انبعاث واسع حوالي 600 نانومتر. منذ بي يمكن أيضا ربط رنا المزدوج تقطعت بهم السبل، فمن الضروري لعلاج الخلايا مع ريبونوكلياز لقرار الحمض النووي الأمثل.
    1. إعداد طازجة بي حل تلطيخ. ويمكن إعداد حل الأسهم بي عن طريق حل مسحوق بي في برنامج تلفزيوني (على سبيل المثال 5 ملغ / مل). تخزين محلول المخزون في 4 درجات مئوية (في الظلام). ويتكون حل تلطيخ من بي (140 ميكرومتر)، سيترات الصوديوم (38 ملم) و تريتون X-100 (0.01٪ الخامس / الخامس).
    2. الاحماء سطح مناسب ( مثل الفرن) إلى 37 درجة مئوية.
    3. خلايا الطرد المركزي الثابتة (450 x ج، 5 دقائق، رت)، طاف صب (الإيثانول) ويغسل مرة واحدة مع برنامج تلفزيوني 1X.
    4. خلايا الطرد المركزي مرة أخرى، وإزالة برنامج تلفزيوني وإضافة 300 ميكرولتر من حل تلطيخ بي لكل عينة (باستثناء واحد من عينات لإعدادات فاكس؛ إضافة برنامج تلفزيوني لهذه العينة بدلا من ذلك).
    5. نقل الخلايا إلى أنابيب فاكس (5 مل أنابيب البوليسترين جولة القاع).
    6. إضافة 1 ميكرولتر من ريبونوكلياز لكل عينة، مزيج واحتضان عينات لمدة 30 دقيقة في الظلام عند 37 درجة مئوية. يمكن تخزين العينات محمية من الضوء في 4 درجات مئوية لمدة أقصاها 2 - 3 أيام.
    7. تحليل محتوى الحمض النووي في العينات عن طريق التدفقالخلوي. تحديد إعدادات تعويض تحليل فاكس مع عينة غير متزامنة بي المتلألئة. استخدام عينة فارغة (دون حل تلطيخ بي) للتحقق من تألق ذاتي. أساسيات بي تلطيخ بوساطة تحليل محتوى الحمض النووي عن طريق التدفق الخلوي وقد سبق وصفها 9 .
  5. تحديد مؤشر الانقسامية من قبل المزدوج فسفو-H3 (سر 10) / بي تلطيخ
    ملاحظة: الخلايا التي تمر الانقسام يمكن الكشف عنها بسهولة عن طريق التدفق الخلوي مع الأجسام المضادة المحددة ل H3 فوسفو هيستون في سيرين 10 (pH3). تلطيخ بي يصاحب ذلك هو مفيد لتحديد توزيع الحمض النووي على أساس المحتوى من السكان الخلية. مطلوب 5 عينات من أجل التشكيلات المثلى لإعدادات فاكس: فارغة، بي فقط، pH3 فقط، الثانوية الأجسام المضادة فقط وتلطيخ مزدوج.
    1. خلايا الطرد المركزي الثابتة (450 x ج، 5 دقائق، 4 درجات مئوية) وتجاهل طاف. يتم وصف الخطوات التالية لأداء تلطيخ في أنابيب 15 مل.
    2. غسل الخلايا عن طريق إضافة 1مل بس-T (بس + 0.05٪ توين -20) إلى بيليه وأجهزة الطرد المركزي (450 x ج، 5 دقائق، 4 درجات مئوية). إزالة طاف.
    3. إضافة الأجسام المضادة المضادة لل PH3 المخفف (1: 500) في 100-200 ميكرولتر من بس-T + 3٪ بسا، واحتضان مع هزاز لمدة 2 ساعة في رت (أو O / N عند 4 درجات مئوية).
    4. إضافة 2 مل بس-T (بس + 0.05٪ توين -20) وأجهزة الطرد المركزي (450 x ج، 5 دقائق، 4 درجات مئوية). إزالة طاف.
    5. يغسل مرة أخرى عن طريق إضافة 2 مل بس-T إلى بيليه، وأجهزة الطرد المركزي وتجاهل طاف.
    6. إضافة الأجسام المضادة الثانوية (المضادة للأرنب أليكسافلور 488 في حالة الجسم المضاد PH3 المحدد) المخفف (1: 500) في 100-200 ميكرولتر من بس-T + 3٪ بسا واحتضان مع هزاز لمدة 1 ساعة في رت (أو O / N في 4 درجات مئوية). حماية عينات من الضوء.
    7. غسل مرتين مع بس-T (2 مل) بواسطة الطرد المركزي كما هو موضح في الخطوة 1.5.4.
    8. أداء تلطيخ بي كما هو موضح (الخطوات 1.4.1 إلى 1.4.6).

2. جمع العينات والعمليات لتحليل الجينات التعبير

  1. يأخذ1.5 مل عينات ميكروسنتريفوج في كاشف العزلة الحمض النووي الريبي من الفريزر والسماح لهم ذوبان الجليد في رت داخل مجلس الوزراء السلامة للمواد الكيميائية.
  2. إضافة 400 ميكرولتر من الكلوروفورم إلى كل عينة ويهز بقوة (ولكن لا دوامة) حتى خلط كامل. احتضان عينات لمدة 5 دقائق في رت.
  3. أنابيب الطرد المركزي لمدة 15 دقيقة (≥8،000 x ج، 4 درجات مئوية) في ميكروسنتريفوج بينشتوب.
  4. نقل المرحلة المائية (العليا) إلى أنبوب ميكروسنتريفوج 1.5 مل جديد وتسجيل حجم نقلها (من أجل تبسيط الإجراء، فمن المستحسن لجمع كميات متساوية في جميع عينات من التجربة).
  5. إضافة 1 حجم من الايثانول بنسبة 100٪ ببطء (قطرة عن طريق قطرة) إلى المرحلة المائية أثناء الخلط. لا أجهزة الطرد المركزي.
  6. قم بتنفيذ الخطوات التالية مع مجموعة الإعدادية ميني رنا. الماصة تصل إلى 700 ميكرولتر من كل عينة، بما في ذلك أي راسب التي قد تشكلت، في عمود تدور في أنبوب جمع 2 مل (المقدمة من قبل الشركة المصنعة).
  7. أقفل الغطاء وطرد مركزي (≥ 8000 غرام، رت) لمدة 15 ثانية. تجاهل تدفق من خلال. كرر الخطوة السابقة مع العينة المتبقية (إن وجدت).
  8. اتبع مانوفاتوريتس 'تعليمات لغسل الحمض النووي الريبي وشطف (أزل كل عينة في 30 - 40 ميكرولتر نوكليس خالية H 2 O من أجل تحقيق تركيز الحمض النووي الريبي المناسب للخطوة التالية).
  9. تحديد تركيز الحمض النووي الريبي ونقاء العينات عن طريق قياسات الامتصاصية ( A 260/280 نسبة 2.0-2.1 يدل على نقاء جيد من عينة الحمض النووي الريبي). تخزين عينات الحمض النووي الريبي في -80 درجة مئوية حتى استخدام تحليل رت-قر.
  10. لتحويل الحمض النووي الريبي إلى [كدنا] واللاحقة الكمي ير، واتخاذ 1 ميكروغرام رنا لكل عينة وإعداد رد فعل ريتروترانسكريبتاس وفقا لتعليمات الشركات المصنعة. الحصول على عينات [كدنا] يمكن تخزينها في 4 درجات مئوية (لبضعة أيام) أو في -20 درجة مئوية (لفترات أطول من الزمن).
    ملاحظة: إعداد عينة، تصميم التمهيدي واعتبارات أخرى في الوقت الحقيقي ير تم السابقينوصفت بشكل مكثف في الأدب 22 ، 23 .

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

تمثيل تخطيطي للبروتوكولات الخاصة بك و هي-هو لتزامن الخلية.

يلخص الشكل 1 الخطوات المطلوبة لتزامن خلية U2OS وجمع العينات اللاحقة من أجل التحقق من التقدم من خلال دورة الخلية وإجراء تحليلات التعبير الجيني.

فوسفهو-H3 و بي تلطيخ هي معايير تقييم جيدة لتحديد أساليب التزامن.

يجب تقييم إجراءات تزامن الخلية وتحسينها لكل خط خلية بسبب عدم التجانس الكامن للخلايا المستزرعة. وعادة ما يتحقق التزامن في الانقسام مع بروتوكول ثي-نوك، وإثراء الخلايا الانقسامية بعد العلاج مع نوكودازول يمكن تقييمها مع الأجسام المضادة المحددة ل هيستون H3 فوسفهوريلاتد (PH3)، علامة الانقسامية نموذجية. بيئة تطوير متكاملة يسمح تعديل الخلايا الإيجابية لل PHH3 بالتمييز بين الخلايا الانقسامية وأولئك الذين لديهم محتوى من الحمض النووي 4C لا يخضعون للانقسام (وكلهم يعتبرون من السكان "G2" بواسطة تلطيخ بي). في خلايا U2OS يؤدي بروتوكول ثي-نوك إلى إثراء كبير من السكان مع محتوى الحمض النووي 4C (الشكل 2A، الرسم البياني الأيسر العلوي، والسكان الأزرق من قبل تلطيخ بي)، والجزء النسبي من الخلايا الانقسامية داخل هذه المجموعة كانت روتينية نقية تماما (تقريبا 91٪ مقارنة مع 2٪ في الخلايا غير المتزامنة). الافراج عن النتائج نوكودازول في تطور متزامن من الخلايا إلى مرحلة G1 المقبل، كما يحددها تراكم السكان مع 2C محتوى الحمض النووي ( الشكل 2A ، الرسم البياني الأيمن العلوي، السكان الأخضر بي تلطيخ بي) والاختفاء القريب من الانقسام إيجابي PH3 الخلايا ( الشكل 2A ، الرسم البياني الأيمن السفلي). وهكذا، أكدت نتائج تلطيخ PH3 ملاءمة بروتوكول ثي-نوك للمزامنة الانقسامية للخلايا U2OS.

e_ontent "فو: كيب-together.within-بادج =" 1 "> تم اختبار تزامن خلايا U2OS في G1 / S مع ثيميدين و هدروكسيوريا، وهما متزامنان يستخدمان على نطاق واسع.وتم تحديد التخصيب في مراحل مختلفة من دورة الخلية بواسطة تلطيخ بي تحليل فاكس ونسبة مئوية من الخلايا تلخيصها في جدول ( الشكل 2B )، وكان التعرض 24 ساعة من خلايا U2OS إلى الخاص بك (2mM) غير فعالة في اعتقال الخلايا في حدود G1 / S ( الشكل 2B )، في حين أن العلاج مع هو أو مع ضعف (دت) أسفرت عن اعتقال مرضي، إلا أن الخلايا المعالجة بالحساسية فقط استعادت تماما من الاعتقال، وتطورت بشكل كاف من خلال دورة الخلية، وعلى النقيض من ذلك، تسببت كتلة دت في اعتقال دائم لمجموعة G1 في جزء كبير من سكان الخلية ( 13.3٪ من الخلايا في G1 عند نقطة زمن 6 ساعات مع دت مقابل 3.1٪ مع البروتوكول القائم على هو)، مما يؤثر سلبا على تزامن الخلية، وبالتالي، يوصى بالتعرض إلى هو باعتباره المزامنة المناسبة G1 / Sأود للخلايا U2OS.

البروتوكولات القائمة على ثي-نوك و هو مكملة لمزامنة الخلية.

كما هو مبين في الشكل 3A (0 ساعة نقطة الوقت)، والعلاج من قبل بروتوكول ثي-نوك بكفاءة اعتقلت خلايا U2OS في دخول M- مرحلة (السكان مع محتوى الحمض النووي 4C، كما هو موضح باللون الأزرق) والعلاج من قبل بروتوكول هو اعتقل الخلايا في حدود G1 / S (السكان مع 2C محتوى الحمض النووي، كما هو موضح باللون الأخضر / الأحمر). عند إزالة المخدرات، دخلت الخلايا وتطورت من خلال دورة الخلية بطريقة متزامنة. لوحظت الخلايا المستعادة من العلاج ثي-نوك لأول مرة في مرحلة G1 في وقت مبكر (السكان باللون الأخضر)، ثم انتقلت من خلال G1 وحتى مرحلة S بطريقة موحدة. الخلايا التي تعافى من العلاج هو تطورت بشكل متزامن من خلال S (السكان باللون الأحمر) و G2 / M. كان التقدم من خلال دورة الخلية التالية مصحوبا لفقدان التزامن. Consequentlذ، لم يتم تضمين الوقت أكثر من 15 ساعة في هذه التحليلات بسبب فقدان التزامن بعد هذه النقطة الزمنية.

وقد أكد تحليل لطخة غربية من سيكلين E1 (سيكلين G1 / S) وسيكلين B1 (A سيكلين G2 / M)، وهما البروتينات التي تنظم مستوياتها بإحكام في دورة الخلية، و PH3 علامة الانقسامية، مرحلة دورة الخلية من كل نقطة زمنية تحليلها من قبل فاكس ( الشكل 3B ). كما كان متوقعا، أظهرت الخلايا في المرحلة M (المقابلة ل 0 نقطة وقت من خلايا تزامن-نوك) والخلايا في مرحلة G2 إلى M (9 ساعة إلى 12 ساعة نقطة الوقت للخلايا متزامنة هو) تراكم كبير من سيكلين B1 ومستويات غير قابلة للكشف من السيكلين E1. وعلاوة على ذلك، كانت مستويات سيكلين B1 منخفضة إلى لا يمكن الكشف عنها في مرحلة G1 (3 ساعات عند الإفراج عن نوكودازول) وقد لوحظ تراكم تدريجي كما تقدمت الخلايا من خلال S (بعد الإفراج ثي-نوك) وإلى G2 (بعد الإفراج هو). قوي وضع العلامات PH3 من الخلايا في 0 ساعة على ثين-نوك سينكرونيزاتيعلى تأكيد تخصيب الخلايا المعتقل في الانقسام عند هذه النقطة الزمنية. أظهرت زيادة طفيفة على مستويات PH3 في 12 ساعة بعد الإفراج عن هو أن غالبية الخلايا مع محتوى الحمض النووي 4C لا تزال في G2 في حين تم زيادة نسبة الخلايا في الانقسام عند نقطة 15 ساعة. على النقيض من ذلك، أظهر نمط التعبير سيكلين E1 تراكم تدريجي من G1 المبكر إلى دخول S- مرحلة (الإجراء ثي-نوك) والاختفاء التدريجي في مرحلة G2 / M (هو الإجراء).

التعبير عن الجينات التي تنظم بشكل مختلف في دورة الخلية يمكن تحليلها بدقة مع مزيج من التثبي-Noc- و هو القائم على التزامن.

كدليل على مفهوم أن الخلية ينظم دورة تحليل التعبير الجيني هو أفضل يقال من قبل مزيج من اثنين من أساليب تزامن الخلية، والتعبير مرنا من اثنين من أفراد الأسرة E2F المعروف أن يكون لها حركية التعبير مختلفة في دورة الخلية(E2F1 و E2F7) تم فحصها من قبل ترانسكريبتاسيس ير العكسية (رت-قر). تحقيقا لهذه الغاية، تم استخدام بروتوكولات المزامنة ثي-نوك و هو، على النحو الموجز في الشكل 1 ، وتم رصد توزيع دورة الخلية عن طريق التدفق الخلوي كما هو مبين في الشكل 3A . ويبين الشكل 4 E2F1 (العلوي اثنين من الرسوم البيانية) و E2F7 (أقل اثنين من الرسوم البيانية) ملامح مرنا من خلال دورة الخلية. وقد لوحظ على نحو أفضل في الشكل التنظيمي النسخي لجين ترميز E2F1 مع الإجراء ثي-نوك، حيث بدأ التعبير E2F1 تدريجيا لزيادة من مرحلة G1 في وقت مبكر للوصول إلى ذروة في مرحلة G1 في وقت متأخر (9 ساعات بعد الإفراج ثي-نوك، والخلفية الخضراء). وانخفضت مستوياتها بعد ذلك، مصحوبة بدخول إلى المرحلتين S و G2 (الخلفيات الحمراء والزرقاء). على النقيض من ذلك، تم الكشف عن حركية التعبير الجيني E2F7 أفضل بعد المزامنة القائمة على هو (الرسم البياني السفلي، خلفية حمراء)، مع التعبير الذروة في 6 ساعات من إطلاق (المقابلة S إلى المرحلة G2 الانتقالية). خاصتك نوكمن ناحية أخرى، كان مناسبا لمراقبة تحريض E2F7، ولكن ليس لها دونريغولاتيون. من ملاحظة، تمديد التحليل بعد 15 ساعة نقطة الوقت المستنسخة E2F1 و E2F7 مرنا التعبير ملامح من وقت سابق نقطة، على الرغم من أن مع تناقص مجموعة من الاختلاف مرنا (لا تظهر البيانات). وإجمالا، تؤكد هذه النتائج على أهمية العمل مع السكان خلية متزامنة بشكل صحيح لتقييم ليس فقط حركية التعبير الجيني ولكن أيضا السعة الدقيقة للتغيرات في مستويات مرنا.

يوفر تزامن الخلية فهم أفضل لبرنامج التعبير الجيني التي تأثرت العلاج المضادة للسرطان.

لتحليل تأثير عقار مضاد للميتوميسين C (مك) في ديناميات دورة الخلية وكذلك في التعبير الجيني، تم مزامنة خلايا U2OS أولا مع هو وبعد ذلك تعامل مع مك. وقد أدى التعرض لهذا العامل السمي للخلايا إلى تنشيط شيكبوانر في مرحلة G2 الذي كان واضحا بعد 15 ساعة من التعرض ( الشكل 5A ، الصف السفلي، الذروة الزرقاء). وعلى النقيض من ذلك، تقدمت الخلايا غير المعالجة بشكل طبيعي من خلال G1 في هذه المرحلة الزمنية ( الشكل 5A ، الصف العلوي، الذروة الخضراء). كشفت العلاج مك على المدى الطويل (36 ساعة) اعتقال دائم من الخلايا في المرحلة G2 في حين أظهرت الخلايا مع عدم وجود العلاج مك توزيع دورة الخلية التي كانت مماثلة لتلك التي أظهرت من قبل السكان الخلية غير المتزامنة.

تم اختيار E2F1 و P21 Cip1 (CDKN1A) لتحليل التعبير الجيني في الخلايا المعاملة مك ( الشكل 5B )، نظرا لتنظيمها خلية تعتمد على دورة مختلفة. التعبير عن E2F1 هو G1 تعتمد على المرحلة، كما هو موضح في الشكل 4 ، في حين يقترن تحريض p21 Cip1 التعبير إلى دورة الخلية اعتقال / نقطة تفتيش تفعيل 24 . كما هو مبين في الشكل 5B (الرسم البياني الأيسر العلوي)، E2F1 التعبير الجيني كيكانت النيتكس مماثلة في وجود أو غياب مك، كما تقدمت الخلايا من خلال G1 / S وإلى مرحلة S. وقد لوحظت الاختلافات في التعبير الجيني E2F1 بين مك الخلايا المعالجة وغير المعالجة بعد 15 ساعة من التعرض ل مك، حيث أعربت الخلايا المعاملة مك أقل مستويات E2F1 مرنا من خلايا السيطرة ( الشكل 5B ، مقارنة خطوط الصلبة ومتقطع). ومع ذلك، على الرغم من الاختلاف الواضح في التعبير، فإنه لا يمكن استنتاج أن مك يخفض تعبير E2F1، لأن ملامح دورة الخلية من الخلايا المعالجة مك وغير المعالجة تختلف بشكل واضح في هذه النقاط في وقت لاحق، وذلك بسبب استمرار المرحلة G2 اعتقال التي فرضها مك. في الواقع، وانخفاض مستويات E2F1 مرنا بعد نقطة الوقت 15 ساعة في الخلايا مك مكشوفة ربما تعكس تأثير الدواء في ديناميات دورة الخلية، بدلا من تأثير مك في E2F1 التنظيم النسخي.

على النقيض من E2F1، P21 Cip1 هو الجين استجابة مك. مستويات مرتفعة من p21 تم الكشف عن Cip1 في G1 / S اعتقال المفترض هو، مما يدل على G1 تفعيل نقطة تفتيش من قبل هو ( الشكل 5B ، 0 ساعة نقطة الوقت) وتعبيره انخفض بعد ذلك في الخلايا غير مك المعالجة، بما يتفق مع تقدم الخلية الخلية دون انقطاع بعد الإفراج عنهم يقبض على. على النقيض من ذلك، أدى العلاج مك لارتفاع P21 Cip1 مستويات مرنا ( الشكل 5B ، الرسم البياني العلوي الأيمن، خط الصلبة) في حين أن الخلايا تتراكم في مرحلة G2 (9 ساعات من التعرض مك). على الرغم من أن التشكيلات دورة الخلية كانت مماثلة في نقطة زمنية 9 ساعة في السيطرة والخلايا المعالجة مك، يظهر تحليل التعبير الجيني فرقا أساسيا. عرض مك الخلايا المعرضة حاجز G2 تفعيلها، يتضح من قبل تحريض p21 Cip1 التعبير، في حين أن الخلايا غير المعالجة كانت تمر بمرحلة انتقالية غير مثقلة من خلال G2، مع انخفاض مستويات P21 Cip1 .

البيانات التي تم الحصول عليها عن طريق تحليل التدفق الخلوي (فيغور 5A) والبيانات الناتجة عن رت-قر ( الشكل 5B ، والرسوم البيانية العليا) تم دمجها في رسم بياني واحد لكل من الجينات المختارة ( الشكل 4B ، الرسوم البيانية أقل). مستويات التعبير مرنا حيث أظهرت ارتفاع نسبي من القضبان بينما تم توضيح توزيع دورة الخلية من الخلايا لكل عينة مع نسبة الألوان: الأخضر لمرحلة G1 (2C محتوى الحمض النووي)، والأزرق لمرحلة G2 (محتوى الحمض النووي 4C) والأحمر ل S المرحلة (محتوى الحمض النووي وسيطة). هذه الطريقة مجتمعة للتمثيل الرسومي قد تكون مفيدة لتفسير توزيع دورة الخلية وتحليلات التعبير الجيني.

وباختصار، فإن تحليل التعبير الجيني إلى جانب أسلوب مزامنة الثقافة سمح بتحديد الجينات المستجيبة للعوامل الجينية (p21 Cip1 ) وأدى إلى اقتراح أن التغيرات التي لوحظت في التعبير E2F1 بين الخلايا المعالجة وغير المعالجة مع العامل كانت غير مباشرة، ووربما تتعلق الاختلافات في توزيع دورة الخلية من الخلايا.

شكل 1
الشكل 1: نظرة عامة على اثنين من بروتوكولات التزامن الخلية التكميلية: ثيميدين-نوكودازول وهيدروكسي يوريا. ( A ) تمثيل رسومي لدورة الخلية الثدييات مما يشير إلى النقاط التي يتحقق فيها القبض على دورة الخلية من خلال أساليب تزامن الخلية. الخلايا المستندة إلى نك-نوك تستند الخلايا في الانقسام المبكر (M) بينما هو يمنع الخلايا عند حدود G1 / S. ( B ) تمثيل تخطيطي للبروتوكول الخاص بك نوك تزامن الخلية. تظهر هي الخطوات المستخدمة عادة لتحليل التعبير الجيني ورصد دورة الخلية في خلايا U2OS. ( C ) تمثيل تخطيطي للبروتوكول هو القائم على تزامن الخلية. تظهر هي الخطوات المستخدمة عادة لتحليل التعبير الجيني ورصد دورة الخلية في U2OS الخلايا. ويمكن أيضا تطبيق إجراء التزامن أقصر حذف المجاعة المصل إذا تم تحقيق المزامنة الأمثل بالفعل من قبل 24 ساعة التعرض إلى هو. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الشكل 2
الشكل 2: تقييم أساليب المزامنة المناسبة. ( A ) غير المتزامنة و ثي-نوك مزامنة الخلايا U2OS خلية تعرضت لتلطيخ PH3 من أجل تقييم جزء من الخلايا الانقسامية في كل حالة. في وقت واحد بي تلطيخ يسمح رصد محتوى الحمض النووي من الخلايا. في السكان غير المتزامن فقط جزء ضئيل من الخلايا مع محتوى الحمض النووي 4C (باللون الأزرق) كانت إيجابية لمؤشر الانقسام. على النقيض من ذلك، بروتوكول ثي-نوك أكو بكفاءة(إيجابية ل تلطيخ pH3) وسمحت بالتقدم السليم إلى المرحلة التالية G1 (باللون الأخضر) عند إزالة نوكودازول (3 ساعة نقطة الوقت). يتم تلخيص النسبة المئوية للخلايا في كل مرحلة في الجدول و المسمى بألوان وفقا لتلك المستخدمة في الرسم البياني بي: الأخضر لخلايا محتوى الحمض النووي 2C (G1)، الأزرق للخلايا مع محتوى الحمض النووي 4C (بما في ذلك G2 و M الخلايا واسمه G2 في الرسم البياني من أجل تبسيط الشكل، والأحمر للخلايا التي تحتوي على محتوى الحمض النووي وسيطة (S). ( ب ) تم تقييم ثيميدين و هو ل كفاءة تزامن دورة الخلية في خلايا U2OS.وقد تم علاج الخلايا مع ثيميدين (واحد أو اثنين جولات)، أو مع هو لمدة 24 ساعة، وتم فحص تزامن الخلية عن طريق تلطيخ بي وتحليل فاكس.وقد استخدمت القمة لتحليل البيانات فاكس الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الشكل 3
الشكل 3: الخطوط العريضة للإطار الزمني للتطور الموحد للخلايا بعد تزامن-Noc- وتزامن بوساطة هو. ( A ) تمت مزامنة الخلايا U2OS في المرحلة M بواسطة بروتوكول ثي-نوك (الصف العلوي) أو في انتقال G1 / S بواسطة بروتوكول هو (الصف السفلي). تم رصد تطور دورة الخلية عن طريق تلطيخ بي وتحليل فاكس من محتوى الحمض النووي من الخلايا كل 3 ساعات بعد الإفراج عن المواد الكيميائية. وقد استخدمت القمة لتحليل بيانات نظام مراقبة الأصول الميدانية. دخلت الخلايا المنطلقة من الاعتقال توسط-نوك بوساطة في مرحلة G1 في وقت مبكر بعد 3 ساعات، وتقدم بشكل موحد يصل إلى مرحلة S في نقاط زمنية لاحقة. تم نقل الخلايا الصادرة عن الاعتقال بوساطة هو بشكل متزامن من خلال S و G2 مراحل. الخلايا التي جمعت 15 ساعة بعد الإفراج تمثل حدود تزامن الخلية، كما كان التقدم إلى المرحلة التالية تحقيق فقط(د) من قبل جزء صغير من السكان. ( ب ) تم رصد تزامن الخلية بواسطة تحليل لطخة غربية عن طريق جمع عينات البروتين كل 3 ساعات وحتى 15 ساعة بعد الإفراج. حركية التعبير عن سيكلين E1 (CCNE1)، وهي سيكلين تراكمت في الغالب من خلال المرحلة S، سيكلين B1 (CCNB1)، وهي موجودة أساسا من G2 إلى M المرحلة و PHH3، علامة للخلايا الانقسامية، مؤيدة ملامح توزيع دورة الخلية التي لاحظها التدفق الخلوي. أكتين B (أكتب) كان يستخدم للتحكم في التحميل الداخلي لأن مستوياته لا تعتمد على الخلية. (كما تم تعديله من ميتكسيلينا وآخرون 8 ). الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الشكل 4
الشكل (4): دراسة دورة الخلية t النسخ من أفراد الأسرة E2F بواسطة أساليب تزامن الخلية التكميلية. تم إلقاء القبض على خلايا U2OS في G2 / M بواسطة بروتوكول ثي-نوك أو في G1 / S من قبل العلاج هو، وجمعت العينات لاستخراج الحمض النووي الريبي وتحليل فاكس كل 3 ساعات تصل إلى 15 ساعة عند إطلاق سراحهم من الاعتقال. كشف تحليل التعبير الجيني من قبل رت-قر ملف تعريف التعبير E2F1 مقيدة أساسا إلى G1 (الرسم البياني الأيسر العلوي) في حين تم نقل الملف الشخصي الجين E2F7 إلى المرحلة S، مع دونرغولاتيون تدريجيا من خلال مرحلة G2 (الرسم البياني الأيمن السفلي). تم استخدام تبب كجين منظم غير الخلية دورة الدورة الدموية لحساب التغيرات النسبية في مستويات مرنا وكانت النتائج ممثلة كمتوسط ​​القيم والانحراف المعياري (سد). تم تحديد التقدم من خلال دورة الخلية عن طريق تلطيخ بي وتحليل فاكس لمحتوى الحمض النووي من الخلايا. تم تمثيل مراحل دورة الخلية كألوان الخلفية في الرسوم البيانية: أسود (الاعتقال في الانقسام المبكر) والأخضر (المرحلة G1) والأحمر (المرحلة S) والأزرق (G2 المرحلة)..com / فيليز / ftp_upload / 55745 / 55745fig4large.jpg "تارجيت =" _ بلانك "> الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الشكل 5
الشكل 5: تأثير مك على التعبير الجيني وتطور دورة الخلية. تم علاج خلايا U2OS مع هو لمدة 24 ساعة، و مك (250 نانومتر) أضيفت مباشرة بعد الإفراج عن اعتقال H1 / S بوساطة هو. تم جمع عينات لتحليل فاكس وتحليل التعبير الجيني في نقاط زمنية محددة. ( A ) تم تحديد التقدم من خلال دورة الخلية عن طريق تلطيخ بي وتحليل فاكس من محتوى الحمض النووي من قبل برنامج القمة. مك تسببت في تأخير معتدل في التقدم من خلال مرحلة S (السكان الأحمر) واعتقال دائم في مرحلة G2 (السكان الزرقاء)، كما يتبين من عدم وجود خلايا في G1 (السكان الأخضر) بعد 15 ساعة من العلاج (الصف السفلي) مقارنة إلى المنظمات غير الحكومية،(الصف العلوي) الخلايا. ( B ) E2F1 و P21 Cip1 تم إجراء تحليل التعبير الجيني في مك الخلايا المعالجة أو غير المعالجة على مستوى مرنا بواسطة رت-قر. تم استخدام oxa1L كجينات داخلية غير مستجيبة لل مك، وكانت النتائج ممثلة كقيم متوسطة و سد. تمثل الرسوم البيانية العليا مستويات مرنا النسبية من الجينات المحددة بعد الإفراج عن هو وإضافة مك. الرسوم البيانية السفلى تجمع بين البيانات التي تم الحصول عليها عن طريق تحليل فاكس و رت-قر. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

ويتطلب تحليل الجينات المنظمة الدقيقة التي تنطوي على أدوار عابرة ومحددة في دورة الخلية وجود خلية موحدة. يستخدم العديد من الباحثين بشكل روتيني خطوط الخلايا السرطانية الطويلة الأمد لهذه الأغراض، وقد تم تطوير مجموعة متنوعة من الأساليب للحصول على سكان الخلية المتزامنة (أو المتزامنة جزئيا)، بهدف تجميع أكبر عدد ممكن من الخلايا في مراحل دورة الخلية المحددة. وعلاوة على ذلك، بذلت جهود قوية لتحسين وتحسين نهج المزامنة الراسخة. ومع ذلك، فإن جميع بروتوكولات التزامن لها عيوب، يمكن أن تعزى إلى عدم التجانس في ثقافات الخلايا، إلى الكفاءة دون المستوى الأمثل لإجراءات المزامنة، أو للآثار الثانوية التي تحدثها المزامنات الكيميائية في وظيفة الخلية، من بين أمور أخرى. يجب أن تؤخذ هذه القيود بعين الاعتبار عند تطبيق بروتوكولات مزامنة الخلية. ويحتاج الباحثون إلى تحديد أساليب المزامنة الأكثر ملاءمة ل سبيسيفإيك نوع الخلية أو التجربة. حتى زراعة خطوط الخلايا المختلفة في بالضبط بنفس الطريقة، مما أدى إلى معدلات التزامن قد تختلف بسبب عدة أسباب. فمن ناحية، قد يختلف طول دورة الخلية تبعا لخط الخلية المحدد؛ من ناحية أخرى، نفس المانع قد يكون لها آثار متباينة على خطوط الخلايا المختلفة بسبب خصائص معينة من كل خط خلية 25 . وعلاوة على ذلك، يجب دائما ضبط تركيز المانع المحدد ووقت التعرض لكل خط خلية من أجل تجنب أو تقليل السمية الجانبية غير المرغوب فيها 26 . حتى بعد تحقيق أقصى استفادة من كل هذه الجوانب، 100٪ تراكم الخلايا في مرحلة دورة الخلية معين لا يتحقق أبدا، و أسينكروني يزيد تدريجيا بعد إزالة المادة الكيميائية 27 . وبالتالي، من المهم أن نفهم أن أساليب التزامن تحصل في أحسن الأحوال على تخصيب سكاني جزئي في الخلية في إطار زمني معين.

في هذا ث وقد تم تحسين أورك اثنين من إجراءات التزامن (ثي-نوك و هو) لاستخدامها في خلايا U2OS، وكلاهما تستخدم على نطاق واسع لمقايسات تزامن الخلية 28 ، 29 ، 30 . لوقف الخلايا في المرحلة M، مزيج من ثيميدين و نوكودازول عملت بكفاءة في خلايا U2OS. ونظرا للطبيعة السامة للخلايا من نوكودازول، كان من المهم تحديد وقت التعرض والجرعة من هذا المانع من أجل الحصول ليس فقط السكان الخلية متزامنة للغاية ولكن أيضا البقاء على قيد الحياة الأمثل الخلية. أدى التعرض المسبق ل ثيميدين (أو نظريا أي مركب مماثل آخر مثل هيدروكسي يوريا) إلى إثراء السكان الخلية في G1 و S مراحل، مما يقلل من الوقت اللازم التعرض نوكودازول. لوقف الخلايا في G1 / S، تم النظر في العديد من الاحتمالات، بما في ذلك كتلة ثيميدين مزدوجة، وهي الطريقة التي هي فعالة جدا في تزامن العديد من خطوط الخلايا"> 31 ، 32. ومع ذلك، تم التخلص من ثيميدين نظرا لنتائجها المخيبة للآمال في U2OS، واحدة من العلاج ثيميدين اعتقلت سوى جزء صغير من الخلايا، في حين أن جولتين من العلاج ثيميدين سدت بكفاءة غالبية الخلايا في G1 / S، ولكن G1 تم الحفاظ على السكان بعد الإفراج عن ثيميدين والتقدم دورة الخلية لم تتقدم بشكل موحد، وعلى النقيض من ذلك، قدمت العلاج هيدروكسي يوريا جيدة G1 / S عرقلة النتائج والتقدم موحد للخلايا من خلال S وإلى G2.

وينبغي دراسة توزيع مرحلة دورة الخلية عند إجراء تجارب تزامن الخلية (على سبيل المثال من قبل تلطيخ يوديد بروبيديوم أو وضع العلامات PH3 تليها تحليل فاكس، أو عن طريق إمونوبلوتينغ من دورة الخلية البروتينات مرحلة محددة) 16 ، 33 ، 34 ، من أجل تفسير أفضل التعبير الجيني النتائج. تزامن غير صحيح إفيسينسي أو اختلافات طفيفة بين التجارب في التقدم من خلال دورة الخلية قد يؤدي إلى استنتاجات خاطئة. على سبيل المثال، من المعروف أن العلاج نوكودازول يسبب فشل وظيفة نقطة الانقسام الإنقسامية في ظل ظروف معينة. وهذا يؤدي إلى عدد من الخلايا مع محتوى الحمض النووي 4C ولكن سلبية للعلامات الانقسامية 34 أن "زلات" الانقسامية الانقسامية ويعود إلى البيني مع محتوى 4C 35 . ظهور هذه المجموعة الفرعية من الخلايا، والتي يمكن الكشف عن طريق المناعية مع الأجسام المضادة لمكافحة الفوسفو H3 (انظر الشكل 2A ) قد يكون الحد الأدنى من خلال استخدام برنامج تلفزيوني الباردة لخطوات الغسيل نوكودازول. وهناك تأثير آخر مرتبط باستخدام مثبطات كيميائية يؤثر على تزامن الخلية هو تفعيل نقطة التفتيش المرتبطة بالتعرض لهذه المركبات 36 ، 37 ، وهي آلية تقوم الخلية من خلالها باعتقال التقدم من خلال دورة الخلية حتى يمكنضمان أن العمليات السابقة لتلك النقطة الدقيقة (مثل تكرار الحمض النووي الصحيح، التجمع المغزل)، يتم حلها 38 . ولكي تكون طريقة المزامنة كافية، يجب ألا يكون الاعتقال فعالا فحسب، بل يجب أيضا عكسه تماما. وهكذا، بعد الإفراج عن مثبطات دورة الخلية من المهم تحليل ما إذا كانت آثار المانع قد عادت، على سبيل المثال من خلال تحليل التعبير عن علامات نقطة التفتيش، مثل p21 سيب . ويبين الشكل 5B أن خلايا U2OS هيدروكسيوريا متزامنة حلت بشكل فعال نقطة التفتيش، لأن مستويات P21 سيب تم تخفيضها إلى التعبير القاعدية بعد الافراج عنهم.

في الخلايا U2OS، ونسبة التخصيب على اعتقال دورة الخلية تقع ضمن نطاق ذكرت من قبل دراسات أخرى على تزامن الخلية 29 ، 30 ، 39 : حوالي 85٪ من الخلايا مع محتوى الحمض النووي 4C (تلطيخ بي) و أبريكسيما يقرب من 90٪ من تلك في الانقسام (وضع العلامات الإيجابية PH3) على العلاج ثيميدين-نوكودازول، ونحو 80-90٪ من الخلايا G1 / S بعد العلاج هيدروكسيوريا. والإفراج عن الاعتقال دورة الخلية يدفع عادة التقدم السليم خلال المرحلة أو مرحلتين المقبل بطريقة موحدة، على الرغم من أن التزامن يتم فقدان دائما بعد عدة ساعات والخلايا غير قادرة على إكمال دورة انقسام الخلية بأكملها بطريقة متزامنة. لذلك، من أجل الحصول على صورة كاملة لجميع مراحل دورة الخلية، والبروتوكول المقترح في هذا العمل يجعل استخدام اثنين من أساليب التزامن من أجزاء مختلفة من دورة الخلية. كما هو مبين في الشكل 3A ، كل بروتوكول الفردية لم تضمن التزامن على دورة الخلية بأكملها. توفر المزامنة المستندة إلى ثي-نوك إطارا مناسبا للعمليات التي تحدث في مراحل G1 إلى S، في حين أن الخلايا المفرج عنها من هو كانت مناسبة لتحليل الأحداث التي تحدث خلال S و G2 / M. أوجه التكامل في الإجراءين المختارين( الشكل 4 )، ودعم فكرة أن الجمع بين طريقتين التي تزامن في مراحل مختلفة من دورة الخلية هو نهج قوي لتحديد بدقة الجينات تنظيم الدورة الجينية التعبير وأنماط وفهم أفضل لدورهم الفسيولوجي.

ويركز تطبيق مقنن لإجراءات تزامن الخلية على تقييم تأثير العوامل العلاجية المحتملة. وغالبا ما يدرس تأثير المركبات الصيدلانية، مثل تلك التي لها نشاط مضاد للورم في السكان الخلية غير متزامن. تحت هذه الإعدادات فمن الممكن لتحديد الآثار المترتبة على الدواء المحدد في تحريض عدة عمليات مثل موت الخلية، دورة الخلية اعتقال أو الشيخوخة 7 ، 40 . ومع ذلك، واختيار إعدادات الخلية غير متزامنة لتحديد الأحداث الجزيئية دقيقة تنظمقد تؤدي هذه العمليات إلى استنتاجات غير كاملة أو خاطئة جزئيا. هذه النقطة، والتي غالبا ما يتم تجاهلها، وقد تم توضيحها في هذا العمل من خلال تحليل تأثير المخدرات العلاج الكيميائي مك على E2F1 و P21 Cip1 التعبير الجيني ( الشكل 5 ). عموما، مزيج من تزامن الخلية والعلاج مع وكلاء السمية الجينية يوفر السياق المناسب الذي لدراسة التعبير عن الجينات التي تستجيب لعامل السامة الجينية والتمييز من أولئك المتضررين من اضطرابات دورة الخلية التي يفرضها الوكيل.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

الكتاب ليس لديهم ما يكشف.

Acknowledgments

ونشكر أعضاء مختبرات زوبياغا ومختبرات ألتمير على المناقشات المفيدة والدعم التقني. وأيد هذا العمل من خلال منح مقدمة من الوزارة الإسبانية (SAF2015-67562-R، مينيكو / فيدر، إي)، وحكومة الباسك (IT634-13 و كك-2015/89)، وجامعة الباسك أوب / إهو ( UFI11 / 20).

Materials

Name Company Catalog Number Comments
DMEM, high glucose, GutaMAX supplement Thermo Fisher Scientific 61965-059
FBS, qualified, E.U.-approved, South America origin Thermo Fisher Scientific 10270-106
Penicillin-Streptomycin (10,000 U/mL) Thermo Fisher Scientific 15140-122
0.25% Trypsin-EDTA (1x), phenol red Thermo Fisher Scientific 25200-072
Thymidine SIGMA T1895-5G Freshly prepared. Slight warming might help dissolve thymidine.
Nocodazole SIGMA M-1404 Stock solution in DMSO stored at -20 ºC in small aliquots
Hydroxyurea SIGMA H8627 Freshly prepared
Mitomycin C from Streptomyces caespitosus SIGMA M4287 1.5 mM stock solution in sterile H2O protected from light and stored at 4 ºC
Dimethyl sulfoxide SIGMA D2650
Propidium iodide SIGMA P4170 Stock solution in sterile PBS at 5 mg/ml, stored at 4 º C protected from light.
PBS pH 7.6 Home made
Ethanol PANREAC A3678,2500
Chloroform SIGMA C2432
Sodium Citrate PANREAC 131655
Triton X-100 SIGMA T8787
RNAse A Thermo Fisher Scientific EN0531
TRIzol Reagent LifeTechnologies 15596018
RNeasy Mini kit QIAGEN 74106
High-Capacity cDNA Reverse Transcription Kit Thermo Fisher Scientific 4368814
Anti-Cyclin E1 antibody Cell Signaling 4129 1:1000 dilution in 5% milk, o/n, 4 ºC
Anti-Cyclin B1 antibody Cell Signaling 4135 1:1000 dilution in 5% milk, o/n, 4 ºC
Anti-β-actin SIGMA A-5441 1:3000 dilution in 5 % milk, 1 hr, RT
Anti-pH3 (Ser 10) antiboty Millipore 06-570 Specified in the protocol
Secondary anti-rabbit AlexaFluor 488 antibody Invitrogen R37116 Specified in the protocol
Secondary anti-mouse-HRP antibody Santa Cruz Biotechnology sc-3697 1:3000 dilution in 5 % milk, 1 hr, RT
Forward E2F1 antibody (human)                    TGACATCACCAACGTCCTTGA Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse E2F1 antibody (human)                    CTGTGCGAGGTCCTGGGTC Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward E2F7 antibody (human)                    GGAAAGGCAACAGCAAACTCT Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse E2F7 antibody (human)                    TGGGAGAGCACCAAGAGTAGAAGA Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward p21Cip1 antibody (human)                    AGCAGAGGAAGACCATGTGGAC Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse p21Cip1 antibody (human)                    TTTCGACCCTGAGAGTCTCCAG Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward TBP antibody (human) reference gene                     Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse TBP antibody (human)                     Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward Oxa1L antibody (human) reference gene   CACTTGCCAGAGATCCAGAAG                  Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse Oxa1L  antibody (human)    CACAGGGAGAATGAGAGGTTTATAG                 Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Power SYBRGreen PCR Master Mix Thermo Fisher Scientific 4368702
FACS Tubes  Sarstedt 551578
MicroAmp Optical 96-Well Reaction Plate Thermo Fisher Scientific N8010560
Corning 100 mm TC-Treated Culture Dish Corning
Corning Costar cell culture plates 6 well Corning 3506
Refrigerated Bench-Top Microcentrifuge Eppendorf 5415 R
Refrigerated Bench-Top Centrifuge Jouan CR3.12 Jouan 743205604
NanoDrop Lite Spectrophotometer Thermo Scientific ND-LITE-PR
BD FACSCalibur Flow Cytometer BD Bioscience
QuantStudio 3 Real-Time PCR System Thermo Fisher Scientific A28567

DOWNLOAD MATERIALS LIST

References

  1. Beato, M., Sánchez-Aguilera, A., Piris, M. A. Cell cycle deregulation in B-cell lymphomas. Blood. 101, (4), 1220-1235 (2003).
  2. Chen, H. Z., Tsai, S. Y., Leone, G. Emerging roles of E2Fs in cancer: an exit from cell cycle control. Nat Rev Cancer. 9, (11), 785-797 (2009).
  3. Cho, R. J., et al. Transcriptional regulation and function during the human cell cycle. Nat Genet. 27, (1), 48-54 (2001).
  4. Peña-Diaz, J., et al. Transcription profiling during the cell cycle shows that a subset of Polycomb-targeted genes is upregulated during DNA replication. Nucleic Acids Res. 41, (5), 2846-2856 (2013).
  5. Grant, G. D., et al. Identification of cell cycle-regulated genes periodically expressed in U2OS cells and their regulation by FOXM1 and E2F transcription factors. Mol Biol Cell. 24, (23), 3634-3650 (2013).
  6. Minderman, H., et al. In vitro and in vivo irinotecan-induced changes in expression profiles of cell cycle and apoptosis-associated genes in acute myeloid leukemia cells. Mol Cancer Ther. 4, (6), 885-900 (2005).
  7. McKenna, E., Traganos, F., Zhao, H., Darzynkiewicz, Z. Persistent DNA damage caused by low levels of mitomycin C induces irreversible cell senescence. Cell Cycle. 11, (16), 3132-3140 (2012).
  8. Infante, A., et al. E2F2 represses cell cycle regulators to maintain quiescence. Cell Cycle. 7, (24), 3915-3927 (2008).
  9. Cecchini, M. J., Amiri, M., Dick, F. A. Analysis of cell cycle position in mammalian cells. J Vis Exp. (59), (2012).
  10. Schorl, C., Sedivy, J. M. Analysis of cell cycle phases and progression in cultured mammalian cells. Methods. 41, (2), 143-150 (2007).
  11. Lalande, M. A reversible arrest point in the late G1 phase of the mammalian cell cycle. Exp Cell Res. 186, (2), 332-339 (1990).
  12. Park, S. Y., et al. Mimosine arrests the cell cycle prior to the onset of DNA replication by preventing the binding of human Ctf4/And-1 to chromatin via Hif-1α activation in HeLa cells. Cell Cycle. 11, (4), 761-766 (2012).
  13. Ikegami, S., et al. Aphidicolin prevents mitotic cell division by interfering with the activity of DNA polymerase-alpha. Nature. 275, (5679), 458-460 (1978).
  14. Baranovskiy, A. G., et al. Structural basis for inhibition of DNA replication by aphidicolin. Nucleic Acids Res. 42, (22), 14013-14021 (2014).
  15. Adams, R. L., Lindsay, J. G. Hydroxyurea reversal of inhibition and use as a cell-synchronizing agent. J Biol Chem. 242, (6), 1314-1317 (1967).
  16. Mitxelena, J., Apraiz, A., Vallejo-Rodríguez, J., Malumbres, M., Zubiaga, A. M. E2F7 regulates transcription and maturation of multiple microRNAs to restrain cell proliferation. Nucleic Acids Res. (2016).
  17. Bootsma, D., Budke, L., Vos, O. Studies on synchronous division of tissue culture cells initiated by excess thymidinE. Exp Cell Res. 33, 301-309 (1964).
  18. Galgano, P. J., Schildkraut, C. L. G1/S Phase Synchronization using Double Thymidine Synchronization. CSH Protoc. (2), (2006).
  19. Edwin Taylor, W. Kinetics of inhibition and the binding of h3-colchicine. J Cell Biol. 25, 145-160 (1965).
  20. Zieve, G. W., Turnbull, D., Mullins, J. M., McIntosh, J. R. Production of large numbers of mitotic mammalian cells by use of the reversible microtubule inhibitor nocodazole. Nocodazole accumulated mitotic cells. Exp Cell Res. 126, (2), 397-405 (1980).
  21. Matsui, Y., Nakayama, Y., Okamoto, M., Fukumoto, Y., Yamaguchi, N. Enrichment of cell populations in metaphase, anaphase, and telophase by synchronization using nocodazole and blebbistatin: a novel method suitable for examining dynamic changes in proteins during mitotic progression. Eur J Cell Biol. 91, (5), 413-419 (2012).
  22. Nolan, T., Hands, R. E., Bustin, S. A. Quantification of mRNA using real-time RT-PCR. Nat Protoc. 1, (3), 1559-1582 (2006).
  23. Thornton, B., Basu, C. Real-time PCR (qPCR) primer design using free online software. Biochem Mol Biol Educ. 39, (2), 145-154 (2011).
  24. Abbas, T., Dutta, A. p21 in cancer: intricate networks and multiple activities. Nat Rev Cancer. 9, (6), 400-414 (2009).
  25. Kung, A. L., Sherwood, S. W., Schimke, R. T. Cell line-specific differences in the control of cell cycle progression in the absence of mitosis. Proc Natl Acad Sci U S A. 87, (24), 9553-9557 (1990).
  26. Borel, F., Lacroix, F. B., Margolis, R. L. Prolonged arrest of mammalian cells at the G1/S boundary results in permanent S phase stasis. J Cell Sci. 115 (Pt. 14, 2829-2838 (2002).
  27. Knehr, M., et al. A critical appraisal of synchronization methods applied to achieve maximal enrichment of HeLa cells in specific cell cycle phases). Exp Cell Res. 217, (2), 546-553 (1995).
  28. Zhu, W., Giangrande, P. H., Nevins, J. R. E2Fs link the control of G1/S and G2/M transcription. EMBO J. 23, (23), 4615-4626 (2004).
  29. Whitcomb, E. A., Dudek, E. J., Liu, Q., Taylor, A. Novel control of S phase of the cell cycle by ubiquitin-conjugating enzyme H7. Mol Biol Cell. 20, (1), 1-9 (2009).
  30. Bruinsma, W., Macurek, L., Freire, R., Lindqvist, A., Medema, R. H. Bora and Aurora-A continue to activate Plk1 in mitosis. J Cell Sci. 127, 801-811 (2014).
  31. Thomas, D. B., Lingwood, C. A. A model of cell cycle control: effects of thymidine on synchronous cell cultures. Cell. 5, (1), 37-42 (1975).
  32. Whitfield, M. L., et al. Identification of genes periodically expressed in the human cell cycle and their expression in tumors. Mol Biol Cell. 13, (6), 1977-2000 (2002).
  33. Lim, S., Cdks Kaldis, P. cyclins and CKIs: roles beyond cell cycle regulation. Development. 140, (15), 3079-3093 (2013).
  34. Tapia, C., et al. Two mitosis-specific antibodies, MPM-2 and phospho-histone H3 (Ser28), allow rapid and precise determination of mitotic activity. Am J Surg Pathol. 30, (1), 83-89 (2006).
  35. Andreassen, P. R., Martineau, S. N., Margolis, R. L. Chemical induction of mitotic checkpoint override in mammalian cells results in aneuploidy following a transient tetraploid state. Mutat Res. 372, (2), 181-194 (1996).
  36. Wei, F., Xie, Y., He, L., Tao, L., Tang, D. ERK1 and ERK2 kinases activate hydroxyurea-induced S-phase checkpoint in MCF7 cells by mediating ATR activation. Cell Signal. 23, (1), 259-268 (2011).
  37. Kubota, S., et al. Activation of the prereplication complex is blocked by mimosine through reactive oxygen species-activated ataxia telangiectasia mutated (ATM) protein without DNA damage. J Biol Chem. 289, (9), 5730-5746 (2014).
  38. Hartwell, L. H., Weinert, T. A. Checkpoints: controls that ensure the order of cell cycle events. Science. 246, (4930), 629-634 (1989).
  39. St-Denis, N. A., Derksen, D. R., Litchfield, D. W. Evidence for regulation of mitotic progression through temporal phosphorylation and dephosphorylation of CK2alpha. Mol Cell Biol. 29, (8), 2068-2081 (2009).
  40. Min, A., et al. RAD51C-deficient cancer cells are highly sensitive to the PARP inhibitor olaparib. Mol Cancer Ther. 12, (6), 865-877 (2013).
دراسة الخلية التعبير عن تنظيم دورة الجينات من قبل اثنين من بروتوكولات التزامن الخلية التكميلية
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Apraiz, A., Mitxelena, J., Zubiaga, A. Studying Cell Cycle-regulated Gene Expression by Two Complementary Cell Synchronization Protocols. J. Vis. Exp. (124), e55745, doi:10.3791/55745 (2017).More

Apraiz, A., Mitxelena, J., Zubiaga, A. Studying Cell Cycle-regulated Gene Expression by Two Complementary Cell Synchronization Protocols. J. Vis. Exp. (124), e55745, doi:10.3791/55745 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter