Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Het bestuderen van celcyclusreguleerde genuitdrukking door twee complementaire celsynchronisatieprotocollen

doi: 10.3791/55745 Published: June 6, 2017
* These authors contributed equally

Summary

We rapporteren twee celsynchronisatieprotocollen die een context bieden voor het bestuderen van gebeurtenissen die verband houden met specifieke fasen van de celcyclus. We tonen aan dat deze aanpak nuttig is voor het analyseren van de regulering van specifieke genen in een ongeblokkeerde celcyclus of bij blootstelling aan agens die de celcyclus beïnvloeden.

Abstract

Het genuitdrukkingsprogramma van de celcyclus is een kritische stap voor het begrijpen van celcyclusafhankelijke processen en hun rol in ziekten zoals kanker. Celcyclus-gereguleerde genexpressie analyse hangt van celsynchronisatie in specifieke fasen af. Hier beschrijven we een methode die gebruik maakt van twee complementaire synchronisatieprotocollen die vaak gebruikt worden voor het bestuderen van periodieke variatie van genuitdrukking tijdens de celcyclus. Beide procedures zijn gebaseerd op het voorbijgaande blokkeren van de celcyclus in een bepaald punt. Het synchronisatieprotocol door hydroxyurea (HU) -behandeling leidt tot cellulaire arrestatie in de late G1 / early S-fase, en vrijlating van HU-gemedieerde arrestatie zorgt ervoor dat een cellulaire populatie uniform door S en G2 / M vordert. Het synchronisatieprotocol door thymidine en nocodazol (Thy-Noc) behandeling blokkeert cellen in de vroege mitose, en vrijlating uit Thy-Noc gemedieerde arrestatie levert een gesynchroniseerde cellulaire populatie geschikt voor G1 fase en S fase-enProbeer studies. Toepassing van beide procedures vereist het controleren van de celcyclusverdelingsprofielen, die typisch worden uitgevoerd na propidiumjodide (PI) kleuring van de cellen en flowcytometrie gemedieerde analyse van DNA-inhoud. We laten zien dat het gecombineerde gebruik van twee synchronisatieprotocollen een robuuste aanpak is om de transcriptieprofielen van genen die in de celcyclus anders gereguleerd zijn, duidelijk te bepalen ( dwz E2F1 en E2F7) en dus beter inzicht te krijgen in hun rol in celcyclus processen. Verder tonen wij aan dat deze aanpak nuttig is voor het bestuderen van mechanismen die gebaseerd zijn op geneesmiddelen gebaseerde therapieën ( dwz mitomycine C, een anticancer agent), omdat het het mogelijk maakt genen die reageren op het genotoxische middel te discrimineren van diegenen die alleen door celcyclusverstoringen worden beïnvloed Opgelegd door de agent.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Overgang door alle fasen van de celcyclus wordt gekoppeld aan een strak gereguleerd genuitdrukkingsprogramma. Deze gecoördineerde "aan en uit" van gentranscriptie gedurende de celcyclus wordt geacht onder controle te zijn van complexe transcriptie regulerende systemen, die niet alleen de timing reguleren, maar ook de niveaus van genuitdrukking. Deregulatie van belangrijke celcycluscomponenten is bekend om bij te dragen tot de ontwikkeling van verschillende aandoeningen en is een goed gevestigd kenmerk van tumorigenese 1 , 2 . Genoom-brede transcriptomische analyses uitgevoerd in gist- en zoogdiercellen hebben aangetoond dat een groot aantal genen periodieke genuitdrukkingspatronen in de celcyclus vertoont, wat aangeeft dat transcriptieve fluctuaties tijdens de celcyclus een afspiegeling vormen van de tijdelijke vereiste van een gegeven genproduct In een precieze fase 3 , 4 , 5 .

Een belangrijke taak in de studie van celcyclusreguleerde genuitdrukking is de synchronisatie van cellen in specifieke celcyclusfasen. Cellsynchronisatie helpt de associatie van een genuitdrukkingspatroon te interpreteren met een bepaalde cyclusfaseovergang, en het heeft geleid tot een beter inzicht in de regulering en functie van talrijke genen. Cellsynchronisatie is ook belangrijk voor het bestuderen van het werkingsmechanisme van anticancermiddelen, omdat chemotherapeutische middelen bekend zijn om zowel de genuitdrukking als de celcycluskinetiek 6 , 7 te beïnvloeden. Niettemin is het vaak moeilijk om te bepalen of genuitdrukkingsverschillen die voortvloeien uit de behandeling met deze middelen een directe reactie op de behandeling zijn of gewoon het gevolg zijn van veranderingen in celcyclusprofielen. Om te onderscheiden tussen deze mogelijkheden, moet genuitdrukking worden geanalyseerd in cellen die s zijn geweestGechronchroniseerd voorafgaand aan toevoeging van het chemotherapeutische geneesmiddel.

Met uitzondering van enkele primaire cellen, zoals vers geïsoleerde lymfoïde cellen, die een homogene celpopulatie vormen die gesynchroniseerd zijn in G08, groeien in vitro gevestigde cellijnen asynchroon in cultuur. Onder regelmatige groeivoorwaarden worden deze asynchrone cyclische cellen gevonden in alle fasen van de celcyclus, maar bij voorkeur in G1 9 . Daarom biedt deze context geen optimaal scenario voor functionele of genexpressieanalyses in een specifieke celcyclusfase (bijvoorbeeld G1, S, enz.). Niet-getransformeerde immortalized cellijnen ( bijv. Fibroblasten) kunnen worden gesynchroniseerd met zogenaamde fysiologische methoden 10 . Deze methoden zijn gebaseerd op de bewaarde primaire celkenmerken van niet-getransformeerde cellen, zoals celcontact remming en afhankelijkheid van de groeifactor om verder te gaan fietsen. VerwijderingVan serum in combinatie met contactinhibitie maakt niet-getransformeerde cellen gearresteerd bij G0 / G1. Echter, de gesynchroniseerde celcyclusinvoer en de progressie vereisen vaak subcultuur, die ook kunstmatige loslating van de cellen inhoudt en opnieuw opbouwt 10 . Belangrijker nog, deze methode is niet geschikt voor synchronisatie van getransformeerde cellijnen, de overgrote meerderheid van gevestigde cellijnen die momenteel in gebruik zijn, gekenmerkt door het ontbreken van celcontact gemedieerde groei remming of respons op groeifactor onttrekking. Zo is het duidelijk dat alternatieve methoden nodig zijn voor efficiënte celsynchronisatie in specifieke fasen van de celcyclus. In het algemeen zijn de meest gebruikte synchronisatiemethoden gebaseerd op transiënte chemische of farmacologische remming van een bepaald punt van de celcyclus, typisch DNA synthese of mitotische spindelvorming. Inhibitie van DNA-synthese synchroniseert cellen door ze in de late G1 of vroege S-fase te arresteren. Dit kan achi zijnDoor middel van toevoeging van verbindingen zoals mimosine, een inhibitor van nucleotidebiosynthese 11 , 12 , aphidicoline, een inhibitor van DNA-polymerasen 13 , 14 , hydroxyureum, een inhibitor van ribonucleotide reductase 15 , 16 of door overmaat hoeveelheden thymidine 17 , 18 . Aan de andere kant kunnen remmers van microtubule-polymerisatie, zoals colchicine of nocodazol, de mitotische spindelvorming blokkeren, wat leidt tot cellynchronisatie in de vroege M-fase 19 , 20 , 21 .

In dit werk beschrijven wij een methode waarbij twee complementaire synchronisatieprotocollen zijn gebaseerd op transiënte chemische remming voor het bestuderen van de expressie van celcyclusreguleerde genen bij het mRNAniveau. Deze methode is essentieel voor het bepalen van de rol van celcyclusgenen in specifieke celcyclusprocessen. Bovendien biedt het een algemeen kader voor het bestuderen van de impact van anticancerbehandelingen om nauwkeurig medicijnresponsieve genen te detecteren en misinterpretaties af te leiden die zijn afgeleid van verstoringen in de celcyclusprogressie die door deze medicijnen wordt gegenereerd.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Cellulaire synchronisatie, vrijlating en bewaking van de celcyclusprogressie

  1. Thymidine- en nocodazol-gebaseerde (Thy-Noc) synchronisatie en afgifte van U2OS-cellen uit Mitosis
    1. Bereid het vereiste celcultuurmedium op. U2OS-cellen worden routinematig gegroeid in DMEM-Glutamine-medium aangevuld met 10% (vol / vol) FBS (optioneel: 1% penicilline / streptomycine). Voer alle medium voorbereiding en manipulatie onder steriele omstandigheden en opgewarmd aangevuld medium (vanaf nu wel aangeduid als "compleet medium") tot 37 ° C voor gebruik.
    2. Zaad 2 x 10 6 U2OS cellen per 100 mm schotel in 10 ml compleet kweekmedium. Om het aantal benodigde gerechten te berekenen, rekening houdend met het feit dat elke 100 mm schotel meestal genoeg mitotische cellen biedt om ongeveer 5 putjes van een 6-putjesplaat (0,2 - 0,25 x 10 6 cellen / putje) te platen (zie figuur 1B ). Twee putten per geselecteerd tijdstip zijn requirEd in het experiment (1 putje voor RNA-extractie en 1 putje voor celcyclusmonitoring). Bovendien kan een derde put verzameld worden per tijdspunt voor eiwitanalyse.
      OPMERKING: Plate cellen in de avond (rond 7 uur), zodat volgende stappen kunnen worden uitgevoerd tijdens de werkuren de volgende dagen. Inclusief 2 aanvullende putten van asynchroongroeiende cellen om FACS analyse compensatie instellingen te definiëren.
    3. Laat de cellen bevestigen door 100 mm gerechten bij 37 ° C in een bevochtigde atmosfeer met 5% CO 2 gedurende 24 uur te incuberen.
    4. Voor het thymidine blok bereidt u een 200 mM thymidine voorraadoplossing door 145,2 mg thymidine poeder in 3 ml H20 (of equivalente hoeveelheden) op te lossen en de oplossing door filtratie te steriliseren door een 0,2 μm poriegrootte filter. Lichte opwarming kan helpen om thymidine op te lossen. Voeg 100 μl van de vers bereide 200 mM voorraad aan elke 100 mm kweekschotel (eindconcentratie 2 mM). Incubeer cellen met thymidine gedurende 20 uur bij 3776; C in een bevochtigde atmosfeer met 5% CO2.
      OPMERKING: Behandel de cellen in de avond (rond 7 uur), om de volgende dag de tijd te hebben om zowel de thymidine vrijgave als de nocodazol te blokkeren.
    5. Om vrij te maken van het thymidine blok, verwijder het thymidine bevattende groeimedium in de middag de volgende dag (3 uur); Wascellen tweemaal met voorverwarmde 1x PBS en voeg 10 ml volledig medium toe aan elke 100 mm schotel. Incubeer cellen gedurende 5 uur bij 37 ° C in een bevochtigde atmosfeer met 5% CO2.
    6. Voeg voor mitotische celarrest nocodazol toe tot een eindconcentratie van 50 ng / ml (8 uur). Bereid een voorraadoplossing door het oplossen van nocodazolpoeder in DMSO ( bijv. 5 mg / ml) en opberg-bevroren bij -20 ° C. Incubeer cellen met nocodazol gedurende 10-11 uur bij 37 ° C in een bevochtigde atmosfeer met 5% CO2.
    7. Vrijkomen van nocodazol-gemedieerde arrestatie in vroege M-fase (mitotische shake-off) en verzameling van monsters op verschillende tijdstippenNts (vanaf 6-7 uur).
      1. Maak afgeronde (mitotische) cellen los door elke plaat te schudden en zorgvuldig pipetiseren van nocodazol-bevattend groeimedium. Verzamel medium met losstaande cellen van elke 100 mm plaat in 50 ml steriele buizen, centrifuge (300 xg, 5 min, kamertemperatuur (RT)) en wascellen twee keer door 1x PBS toe te voegen, gevolgd door centrifugeren. Het gebruik van koude PBS of PBS plus nocodazol wordt aanbevolen om mitotische slippen te vermijden (zie discussie sectie).
      2. Resuspende mitotische cellen verzameld uit elke 100 mm plaat in 10 ml volledig medium. Bespaar 2 ml voor RNA-extractie en 2 ml voor FACS-analyse voor het 0 h tijdspunt (ongeveer 0,2-0,25 x 10 6 cellen per monster).
      3. Herplaatst de resterende mitotische cellen voor de volgende tijdspunten in platen met 6 putjes (2 ml / putje, 0,2-0,25 x 10 6 cellen / putje).
        OPMERKING: Onthoud dat 2 putten nodig zijn per geselecteerd tijdspunt (1 voor RNA en 1 voor FACS analyse).
    8. Verzamel monsters op selGeëtiketteerde tijdspunten. Elke 1,5 tot 3 uur wordt aanbevolen om een ​​adequaat profiel van de celcyclusprogressie te verkrijgen.
      1. Voor RNA-extractie, verwijder medium, spoel goed af met 2 ml pre-warm 1x PBS en voeg 1 ml geschikt RNA-isolatiereagens ( bijv. TRIzol) in de put (voer deze laatste stap in een veiligheidskast voor chemicaliën). Pipet omhoog en omlaag om loslaten en lijscellen over te brengen, cellysaat over te brengen naar een 1,5 ml microcentrifugebuis, incubatie 5 minuten bij kamertemperatuur en bewaarbuis bij -80 ° C tot verder gebruik.
      2. Voor FACS analyse, spoel goed met 2 ml pre-warm 1x PBS, voeg de voorverwarmde Trypsin-EDTA oplossing (0,3 ml / putje) toe om de cellen los te maken, blokkeer Trypsin-EDTA door 1 ml volledig medium op te nemen en elk monster in een aparte 15 ml buis.
        1. Centrifuge cellen (300 xg, 5 min, RT), bespaar cellulair pellet en verwerp supernatant. Om cellen op te lossen, cellen opnieuw in 1 ml gekoelde 70% (v / v) ethanol in 1x PBS door zachtjes vortexerende buizen te plaatsen en op ijs voor app plaatsenOngeveer 15 minuten voor het opslaan bij 4 ° C of om te kleuren voor verdere analyse door FACS (beschreven in stappen 1.4 - 1.5).
  2. HU-gebaseerde synchronisatie en vrijgave van U2OS-cellen uit G1 / S-grens
    1. Bereid volledig celcultuurmedium op zoals beschreven in stap 1.1.
    2. Zaai 0,25 x 106 U2OS cellen per putje in 6 putjes platen (2 ml compleet kweekmedium per putje). Voor het berekenen van het aantal bronnen dat nodig is voor het experiment, moet u er rekening mee houden dat 2 putten nodig zijn per geselecteerd tijdspunt (1 goed voor RNA-extractie en 1 putje voor celcyclusmonitoring) en dat 2 additionele putjes van asynchroongroeiende cellen zijn Nodig om FACS analyse compensatie instellingen te definiëren.
    3. Laat cellen bevestigen door 6-putjes platen overnacht (O / N) bij 37 ° C in een bevochtigde atmosfeer met 5% CO 2 te incuberen.
    4. Verwijder het volledige medium uit de putjes de volgende ochtend en voeg 2 ml toeVan voorverwarmd FBS-vrij DMEM-Glutamine medium per putje. Incubeer cellen gedurende 24 uur bij 37 ° C in een bevochtigde atmosfeer met 5% CO2.
      OPMERKING: Voer deze stap uit in alle bronnen behalve 2 (die zijn opgeslagen om FACS-instellingen te definiëren). Serum-terugtrekkingsstap kan worden weggelaten als efficiënte synchronisatie wordt bereikt door simpelweg incubatie van cellen met HU.
    5. G1 / S celcyclus arrestatie met HU.
      1. Bereid verse HU voorraadoplossing (500 mM) voor elk gebruik. Voeg 2 ml H 2 O tot 76.06 mg HU poeder toe en meng tot het grondig opgelost is. Steriliseer de oplossing door filtratie door een 0,2 μm poriëngrootte filter. Meng 50 ml volledig medium met 400 μL filtersteriliseerde HU-voorraadoplossing voor een uiteindelijke HU-concentratie van 4 mM.
      2. Verwijder medium uit alle putjes, behalve van de 2 putjes die nodig zijn voor het bepalen van FACS-instellingen en vervang met een vers bereid 4 mM HU-compleet medium (2 ml / putje).
      3. Incubeer cellen gedurende 24 uur inHU-bevattend medium bij 37 ° C in een bevochtigde atmosfeer met 5% CO2.
    6. Vrijlating van cellen van HU-gemedieerde arrestatie. HU-bevattend medium verwijderen uit putjes en spoelt de putjes tweemaal met voorverwarmde 1x PBS (2 ml per keer). Voeg 2 ml volledig medium per put toe. Verzamel 2 monsters voor het 0 h tijdspunt (1 voor RNA-extractie en 1 voor celcyclus arrestatie verificatie door FACS), evenals 2 monsters opgeslagen voor FACS instellingen. Plaats resterende putjes in de incubator.
    7. Verzamel monsters elke 1,5 tot 3 uur om een ​​adequate verdeling van de celcyclusprogressie te verkrijgen. Op elk tijdstip uitvoeren monsterverwerking (voor RNA-extractie en voor FACS-analyse) zoals beschreven in 1.1.8.1-1.1.8.2.
  3. Behandeling met DNA beschadigende middelen
    OPMERKING: Wanneer het doel is om het effect van een verbinding (bijvoorbeeld DNA-schadelijke stoffen) in celcyclusgebeurtenissen te verklaren, kan elk van de eerder beschreven synchronisatiemethoden wordenGecombineerd met de behandeling van cellen met het genotoxische middel. Om de synchronisatiemethode te selecteren, is het belangrijk om de fase van de celcyclus te overwegen die we zouden willen analyseren. In het algemeen kan Thy-Noc-procedure geschikt zijn om het effect van een verbinding in G1-fase of S-fase-invoer te onderzoeken, terwijl HU-gemedieerde synchronisatie meer geschikt kan zijn om de impact in S tot G2 fases of in de toegang tot mitose te bestuderen.
    1. Analyse van het effect van genotoxische middelen in fase G1 of S fase
      1. Synchroniseer cellen zoals beschreven in 1.1.2. Naar 1.1.6.
      2. Laat cellen uit nocodazol los en plaats ze opnieuw zoals beschreven in 1.1.7. Incubeer hen bij 37 ° C in een bevochtigde atmosfeer met 5% CO2 gedurende 3 uur om ze te laten vallen voor het toevoegen van een middel (de benodigde incubatieperiode kan variëren afhankelijk van de cellijn).
      3. Voeg agent toe en verzamel monsters zoals eerder beschreven in 1.1.8.
    2. Analyse van het effect van genotoxische stoffen in SG2 fasen of M-ingang
      1. Synchroniseer cellen zoals beschreven in 1.2.2. Naar 1.2.5.
      2. Laat cellen uit HU vrij, zoals beschreven in 1.2.6. En voeg onmiddellijk een agent toe.
      3. Verzamel monsters zoals eerder beschreven in 1.8.
  4. Monitoring van celsynchronisatie en progressie door de celcyclus door propidiumjodide (PI) kleuring en FACS analyse
    OPMERKING: Monsters die op alle tijdstippen zijn verzameld, samen met die welke nodig zijn om FACS-instellingen te definiëren, kunnen bij 4 ° C worden opgeslagen nadat ze zijn vastgesteld (zoals vermeld in 1.1.8.2). Vervolg met PI-oplossing, gevolgd door FACS-analyse voor alle monsters van het experiment gelijktijdig. PI intercalateert in de hoofdgroef van dubbelstrengs DNA, dat een zeer fluorescerend signaal produceert wanneer het op 535 nm wordt opgewekt met een brede emissiepiek rond 600 nm. Aangezien PI ook kan binden aan dubbelstrengs RNA, is het nodig om de cellen te behandelen met RNase voor optimale DNA-resolutie.
    1. Bereid vers bereide PI-kleuring op. Een PI-voorraadoplossing kan worden bereid door PI-poeder in PBS op te lossen ( bijv. 5 mg / ml). Bewaar de voorraadoplossing bij 4 ° C (in het donker). Vlekoplossing bestaat uit PI (140 μM), natriumcitraat (38 mM) en Triton X-100 (0,01% v / v).
    2. Maak een geschikt oppervlak ( bijv. Oven) op tot 37 ° C.
    3. Centrifugeer vaste cellen (450 x g, 5 min, RT), dekante supernatant (ethanol) en wrijf eenmaal met 1x PBS.
    4. Centrifugeer cellen opnieuw, verwijder PBS en voeg 300 μL PI-kleurseloplossing per monster toe (behalve op een van de monsters voor FACS-instellingen, voeg PBS toe aan dit monster in plaats daarvan).
    5. Overdracht cellen naar FACS Tubes (5 ml ronde bodem polystyreen buizen).
    6. Voeg 1 μL RNase A toe aan elk monster, meng en incubeer de monsters gedurende 30 minuten in de duisternis bij 37 ° C. Monsters kunnen voor maximaal 2 tot 3 dagen beschermd worden tegen licht bij 4 ° C.
    7. Analyseer DNA-gehalte in de monsters door de stroomcytometrie. Definieer FACS analyse compensatie instellingen met PI-gekleurde asynchrone steekproef. Gebruik blanco monster (zonder PI-vlekoplossing) om te controleren op autofluorescentie. Basis van PI-kleuring gemedieerde analyse van DNA-inhoud door flowcytometrie is eerder beschreven 9 .
  5. Bepaling van de mitotische index door dubbel fosfo-H3 (Ser 10) / PI-kleuring
    OPMERKING: Cellen die mitose ondergaan kunnen gemakkelijk worden gedetecteerd door flowcytometrie met antilichamen die specifiek zijn voor fosforhiston H3 in serine 10 (pH3). Een gelijktijdige PI-kleuring is handig om vast te stellen op basis van DNA-inhoud op basis van de celpopulatie. Er zijn 5 monsters nodig voor de optimale configuraties van FACS-instellingen: blanco, alleen PI, alleen pH3, alleen secundaire antilichaam en dubbele kleuring.
    1. Centrifugeer vaste cellen (450 xg, 5 min, 4 ° C) en verwijder supernatant. De volgende stappen worden beschreven om vlekken in 15 ml buizen uit te voeren.
    2. Wascellen door 1 toe te voegenMl PBS-T (PBS + 0,05% Tween-20) aan de pellet en centrifuge (450 xg, 5 min, 4 ° C). Verwijder supernatant.
    3. Voeg anti-pH3 antilichaam verdund (1: 500) in 100-200 μL PBS-T + 3% BSA toe en incubeer met 2 uur schudden bij RT (of O / N bij 4 ° C).
    4. Voeg 2 ml PBS-T (PBS + 0,05% Tween-20) en centrifuge (450 xg, 5 min, 4 ° C) toe. Verwijder supernatant.
    5. Wassen nogmaals door 2 ml PBS-T aan de pellet toe te voegen, centrifugeer en weggooien supernatant.
    6. Voeg secundair antilichaam (anti-konijn AlexaFluor 488 toe in het geval van geselecteerd pH3-antilichaam) verdund (1: 500) in 100-200 μl PBS-T + 3% BSA en incubeer met 1 uur schudden bij RT (of O / N Bij 4 ° C). Bescherm monsters tegen licht.
    7. Was tweemaal met PBS-T (2 ml) door centrifugeren zoals beschreven in stap 1.5.4.
    8. Voer PI-kleuring uit zoals beschreven (stappen 1.4.1 tot 1.4.6).

2. Sample Collection en Processsing voor Gene Expression Analysis

  1. Nemen1,5 ml microcentrifuge monsters in het RNA isolatie reagens uit de vriezer en laten ze bij RT in een veiligheidskast voor chemicaliën ontdooien.
  2. Voeg 400 μl chloroform aan elk monster toe en schud krachtig (maar niet vortex) tot volledig mengen. Incubeer de monsters gedurende 5 minuten bij RT.
  3. Centrifugeerbuizen gedurende 15 minuten (≥8000 xg, 4 ° C) in een micro-centrifugebuisje.
  4. Breng de waterige (bovenste) fase over naar een nieuwe 1,5 ml microcentrifugebuis en registreer het overgebrachte volume (om de procedure te vereenvoudigen, wordt aanbevolen om gelijke volumes in alle monsters van het experiment te verzamelen).
  5. Voeg 1 volume 100% ethanol langzaam (druppel per druppel) toe aan de waterfase tijdens het mengen. Centrifugeer niet.
  6. Voer de volgende stappen uit met de commerciële RNA mini prep kit. Pipet tot 700 μL van elk monster, met inbegrip van eventuele neerslag dat kan hebben gevormd, in een spin kolom in een 2 ml collectibuis (verstrekt door de fabrikant).
  7. Sluit deDeksel en centrifuge (≥ 8000 g, RT) gedurende 15 s. Weggooi de doorstroom. Herhaal de vorige stap met het resterende monster (indien aanwezig).
  8. Volg de instructies van de fabrikanten voor RNA-wassen en elueren (eluteer elk monster in 30-40 μl nuclease-vrij H 2 O om een ​​geschikte RNA-concentratie voor de volgende stap te bereiken).
  9. Bepaal RNA-concentratie en zuiverheid van monsters door absorptiemetingen (een A 260/280 verhouding van 2,0-2,1 duidt op een goede zuiverheid van het RNA-monster). Bewaar RNA-monsters bij -80 ° C tot gebruik voor RT-qPCR analyse.
  10. Voor RNA conversie in cDNA en daaropvolgende kwantitatieve PCR, neem 1 μg RNA per monster en berei retrotranscriptase reactie volgens de instructies van de fabrikanten. De verkregen cDNA-monsters kunnen bij een temperatuur van 4 ° C (gedurende een paar dagen) of bij -20 ° C (gedurende langere tijd) worden opgeslagen.
    OPMERKING: Voorbeeldbereiding, primerontwerp en andere overwegingen voor real-time-PCR zijn exStevig beschreven in de literatuur 22 , 23 .

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Schematische weergave van Thy-Noc en HU-gebaseerde protocollen voor celsynchronisatie.

Figuur 1 geeft een samenvatting van de stappen die nodig zijn voor de U2OS-celsynchronisatie en de daaropvolgende monsterversameling om verificatie door de celcyclus te verifiëren en genuitdrukkingsanalyses uit te voeren.

Phospho-H3 en PI-kleuring zijn goede evaluatieparameters om synchronisatiemethoden te selecteren.

Cellsynchronisatieprocedures moeten worden beoordeeld en geoptimaliseerd voor elke cellijn als gevolg van inherente heterogeniteit van gekweekte cellen. Synchronisatie in mitose wordt typisch bereikt met Thy-Noc protocol, en verrijking van mitotische cellen na behandeling met nocodazol kan worden beoordeeld met antilichamen die specifiek zijn voor gefosforyleerde histon H3 (pH3), een typische mitotische marker. Ide Ntificatie van pH3 positieve cellen maakt het mogelijk om te discrimineren tussen mitotische cellen en die met een 4C-DNA-gehalte dat geen mitose ondergaat (alle worden beschouwd als een "G2" populatie door PI-kleuring). In U2OS-cellen leidde het Thy-Noc protocol een significante verrijking van een populatie met 4C DNA-gehalte (Figuur 2A, linksboven grafiek, blauwe populatie door PI-kleuring) en de relatieve fractie van mitotische cellen binnen deze populatie was routinematig vrij zuiver (ongeveer 91% vergeleken met 2% in asynchrone cellen). Het vrijkomen van nocodazol resulteert in een gesynchroniseerde progressie van cellen naar de volgende G1 fase, zoals bepaald door de accumulatie van een populatie met 2C DNA-gehalte ( Figuur 2A , rechtsboven, groene populatie door PI-kleuring) en de nabije verdwijning van pH3 positieve mitotische Cellen ( figuur 2A , rechtsonder). Zo bevestigden de pH3-kleurresultaten de geschiktheid van Thy-Noc-protocol voor mitotische synchronisatie van U2OS-cellen.

E_content "voor: keep-together.within-page =" 1 "> Synchronisatie van U2OS-cellen in G1 / S werd getest met thymidine en hydroxyurea, twee veelgebruikte synchronisatoren. Verrijking in verschillende fasen van de celcyclus werd bepaald door PI-kleuring en FACS analyse en percentage cellen samengevat in een tabel ( Figuur 2B ). Een 24 uur blootstelling van U2OS cellen aan Thy (2mM) was inefficiënt bij het arresteren van cellen in G1 / S grens ( Figuur 2B ), terwijl behandeling met HU of met een dubbele Ronde thymidine (DT) resulteerde in een bevredigende arrestering. Echter, alleen HU-behandelde cellen herstelden zich volledig uit arrestatie en werden adequaat door de celcyclus gevorderd. In tegenstelling hiermee induceerde DT-blok een permanente G1-arrestatie in een significante fractie van de celpopulatie 13,3% van de cellen in G1 op 6 uur tijdspunt met DT versus 3,1% met HU-protocol), waardoor de celsynchronie negatief beïnvloed is. Daarom wordt de blootstelling aan HU aanbevolen als een geschikte G1 / S synchronisatie methodeOd voor U2OS cellen.

Thy-Noc- en HU-gebaseerde protocollen zijn complementair voor celsynchronisatie.

Zoals getoond in Figuur 3A (0 uur tijdspunt), behandelde behandeling door Thy-Noc protocol de U2OS-cellen efficiënt in M-fase-ingang (populatie met 4C DNA-gehalte, getoond in blauw) en behandeling door HU-protocol gearresteerde cellen in G1 / S-grens (Populatie met 2C DNA-gehalte, weergegeven in groen / rood). Bij het verwijderen van de drugs, werden cellen op een gesynchroniseerde manier ingevoerd en door de celcyclus voortgezet. Cellen die worden hersteld van Thy-Noc-behandeling werden eerst in de vroege G1-fase (populatie in het groen) waargenomen en vervolgens op een uniforme wijze overgegaan door G1 en tot en met S-fase. Cellen die zijn hersteld van HU-behandeling, zijn synchroon door S (populatie in het rood) en G2 / M. Progressie door de volgende celcyclus was gelijktijdig met het verlies van synchroniciteit. ConsequentlY, tijdspunten van meer dan 15 uur werden niet in deze analyses opgenomen door het verlies van synchroniciteit na dit tijdstip.

Western blot analyse van Cyclin E1 (een G1 / S cycline) en Cyclin B1 (een G2 / M cyclin), twee eiwitten waarvan de niveaus stevig gereguleerd zijn in de celcyclus en van de mitotische marker pH3, bevestigde de celcyclusfase van elk Tijdpunt geanalyseerd door FACS ( Figuur 3B ). Zoals verwacht, bleken cellen in M ​​fase (overeenkomend met 0 uur tijdspunt van Thy-Noc-gesynchroniseerde cellen) en cellen in G2 tot M fase (9 uur tot 12 uur tijdspunt van HU-gesynchroniseerde cellen) een dramatische accumulatie van cyclin B1 En onopspoorbare niveaus van cycline E1. Bovendien waren de cyclin B1 niveaus laag om niet te detecteren in G1-fase (3 uur na vrijlating van nocodazol) en de geleidelijke accumulatie werd waargenomen als cellen door S (na Thy-Noc-vrijgave) en in G2 (na HU-vrijlating) werden gevorderd. Sterke pH3-labeling van cellen bij 0 uur op Thy-Noc synchronizatiOp bevestigde de verrijking van cellen die op dit punt bij mitose gearresteerd werden. Een lichte stijging van de pH3-niveaus na 12 uur na de release van HU bleek dat de meerderheid van de cellen met 4C DNA-gehalte nog steeds in G2 was, terwijl het aandeel van de cellen in mitose op 15 uur tijdspunt werd verhoogd. Daarentegen vertoonde het expressiepatroon van Cyclin E1 een progressieve accumulatie van vroege G1 tot S-fase entry (Thy-Noc procedure) en geleidelijke verdwijning in G2 / M fase (HU procedure).

Expressie van genen die differentieel gereguleerd zijn in de celcyclus kunnen nauwkeurig geanalyseerd worden met een combinatie van Thy-Noc- en HU-gebaseerde synchronisatie.

Als bewijs van het concept dat celcyclus-gereguleerde genexpressieanalyse het best wordt geanalyseerd door een combinatie van twee celsynchronisatiemethoden, heeft mRNA-expressie van twee E2F-familieleden bekend dat ze verschillende expressiekinetiek hebben in de celcyclus(E2F1 en E2F7) werden onderzocht door kwantitatieve PCR (RT-qPCR) van omgekeerde transcriptase. Daartoe werden Thy-Noc en HU synchronisatieprotocollen gebruikt, zoals samengevat in Figuur 1 , en celcyclusverdeling werd gecontroleerd door flowcytometrie zoals getoond in Figuur 3A . Figuur 4 toont E2F1 (bovenste twee grafieken) en E2F7 (onderste twee grafieken) mRNA profielen door de celcyclus. Het transcriptie-reguleringsprofiel van E2F1-coderende gen werd het best waargenomen met Thy-Noc-procedure, waarbij E2F1-expressie begon geleidelijk te verhogen van de vroege G1-fase om een ​​piek te bereiken in de late G1-fase (9 uur na de Thy-Noc-afgifte; groene achtergrond). De niveaus daalden daarna, in combinatie met een toegang tot S en G2 fasen (rode en blauwe achtergronden). Daarentegen werden de E2F7 gen expressie kinetica best gedetecteerd na HU-gebaseerde synchronisatie (lagere grafiek; rode achtergrond), met een piekuitdrukking om 6 uur vanaf de release (overeenkomend met S tot G2 fase overgang). Thy-NocProcedure was daarentegen geschikt om inductie van E2F7 in acht te nemen, maar niet de downregulatie daarvan. Opvallend, de uitbreiding van de analyse na 15 uur tijdspunt reproduceerde E2F1- en E2F7-expressieprofielen van vroegere tijdspunten, hoewel met een verminderd bereik van mRNA-variatie (data niet getoond). In totaal bevestigen deze resultaten het belang van het werken met een goed gesynchroniseerde celpopulatie om niet alleen de genexpressiekinetiek te beoordelen, maar ook de nauwkeurige amplitude van veranderingen in de mRNA-niveaus.

Cellsynchronisatie zorgt voor een beter begrip van het genuitdrukkingsprogramma dat wordt beïnvloed door anticancertherapie.

Om het effect van het antitumor drug mitomycine C (MMC) in celcyclusdynamiek evenals in de genexpressie te analyseren, werden de U2OS-cellen eerst gesynchroniseerd met HU en vervolgens behandeld met MMC. Blootstelling aan dit genotoxische middel activeerde een checkpoinT in G2 fase die bleek na 15 uur blootstelling ( Figuur 5A , onderste rij, blauwe piek). Daarentegen vorderen onbehandelde cellen normaal door G1 op dit tijdstip ( Figuur 5A , bovenste rij, groene piek). Langdurige MMC-behandeling (36 uur) onthulde een permanente arrestatie van cellen in G2-fase, terwijl cellen zonder MMC-behandeling een celcyclusverdeling vertoonden die vergelijkbaar was met die van de asynchrone celpopulatie.

E2F1 en p21 Cip1 (CDKN1A) werden gekozen voor genexpressieanalyse in MMC-behandelde cellen ( Figuur 5B ), gegeven hun verschillende celcyclusafhankelijke regulering. Expressie van E2F1 is G1-faseafhankelijk, zoals beschreven in Figuur 4 , terwijl inductie van p21- Cip1 - expressie gekoppeld is aan celcyclus arrestatie / controlepunt activatie 24 . Zoals getoond in Figuur 5B (bovenste linker grafiek), E2F1-genuitdrukking kiNetics waren vergelijkbaar in aanwezigheid of afwezigheid van MMC, aangezien cellen door G1 / S en in S-fase zijn voortgezet. Verschillen in E2F1-genuitdrukking onder MMC behandelde en onbehandelde cellen werden waargenomen na 15 uur blootstelling aan MMC, waarbij MMC-behandelde cellen lagere E2F1 mRNA-niveaus uitdrukken dan controlecellen ( Figuur 5B , vergelijk vaste en streeplijnen). Ondanks het duidelijke verschil in expressie kan echter niet worden geconcludeerd dat MMC E2F1 expressie vermindert, omdat celcyclusprofielen van MMC behandelde en onbehandelde cellen duidelijk verschillend zijn in deze latere tijdspunten, als gevolg van een langdurige G2 fase arrestatie die door MMC is opgelegd. In feite weerspiegelen de lage E2F1 mRNA niveaus na het 15 uur tijdstip in MMC-blootgestelde cellen een effect van het geneesmiddel in celcyclus dynamiek, in plaats van een effect van MMC bij E2F1 transcriptie regulatie.

In tegenstelling tot E2F1 is p21 Cip1 een MMC-responsief gen. Verhoogde niveaus van p21 Cip1 werden gedetecteerd bij HU- opgelegde G1 / S-arrestatie, die de G1-controlepuntactivering door HU aangeeft ( Figuur 5B , 0 uur tijdspunt) en zijn expressie daalde daarna in niet-MMC behandelde cellen, consistent met een ongeblokkeerde celcyclusprogressie na vrijlating van arresteren. Daarentegen leidde MMC-behandeling tot verhoogde p21- Cip1 mRNA-niveaus ( Figuur 5B , rechterbovenhoek , vaste lijn), terwijl cellen in G2-fase accumuleren (9 uur MMC-blootstelling). Ondanks het feit dat celcyclusprofielen op het 9 uur tijdspunt in controle en MMC behandelde cellen vergelijkbaar waren, toont de genuitdrukkingsanalyse een fundamenteel verschil. MMC-blootgestelde cellen vertoonden een geactiveerd G2-controlepunt, aangetoond door inductie van de expressie van p21 Cip1 , terwijl onbehandelde cellen een doorlopende overgang door G2 ondergaan, met lage p21 Cip1- niveaus.

Gegevens verkregen door flowcytometrie analyse ( FiGure 5A) en de gegevens die voortkomen uit RT-qPCR ( Figuur 5B , bovenste grafieken) werden gecombineerd in een enkele grafiek voor elk van de geselecteerde genen ( Figuur 4B , onderste grafieken). MRNA-expressieniveaus, waarbij de celcyclusverdeling van cellen voor elk monster werd geïllustreerd met het aantal kleuren: groen voor G1-fase (2C DNA-inhoud), blauw voor G2-fase (4C DNA-gehalte) en rood Voor S-fase (intermediair DNA-gehalte). Deze gecombineerde methode van grafische weergave kan nuttig zijn voor het interpreteren van celcyclusverdeling en genexpressieanalyses.

Samengevat liet de genexpressieanalyse gekoppeld aan een codynchronisatiemethode de identificatie van een genotoxisch middel-responsief gen (p21 Cip1 ) toe en leidde tot het voorstellen dat veranderingen waargenomen in E2F1 expressie tussen behandelde cellen en onbehandeld met het middel indirect waren enMogelijk gerelateerd aan verschillen in celcyclusverdeling van cellen.

Figuur 1
Figuur 1: Overzicht van twee complementaire celsynchronisatieprotocollen: Thymidine-Nocodazol en Hydroxyurea. ( A ) Grafische weergave van de zoogdiercellencyclus die de punten aangeeft bij welke celcyclusarray wordt bereikt door celsynchronisatiemethoden. Thy-Noc-gebaseerde procedure blokkeert cellen in vroege mitose (M) terwijl HU cellen blokkeert bij de G1 / S-grens. ( B ) Schematische weergave van Thy-Noc protocol van celsynchronisatie. Getoonde zijn de stappen die typisch worden gebruikt voor genexpressieanalyse en celcyclusmonitoring in U2OS-cellen. ( C ) Schematische weergave van HU-gebaseerd protocol van celsynchronisatie. Getoonde zijn de stappen die typisch worden gebruikt voor genexpressie analyse en celcyclusmonitoring in U2OS cellen. Een kortere synchronisatieprocedure die serumhongersing weglaat, kan ook worden toegepast als optimale synchronisatie al bereikt wordt door een 24 uur blootstelling aan HU. Klik hier om een ​​grotere versie van deze figuur te bekijken.

Figuur 2
Figuur 2: Beoordeling van geschikte synchronisatiemethoden. ( A ) Asynchrone en Thy-Noc gesynchroniseerde U2OS celculturen werden onderworpen aan pH3-kleuring om de fractie van mitotische cellen in elk geval te beoordelen. Gelijktijdige PI-kleuring liet het toezicht op het DNA-gehalte van cellen toe. In de asynchrone populatie waren slechts een minimale fractie cellen met 4C DNA-gehalte (in blauw) positief voor de mitosemarker. In tegenstelling hiermee, Thy-Noc protocol efficiënt accuGetuleerde cellen in mitose (positief voor de pH3-kleuring) en de juiste progressie in de volgende G1-fase (in groen) mogelijk bij verwijdering van nocodazol (3 uur tijdspunt). Percentage cellen in elke fase is samengevat in de tabel en gemarkeerd met kleuren volgens die welke in de PI histogrammen zijn gebruikt: groen voor 2C DNA-inhoudscellen (G1), blauw voor cellen met 4C DNA-gehalte (inclusief G2 en M-cellen en genoemd als G2 in de histogrammen om de figuur te vereenvoudigen en rood voor cellen met tussenliggende DNA-inhoud (S). ( B ) Thymidine en HU werden beoordeeld op hun celcyclussynchronisatie-efficiëntie in U2OS-cellen. Cellen werden behandeld met thymidine (een of twee Rondes), of bij HU gedurende 24 uur, en celsynchronisatie werd onderzocht door PI-kleuring en FACS-analyse. Summit werd gebruikt voor FACS-data analyse. Klik hier om een ​​grotere versie van deze figuur te zien.

Figuur 3
Figuur 3: Uitleggen van het temporale kader voor uniforme voortgang van cellen na Thy-Noc- en HU-gemedieerde synchronisatie. ( A ) U2OS cellen werden gesynchroniseerd in M ​​fase door Thy-Noc protocol (bovenste rij) of in G1 / S overgang door HU protocol (onderste rij). Celcyclusprogressie werd gecontroleerd door PI-kleuring en FACS-analyse van het DNA-gehalte van cellen om de 3 uur na de vrijlating van chemicaliën. Top werd gebruikt voor FACS data analyse. Cellen vrijgegeven van Thy-Noc-gemedieerde arrestatie zijn na 3 uur in de vroege G1-fase synchroon ingevoerd en gingen uniform naar S-fase op latere tijdstippen. Cellen die vrijkomen van HU-gemedieerde arrestatie zijn synchroon overgeschakeld door S en G2 fasen. Cellen verzamelden 15 uur na vrijlating de grenzen voor celsynchronisatie vertegenwoordigen, aangezien progressie tot volgende fase alleen werd bereiktD door een fractie van de bevolking. ( B ) Celsynchronisatie werd gecontroleerd door Western blot analyse door eiwitmonsters elke 3 uur en tot 15 uur na de vrijgave te verzamelen. Expressie-kinetiek van Cyclin E1 (CCNE1), een cycline die overwegend door de S-fase wordt geaccumuleerd, cyclin B1 (CCNB1), voornamelijk aanwezig van G2 tot M fase en pH3, een marker voor mitotische cellen, gecontroleerde celcyclusverdelingsprofielen waargenomen door flowcytometrie. Actin B (ACTB) werd gebruikt als endogene belastingcontrole omdat de niveaus ervan niet afhankelijk zijn van celcyclus. (Zoals gemodificeerd uit Mitxelena et al ., 8 ). Klik hier om een ​​grotere versie van deze figuur te bekijken.

Figuur 4
Figuur 4: Studie van de celcyclus fase-afhankelijke T Transcriptie van E2F-familieleden door middel van complementaire celsynchronisatiemethoden. U2OS cellen werden gearresteerd in G2 / M door Thy-Noc protocol of in G1 / S door HU behandeling, en monsters werden verzameld voor RNA-extractie en FACS analyse elke 3 uur tot 15 uur bij vrijlating van arrestatie. Gene-expressie-analyse door RT-qPCR onthulde een E2F1 expressieprofiel dat hoofdzakelijk aan G1 (bovenste linker grafiek) werd omschreven, terwijl E2F7 genexpressieprofiel werd verplaatst naar S-fase, met een geleidelijke downregulatie via G2-fase (onderste rechtergrafiek). TBP werd gebruikt als endogeen niet-cel cyclus gereguleerd gen om relatieve veranderingen in mRNA niveaus te berekenen en resultaten werden weergegeven als de gemiddelde waarden en standaardafwijking (SD). Progressie door celcyclus werd bepaald door PI-kleuring en FACS-analyse van het DNA-gehalte van cellen. Celcyclusfases werden weergegeven als achtergrondkleuren in grafieken: zwart (arrestatie bij vroege mitose), groen (G1 fase), rood (S fase) en blauw (G2 fase)..com / files / ftp_upload / 55745 / 55745fig4large.jpg "target =" _ blank "> Klik hier om een ​​grotere versie van deze figuur te bekijken.

Figuur 5
Figuur 5: Impact van MMC op genuitdrukking en celcyclusprogressie. U2OS-cellen werden 24 uur behandeld met HU en MMC (250 nM) werd onmiddellijk na het vrijkomen van HU-gemedieerde G1 / S-arrestatie toegevoegd. Monsters voor FACS analyse en genexpressie analyse werden verzameld op aangegeven tijdspunten. ( A ) Progressie door de celcyclus werd bepaald door PI-kleuring en FACS-analyse van DNA-inhoud door Summit software. MMC veroorzaakte een matige vertraging in de progressie door middel van S-fase (rode populatie) en een permanente arrestatie in G2-fase (blauwe populatie), zoals blijkt uit de afwezigheid van cellen in G1 (groene populatie) na 15 uur behandeling Naar niet-Behandelde (bovenste rij) cellen. ( B ) E2F1 en p21 Cip1 -genexpressieanalyse in MMC behandelde of onbehandelde cellen werd uitgevoerd op het mRNA-niveau door RT-qPCR. Oxa1L werd gebruikt als een endogeen niet-MMC-responsief gen en de resultaten werden weergegeven als gemiddelde waarden en SD. Bovenste grafieken vertegenwoordigen relatieve mRNA niveaus van geselecteerde genen na vrijlating van HU en toevoeging van MMC. Lager grafieken combineren gegevens verkregen door FACS analyse en RT-qPCR. Klik hier om een ​​grotere versie van deze figuur te bekijken.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Analyse van fine-tuned gereguleerde genen die betrokken zijn bij transiënte en specifieke rollen in de celcyclus vereist een uniforme celpopulatie. Veel onderzoekers gebruiken hiervoor langdurige tumorcellijnen voor deze doeleinden, en een verscheidenheid aan methoden zijn ontwikkeld om synchrone (of gedeeltelijk synchrone) celpopulaties te verkrijgen, met het doel om zoveel mogelijk cellen op te bouwen in gedefinieerde celcyclusfasen. Bovendien zijn er veel inspanningen geleverd om de gevestigde synchronisatiebenaderingen te verbeteren en te optimaliseren. Niettemin hebben alle synchronisatieprotocollen nadeel, die kan worden toegeschreven aan heterogeniteit van celculturen, tot suboptimale efficiëntie van de synchronisatieprocedures, of tot secundaire effecten die chemische synchronisatoren onder andere in celfunctie hebben. Deze beperkingen moeten in aanmerking worden genomen bij het toepassen van celsynchronisatieprotocollen. Onderzoekers moeten de meest geschikte synchronisatiemethoden voor hun specifiek identificerenIc cel type of experiment. Zelfs op dezelfde manier cultiveren van verschillende cellijnen, kunnen de verschillende synchronisatiepercentages vanwege verschillende redenen verschillen. Aan de ene kant kan de lengte van de celcyclus variëren afhankelijk van de geselecteerde cellijn; Aan de andere kant kan dezelfde inhibitor contrasterende effecten hebben op verschillende cellijnen als gevolg van specifieke kenmerken van elke cellijn 25 . Bovendien moet de geselecteerde inhibitorconcentratie en blootstellingstijd altijd aan elke cellijn worden aangepast om ongewenste sidetoxiciteit te voorkomen of te minimaliseren 26 . Zelfs na optimalisatie van al deze aspecten, wordt 100% accumulatie van cellen in een gegeven celcyclusfase nooit bereikt, en asynchronie neemt geleidelijk toe na verwijdering van de chemische stof 27 . Zo is het belangrijk om te begrijpen dat synchronisatiemethoden in een bepaald tijdsbestek op zijn best de gedeeltelijke celpopulatie verrijking verkrijgen.

In deze w Ork twee synchronisatieprocedures (Thy-Noc en HU) zijn geoptimaliseerd voor hun gebruik in U2OS-cellen, die beide extensief worden gebruikt voor celsynchronisatiebepalingen 28 , 29 , 30 . Voor het arresteren van cellen in M-fase werkte een combinatie van thymidine en nocodazol efficiënt in U2OS-cellen. Gezien de cytotoxische aard van nocodazol, was het belangrijk de blootstellingsduur en de dosis van deze remmer te bepalen om niet alleen een zeer gesynchroniseerde celpopulatie te verkrijgen maar ook de optimale celoverleving. Voorafgaande blootstelling aan thymidine (of theoretisch elke andere soortgelijke verbinding zoals hydroxyureum) leidde tot een verrijking van de celpopulatie in G1- en S-fasen, waardoor de vereiste nocodazol-belichtingstijd werd afgenomen. Voor het arresteren van cellen in G1 / S werden verschillende mogelijkheden overwogen, waaronder dubbel thymidine blok, een werkwijze die zeer efficiënt is bij synchronisatie van meerdere cellijnen"> 31 , 32. Thymidine werd echter weggegooid gezien zijn teleurstellende resultaten in U2OS. Eén ronde thymidine behandeling heeft slechts een fractie van cellen gearresteerd, terwijl twee ronden thymidinebehandeling de meeste cellen in G1 / S efficiënt blokkeerde, maar een G1 Populatie werd gehandhaafd na vrijlating van thymidine en celscyclusprogressie ging niet gelijkmatig voort. In tegenstelling tot de behandeling van hydroxyurea leverde goede G1 / S blokkerende resultaten en uniforme progressie van cellen door S en in G2.

Celcircuitfaseverdeling moet worden onderzocht bij het uitvoeren van celsynchronisatie-experimenten (bijvoorbeeld door propidiumjodide-kleuring of pH3-etikettering gevolgd door FACS-analyse, of door immunoblotting van celcyclusfasespecifieke eiwitten) 16 , 33 , 34 , om de expressie van de gene te verbeteren resultaten. Een onjuiste synchronisatie-efficiëntieNcy of lichte inter-experimentele verschillen in de progressie door de celcyclus kunnen leiden tot verkeerde conclusies. Zo is bekend dat nocodazolbehandeling onder bepaalde omstandigheden mislukking van de mitotische controlepuntfunctie veroorzaakt. Dit leidt tot een populatie cellen met 4C DNA-gehalte, maar negatief voor mitotische markers 34 die mitotische deling "slipt" en terugkeren naar interfase met een 4C-inhoud 35 . De opkomst van deze subset cellen, die kan worden gedetecteerd door immunostaining met anti-fosfo-H3-antilichamen (zie Figuur 2A ) kan worden geminimaliseerd door het gebruik van koude PBS voor de nocodazol-wassen stappen. Een ander effect geassocieerd met het gebruik van chemische remmers die celsynchronisatie beïnvloedt, is de controle van de controle bij de blootstelling aan deze verbindingen 36 , 37 , een mechanisme waardoor de cel progressief door de celcyclus wordt aangehouden tot het kanZorg ervoor dat processen die eerder zijn dan dat precieze punt (bijv. Correcte DNA replicatie, spindel assemblage) worden opgelost 38 . Om een ​​synchronisatiemethode adequaat te zijn, moet de arrestatie niet alleen efficiënt zijn maar ook volledig omkeerbaar zijn. Zo is het na het loslaten van celcyclusremmers belangrijk om te analyseren of de effecten van de remmer zijn teruggezet, bijvoorbeeld door de expressie van controlepuntmarkers te analyseren, zoals p21 CIP . Figuur 5B laat zien dat hydroxyurea-gesynchroniseerde U2OS-cellen het controlepunt efficiënt oplossen, omdat p21- CIP- niveaus werden verminderd tot basale expressie na vrijlating.

In U2OS-cellen vallen de verrijking percentages bij celcyclusarrest binnen het bereik dat is gerapporteerd door andere studies op celsynchronisatie 29 , 30 , 39 : ongeveer 85% van cellen met 4C DNA-gehalte (PI-kleuring) en ongeveerMatig 90% van die in mitose (pH3 positieve etikettering) bij behandeling met thymidine-nocodazol en ongeveer 80-90% van G1 / S cellen na hydroxyurea behandeling. Vrijlating van celcyclus arrestatie voert typisch een goede progressie door de volgende één of twee fasen op een uniforme wijze, hoewel de synchronisatie na enkele uren onvermijdelijk wordt verloren en cellen niet in staat zijn op een gesynchroniseerde manier een hele celverdelingscyclus te voltooien. Om zo een volledig beeld te krijgen van alle fasen van de celcyclus, gebruikt het protocol in dit werk twee synchronisatiemethoden uit verschillende delen van de celcyclus. Zoals getoond in Figuur 3A , verzekerde elk afzonderlijk protocol geen synchroniciteit gedurende een hele celcyclus. Thy-Noc-gebaseerde synchronisatie verschafte een geschikt kader voor processen die zich voordoen in G1 tot S fasen, terwijl cellen die uit HU waren vrijgegeven geschikt waren voor de analyse van gebeurtenissen die plaatsvinden tijdens S en G2 / M. De complementariteiten van de geselecteerde twee procedureEs werden aangetoond door de analyse van twee leden van de E2F transcriptiefactorfamilie ( Figuur 4 ), waarbij het idee wordt ondersteund dat combinatie van twee methoden die in verschillende fasen van de celcyclus synchroniseren, een krachtige aanpak is om nauwkeurig celcyclus gereguleerde genexpressie te bepalen Patronen en hun fysiologische rol beter te begrijpen.

Een dwingende toepassing van celsynchronisatieprocedures richt zich op het evalueren van de impact van potentiële therapeutische middelen. Het effect van farmaceutische verbindingen, zoals die met antitumoractiviteit, wordt vaak bestudeerd in asynchrone celpopulaties. Onder deze instellingen is het mogelijk om de implicaties van het geselecteerde geneesmiddel te bepalen bij de inductie van verschillende processen, zoals celdood, celcyclus arrestatie of senescentie 7 , 40 . Echter, selectie van asynchrone celinstellingen voor identificatie van precieze moleculaire gebeurtenissen die regelenDergelijke processen kunnen leiden tot onvolledige of gedeeltelijk verkeerde conclusies. Dit punt, dat vaak wordt over het hoofd gezien, is geïllustreerd in het huidige werk door het effect van het chemotherapeutische geneesmiddel MMC op E2F1 en p21 Cip1 -genuitdrukking te analyseren ( Figuur 5 ). In het algemeen verschaft de combinatie van celsynchronisatie en behandeling met genotoxische middelen een geschikte context om de expressie van genen die responsief zijn op het genotoxische middel te bestuderen en te onderscheiden van die welke zijn getroffen door celcyclusverstoringen die door de agent zijn opgelegd.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs hebben niets te onthullen.

Acknowledgments

Wij danken de leden van de Zubiaga en de Altmeyer laboratoria voor hulpvaardige discussies en voor technische ondersteuning. Dit werk werd ondersteund door subsidies van het Spaanse ministerie (SAF2015-67562-R, MINECO / FEDER, UE), de Baskische regering (IT634-13 en KK-2015/89) en de Universiteit van Baskenland UPV / EHU UFI11 / 20).

Materials

Name Company Catalog Number Comments
DMEM, high glucose, GutaMAX supplement Thermo Fisher Scientific 61965-059
FBS, qualified, E.U.-approved, South America origin Thermo Fisher Scientific 10270-106
Penicillin-Streptomycin (10,000 U/mL) Thermo Fisher Scientific 15140-122
0.25% Trypsin-EDTA (1x), phenol red Thermo Fisher Scientific 25200-072
Thymidine SIGMA T1895-5G Freshly prepared. Slight warming might help dissolve thymidine.
Nocodazole SIGMA M-1404 Stock solution in DMSO stored at -20 ºC in small aliquots
Hydroxyurea SIGMA H8627 Freshly prepared
Mitomycin C from Streptomyces caespitosus SIGMA M4287 1.5 mM stock solution in sterile H2O protected from light and stored at 4 ºC
Dimethyl sulfoxide SIGMA D2650
Propidium iodide SIGMA P4170 Stock solution in sterile PBS at 5 mg/ml, stored at 4 º C protected from light.
PBS pH 7.6 Home made
Ethanol PANREAC A3678,2500
Chloroform SIGMA C2432
Sodium Citrate PANREAC 131655
Triton X-100 SIGMA T8787
RNAse A Thermo Fisher Scientific EN0531
TRIzol Reagent LifeTechnologies 15596018
RNeasy Mini kit QIAGEN 74106
High-Capacity cDNA Reverse Transcription Kit Thermo Fisher Scientific 4368814
Anti-Cyclin E1 antibody Cell Signaling 4129 1:1000 dilution in 5% milk, o/n, 4 ºC
Anti-Cyclin B1 antibody Cell Signaling 4135 1:1000 dilution in 5% milk, o/n, 4 ºC
Anti-β-actin SIGMA A-5441 1:3000 dilution in 5 % milk, 1 hr, RT
Anti-pH3 (Ser 10) antiboty Millipore 06-570 Specified in the protocol
Secondary anti-rabbit AlexaFluor 488 antibody Invitrogen R37116 Specified in the protocol
Secondary anti-mouse-HRP antibody Santa Cruz Biotechnology sc-3697 1:3000 dilution in 5 % milk, 1 hr, RT
Forward E2F1 antibody (human)                    TGACATCACCAACGTCCTTGA Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse E2F1 antibody (human)                    CTGTGCGAGGTCCTGGGTC Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward E2F7 antibody (human)                    GGAAAGGCAACAGCAAACTCT Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse E2F7 antibody (human)                    TGGGAGAGCACCAAGAGTAGAAGA Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward p21Cip1 antibody (human)                    AGCAGAGGAAGACCATGTGGAC Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse p21Cip1 antibody (human)                    TTTCGACCCTGAGAGTCTCCAG Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward TBP antibody (human) reference gene                     Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse TBP antibody (human)                     Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward Oxa1L antibody (human) reference gene   CACTTGCCAGAGATCCAGAAG                  Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse Oxa1L  antibody (human)    CACAGGGAGAATGAGAGGTTTATAG                 Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Power SYBRGreen PCR Master Mix Thermo Fisher Scientific 4368702
FACS Tubes  Sarstedt 551578
MicroAmp Optical 96-Well Reaction Plate Thermo Fisher Scientific N8010560
Corning 100 mm TC-Treated Culture Dish Corning
Corning Costar cell culture plates 6 well Corning 3506
Refrigerated Bench-Top Microcentrifuge Eppendorf 5415 R
Refrigerated Bench-Top Centrifuge Jouan CR3.12 Jouan 743205604
NanoDrop Lite Spectrophotometer Thermo Scientific ND-LITE-PR
BD FACSCalibur Flow Cytometer BD Bioscience
QuantStudio 3 Real-Time PCR System Thermo Fisher Scientific A28567

DOWNLOAD MATERIALS LIST

References

  1. Beato, M., Sánchez-Aguilera, A., Piris, M. A. Cell cycle deregulation in B-cell lymphomas. Blood. 101, (4), 1220-1235 (2003).
  2. Chen, H. Z., Tsai, S. Y., Leone, G. Emerging roles of E2Fs in cancer: an exit from cell cycle control. Nat Rev Cancer. 9, (11), 785-797 (2009).
  3. Cho, R. J., et al. Transcriptional regulation and function during the human cell cycle. Nat Genet. 27, (1), 48-54 (2001).
  4. Peña-Diaz, J., et al. Transcription profiling during the cell cycle shows that a subset of Polycomb-targeted genes is upregulated during DNA replication. Nucleic Acids Res. 41, (5), 2846-2856 (2013).
  5. Grant, G. D., et al. Identification of cell cycle-regulated genes periodically expressed in U2OS cells and their regulation by FOXM1 and E2F transcription factors. Mol Biol Cell. 24, (23), 3634-3650 (2013).
  6. Minderman, H., et al. In vitro and in vivo irinotecan-induced changes in expression profiles of cell cycle and apoptosis-associated genes in acute myeloid leukemia cells. Mol Cancer Ther. 4, (6), 885-900 (2005).
  7. McKenna, E., Traganos, F., Zhao, H., Darzynkiewicz, Z. Persistent DNA damage caused by low levels of mitomycin C induces irreversible cell senescence. Cell Cycle. 11, (16), 3132-3140 (2012).
  8. Infante, A., et al. E2F2 represses cell cycle regulators to maintain quiescence. Cell Cycle. 7, (24), 3915-3927 (2008).
  9. Cecchini, M. J., Amiri, M., Dick, F. A. Analysis of cell cycle position in mammalian cells. J Vis Exp. (59), (2012).
  10. Schorl, C., Sedivy, J. M. Analysis of cell cycle phases and progression in cultured mammalian cells. Methods. 41, (2), 143-150 (2007).
  11. Lalande, M. A reversible arrest point in the late G1 phase of the mammalian cell cycle. Exp Cell Res. 186, (2), 332-339 (1990).
  12. Park, S. Y., et al. Mimosine arrests the cell cycle prior to the onset of DNA replication by preventing the binding of human Ctf4/And-1 to chromatin via Hif-1α activation in HeLa cells. Cell Cycle. 11, (4), 761-766 (2012).
  13. Ikegami, S., et al. Aphidicolin prevents mitotic cell division by interfering with the activity of DNA polymerase-alpha. Nature. 275, (5679), 458-460 (1978).
  14. Baranovskiy, A. G., et al. Structural basis for inhibition of DNA replication by aphidicolin. Nucleic Acids Res. 42, (22), 14013-14021 (2014).
  15. Adams, R. L., Lindsay, J. G. Hydroxyurea reversal of inhibition and use as a cell-synchronizing agent. J Biol Chem. 242, (6), 1314-1317 (1967).
  16. Mitxelena, J., Apraiz, A., Vallejo-Rodríguez, J., Malumbres, M., Zubiaga, A. M. E2F7 regulates transcription and maturation of multiple microRNAs to restrain cell proliferation. Nucleic Acids Res. (2016).
  17. Bootsma, D., Budke, L., Vos, O. Studies on synchronous division of tissue culture cells initiated by excess thymidinE. Exp Cell Res. 33, 301-309 (1964).
  18. Galgano, P. J., Schildkraut, C. L. G1/S Phase Synchronization using Double Thymidine Synchronization. CSH Protoc. (2), (2006).
  19. Edwin Taylor, W. Kinetics of inhibition and the binding of h3-colchicine. J Cell Biol. 25, 145-160 (1965).
  20. Zieve, G. W., Turnbull, D., Mullins, J. M., McIntosh, J. R. Production of large numbers of mitotic mammalian cells by use of the reversible microtubule inhibitor nocodazole. Nocodazole accumulated mitotic cells. Exp Cell Res. 126, (2), 397-405 (1980).
  21. Matsui, Y., Nakayama, Y., Okamoto, M., Fukumoto, Y., Yamaguchi, N. Enrichment of cell populations in metaphase, anaphase, and telophase by synchronization using nocodazole and blebbistatin: a novel method suitable for examining dynamic changes in proteins during mitotic progression. Eur J Cell Biol. 91, (5), 413-419 (2012).
  22. Nolan, T., Hands, R. E., Bustin, S. A. Quantification of mRNA using real-time RT-PCR. Nat Protoc. 1, (3), 1559-1582 (2006).
  23. Thornton, B., Basu, C. Real-time PCR (qPCR) primer design using free online software. Biochem Mol Biol Educ. 39, (2), 145-154 (2011).
  24. Abbas, T., Dutta, A. p21 in cancer: intricate networks and multiple activities. Nat Rev Cancer. 9, (6), 400-414 (2009).
  25. Kung, A. L., Sherwood, S. W., Schimke, R. T. Cell line-specific differences in the control of cell cycle progression in the absence of mitosis. Proc Natl Acad Sci U S A. 87, (24), 9553-9557 (1990).
  26. Borel, F., Lacroix, F. B., Margolis, R. L. Prolonged arrest of mammalian cells at the G1/S boundary results in permanent S phase stasis. J Cell Sci. 115 (Pt. 14, 2829-2838 (2002).
  27. Knehr, M., et al. A critical appraisal of synchronization methods applied to achieve maximal enrichment of HeLa cells in specific cell cycle phases). Exp Cell Res. 217, (2), 546-553 (1995).
  28. Zhu, W., Giangrande, P. H., Nevins, J. R. E2Fs link the control of G1/S and G2/M transcription. EMBO J. 23, (23), 4615-4626 (2004).
  29. Whitcomb, E. A., Dudek, E. J., Liu, Q., Taylor, A. Novel control of S phase of the cell cycle by ubiquitin-conjugating enzyme H7. Mol Biol Cell. 20, (1), 1-9 (2009).
  30. Bruinsma, W., Macurek, L., Freire, R., Lindqvist, A., Medema, R. H. Bora and Aurora-A continue to activate Plk1 in mitosis. J Cell Sci. 127, 801-811 (2014).
  31. Thomas, D. B., Lingwood, C. A. A model of cell cycle control: effects of thymidine on synchronous cell cultures. Cell. 5, (1), 37-42 (1975).
  32. Whitfield, M. L., et al. Identification of genes periodically expressed in the human cell cycle and their expression in tumors. Mol Biol Cell. 13, (6), 1977-2000 (2002).
  33. Lim, S., Cdks Kaldis, P. cyclins and CKIs: roles beyond cell cycle regulation. Development. 140, (15), 3079-3093 (2013).
  34. Tapia, C., et al. Two mitosis-specific antibodies, MPM-2 and phospho-histone H3 (Ser28), allow rapid and precise determination of mitotic activity. Am J Surg Pathol. 30, (1), 83-89 (2006).
  35. Andreassen, P. R., Martineau, S. N., Margolis, R. L. Chemical induction of mitotic checkpoint override in mammalian cells results in aneuploidy following a transient tetraploid state. Mutat Res. 372, (2), 181-194 (1996).
  36. Wei, F., Xie, Y., He, L., Tao, L., Tang, D. ERK1 and ERK2 kinases activate hydroxyurea-induced S-phase checkpoint in MCF7 cells by mediating ATR activation. Cell Signal. 23, (1), 259-268 (2011).
  37. Kubota, S., et al. Activation of the prereplication complex is blocked by mimosine through reactive oxygen species-activated ataxia telangiectasia mutated (ATM) protein without DNA damage. J Biol Chem. 289, (9), 5730-5746 (2014).
  38. Hartwell, L. H., Weinert, T. A. Checkpoints: controls that ensure the order of cell cycle events. Science. 246, (4930), 629-634 (1989).
  39. St-Denis, N. A., Derksen, D. R., Litchfield, D. W. Evidence for regulation of mitotic progression through temporal phosphorylation and dephosphorylation of CK2alpha. Mol Cell Biol. 29, (8), 2068-2081 (2009).
  40. Min, A., et al. RAD51C-deficient cancer cells are highly sensitive to the PARP inhibitor olaparib. Mol Cancer Ther. 12, (6), 865-877 (2013).
Het bestuderen van celcyclusreguleerde genuitdrukking door twee complementaire celsynchronisatieprotocollen
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Apraiz, A., Mitxelena, J., Zubiaga, A. Studying Cell Cycle-regulated Gene Expression by Two Complementary Cell Synchronization Protocols. J. Vis. Exp. (124), e55745, doi:10.3791/55745 (2017).More

Apraiz, A., Mitxelena, J., Zubiaga, A. Studying Cell Cycle-regulated Gene Expression by Two Complementary Cell Synchronization Protocols. J. Vis. Exp. (124), e55745, doi:10.3791/55745 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter