Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

3' Ende Sequenzierung Bibliothek Vorbereitung mit A-seq2

doi: 10.3791/56129 Published: October 10, 2017

Summary

Dieses Protokoll beschreibt eine Methode für die Zuordnung Pre-mRNA 3' End-Verarbeitung Websites.

Abstract

Studien in den letzten zehn Jahren haben eine komplexe und dynamische Vielzahl von Pre-mRNA Spaltung und Polyadenylation Reaktionen gezeigt. mRNAs mit langen 3' unübersetzt Regionen (wo) sind in den differenzierten Zellen generiert, während proliferierende Zellen Protokolle mit kurzen 3' wo bevorzugt zum Ausdruck bringen. Wir beschreiben das A-Seq-Protokoll, jetzt in seiner zweiten Version, entwickelte Polyadenylation Websites genomweite abzubilden und die Regulierung der Pre-mRNA 3' End-Verarbeitung zu studieren. Auch nutzt das aktuelle Protokoll die Polyadenylate (poly(A)) Schwänzen, die während der Biogenese der meisten Säugetiere mRNAs für fully-processed mRNAs bereichern hinzugefügt werden. Ein DNA-Adapter mit Deoxyuracil an der vierten Position ermöglicht die präzise Bearbeitung von mRNA 3' Ende Fragmente für die Sequenzierung. Nicht einschließlich der Zellkultur und die Übernachtung grundsätzlich das Protokoll erfordert ca. 8 h Arbeitsaufwand beträgt. Zusammen mit ihm ist eine einfach zu bedienende Software-Paket für die Analyse der Sequenzierungsdaten abgeleiteten zur Verfügung gestellt. A-seq2 und der damit verbundenen Analyse-Software bieten eine effiziente und zuverlässige Lösung für die Zuordnung der Pre-mRNA 3' endet in einer Vielzahl von Bedingungen von 106 oder weniger Zellen.

Introduction

Die Erfassung und die Abfolge der mRNA 3' Enden ermöglicht die Untersuchung von mRNA-Verarbeitung und die Quantifizierung der Genexpression. Durch ihren Schwänzen poly(A) können eukaryontischen mRNAs effizient gereinigt werden vom gesamten Zelle Lysates mit Wulst immobilisiert Oligo-Deoxythymidine (oligo(dT))-Moleküle, die auch cDNA Synthese prime kann. Dieser Ansatz hat jedoch zwei Nachteile. Erstens können Strecken von A, die intern für Abschriften sind auch cDNA-Synthese, wodurch falsche poly(A) Websites prime. Zweite, homogene poly(A) Strecken stellen besondere Herausforderungen für die Sequenzierung, abgesehen davon, dass nicht informativ für Abschrift Identifikation. Verschiedene Ansätze wurden vorgeschlagen, diese Einschränkungen, z. B. reverse Transkription durch poly(A) umgehen Schwänzen gefolgt von RNase H Verdauung (3P-Seq 1), verwenden Sie eine benutzerdefinierte Sequenzierung Grundierung endet in 20 Ts (2P-Seq 2), Vorauswahl der RNA-Fragmente mit poly(A) Schwänzen von mehr als 50 Nukleotiden Primer eine CU5T45 gefolgt von RNase H Verdauung (3' liest 3) und die Verwendung von Oligo-dT Grundierung, die den 3'-Adapter in einer Haarnadelkurve (A-Seq 4) enthält.

Die neu entwickelte A-seq2 Methode 5 umgehen Sequenzierung durch poly(A) und gleichzeitig den Anteil der Dimere zu minimieren, die durch selbständige Ligatur der Adapter, besonders auftreten erzeugt werden soll wenn die molare Konzentration der Adapter überwiegt die einfügen-Konzentration. Dieses Problem kann beseitigt werden, wenn beide Adapter auf die gleiche Art von Polynukleotid enden wie in A-seq2 ligiert sind wo die 3'-Adapter, 5'-Ende der RNA-Fragmente und die Adapter 5', 5' Ende der cDNAs nach reversen Transkription ligiert werden. Die Methode ist bequemer als unsere zuvor vorgeschlagene A-Seq - in der Sequenzierung in den 5'-bis-3 wurde ' Richtung damit erfordern präzise gesteuert RNA Fragmentierung-, unter Beibehaltung einer hohen Genauigkeit der Poly-Website-Identifikation. Rund 80 % der sequenzierten lautet in typische Proben des Genoms eindeutig zuordnen und zur Identifizierung von mehr als 20.000 poly(A) Website Clustern, mehr als 70 % der welche Überschneidungen mit kommentierten 3' wo führen.

In Kürze beginnt die A-seq2 Protokoll mit mRNA Fragmentierung und Ligatur der Reverse-Ergänzung 3' Adapter an den 5'-Enden der RNA-Fragmente. Poly (A)-enthaltenden RNAs sind dann umgekehrte transkribiert mit 25 Nukleotide (nt) lang oligo(dT) Grundierung, die einen Anker Nukleotid am 3'-Ende, ein dU an Position 4 und Biotin am 5'-Ende, enthält so dass Bindung der cDNA, magnetische Streptavidin Perlen. Die meisten des Primers, einschließlich Biotin, ist aus der cDNA durch Spaltung an dU durch den Benutzer-Enzym-Mix enthält Uracil DNA Glycosylase (UDG) und der DNA-Glycosylase-Lyase Endonuklease VIII entfernt. Diese Reaktion lässt intakt endet für die Unterbindung der 5'-Adapter und drei Ts links nach Spaltung bleiben um markieren den Standort der Poly-Schwanz. Da 5' und 3'-Adapter durch Unterbindung an Empfänger 5' Enden verbunden sind, sind keine Adapter-Dimere generiert. Vier Nukleotid zufällige-Mers eingeführt Anfang liest ermöglicht Cluster Auflösung auf State-of-the-Art-Sequenzierung Instrumenten und kann auch als einzigartige molekulare Bezeichner (UMI) für die Erkennung und Entfernung von PCR-Amplifikation Artefakten dienen. Die Größe der UMI kann weiter erhöht werden, wie in anderen Studien 6getan. Das Protokoll liest, die Komplementäre mRNA 3' enden, alles beginnt mit einer randomisierten Tetramer, gefolgt von 3 Ts. Verarbeitung der Lesevorgänge, die 3 diagnostische Ts an ihre 5' Ende beginnt mit der Korrektur der PCR-Amplifikation Artefakte durch umkehren werden generiert UMIs, Entfernung von 3' Adapter Sequenzen, Ausnutzung und reverse-Ergänzung. Lesevorgänge, die aus oligo(dT) Grundierung an interne A-reiche Standorten entstanden sein können sind auch rechnerisch ermittelt und verworfen. Die unechten Websites in der Regel fehlt eines der 18 gut charakterisierten und konservierten poly(A) Signale die sollte befindet sich ~ 21 Nukleotide stromaufwärts der scheinbare Spaltung Seite 7.

Das Protokoll erfordert ca. 8 h Handhabungszeit Zellkultur und die Übernachtung grundsätzlich nicht zu zählen. Die damit verbundene lesen Analyse-Software ermöglicht eine hochpräzise poly(A) Website Identifikation. Von der Poly-Website erstellt Cluster basierend auf 4 Proben weiter hervorgehoben, in diesem Manuskript (zwei biologische Wiederholungen der Kontrolle SiRNA und Si-HNRNPC-behandelten Zellen) 84 % Überlappung mit einem kommentierten gen und davon, 75 % Überlappung mit einem 3' UTR und 86 % entweder mit einem 3' UTR oder ein terminal Exon. Der Pearson-Korrelationskoeffizient des Ausdrucks von 3' enden in den Replicate Proben ist 0.92 und Werte von über 0,9 sind in der Regel mit der Methode erhalten. A-seq2 ist somit eine bequeme Methode, die sehr reproduzierbare Ergebnisse liefert.

Protocol

1. Zellwachstum und mRNA Isolierung

  1. wachsen Zellen nach Ihrem experimentellen Design in 6-Well Platten bis ~ 1 x 10 6 Zellen pro Bohrloch an 80 % Einmündung.
  2. Das Wachstumsmedium zu entfernen und die Zellen einmal waschen mit Phosphat gepufferte Kochsalzlösung. Lösen Sie die Zellen auf der Platte direkt durch Zugabe von 1 mL Lyse Puffer aus dem mRNA-Isolierung-Kit. Übertragen die Viskose lysate in ein Plastikrohr 15 mL mit 1 mL Pipettenspitze. Verwenden eine Gummispachtel vollständig das Zellmaterial aus der Plattenoberfläche lösen.
  3. Scheren die lysate enthaltende zähflüssige DNA mit einer 1 mL Spritze, die an einer Injektionsnadel 23 G von mehreren kräftigen Abbewegungen des Kolbens befestigt, bis die lysate nicht mehr dickflüssig ist. Zeigen Sie die Spritzennadel auf der Mitte der Unterseite zu vermeiden, Auswerfen der lysate aus der Tube.
  4. Übertragen die lysate in einem 1,5 mL-Tube mit der Spritze. Spin 5 min bei 20.000 x g und 4 ° C, die Ablagerungen zu entfernen. DNA-niedrige Bind 1,5 mL Fläschchen im gesamten Protokoll verwendet werden.
  5. Während der Ausführung der Zentrifuge waschen 300 µL resuspendierte Oligo (dT) 25 magnetischen Kügelchen auf einer magnetischen Zahnstange mit 500 µL Puffer Lyse. Mischen Sie die Rohre 2 - 3 Mal auf dem Gestell. Entfernen Sie den Puffer, nachdem die Lösung klar ist. Den klare Überstand aus Schritt 1.4 zu sammeln und die Perlen hinzufügen. Aufschwemmen und Röhren auf ein rotierendes Rad für 10 min.
  6. Legen die Rohre auf einem magnetischen Gestell. Entfernen Sie die klare Flüssigkeit aus der mRNA-Isolierung-Kit nach 2 min. Add 0,8 mL Puffer A. Biegen Sie das Rohr um 180° Grad auf dem Rack, 2 - 3 Mal. Wiederholen Sie diesen Waschschritt wieder mit Puffer A.
  7. Waschen die Perlen 2 Mal mit 0,8 mL Puffer B, wie unter Punkt 1.6 beschrieben.
  8. , Die gebundenen mRNA aus Perlen, Eluieren fügen 33 µL H 2 O und Aufschwemmen der Perlen. Auf 75 ° C für 5 min auf einem beheizten Block erwärmen. Drehen Sie sofort die Röhren für 1 s und Platz auf der magnetischen Zahnstange. Übertragen Sie den Überstand auf einen neuen Schlauch. Proben können bei-80 ° C bis zur weiteren Verwendung gespeichert werden.
  9. Fügen Sie 66 µL alkalische Hydrolyse Puffer an den 33 µL mRNA (Schritt 1,8), mischen und erhitzen für genau 5 min bei 95 ° C auf einem Heizblock. Sofort kühlen Rohre auf Ice
  10. Isolieren RNA mit einem RNA-Bereinigung Kit.
    Hinweis: Bestätigen Sie die Lautstärke; Es sollte 100 µL.
    1. Hinzufügen 350 µL RLT-Puffer von Kit und 250 µL Ethanol. Ladung auf die Spalte und Spin für 30 s bei 8.000 x g bei Raumtemperatur (RT). Waschen Sie mit 500 µL RPE Puffer aus dem Kit. Waschen Sie mit 500 µL 80 % Ethanol. Spinnen Sie für 5 min bei 20.000 x g um die Spalte zu trocknen. Spalte 36 µL H 2 O hinzu und spin für 1 min bei 20.000 x g. verwerfen die Spalte und speichern das Eluat.

2. 5 ' Ende Phosphorylierung und DNase-Behandlung

  1. hinzufügen 5 µL Polynukleotid Kinase Puffer, 5 µL 10 mM ATP, 1 µL Ribonuklease-Hemmer, 1 µL DNase und 2 µL Polynukleotid Kinase, Proben und Inkubation bei 37 ° C für 30 min. optional bereiten Meister Reaktionsmischungen im gesamten Protokoll durch das Mischen von 1,1 Bände x n (n = Anzahl der Proben) der einzelnen Komponenten.
  2. Puffer zu ändern und Entfernen von ATP auf einer Spin-Spalte poly(A) Zusatz im nächsten Schritt zu verhindern.
    1. Prespin Spin-Spalten 735 X g für 1 min. Transfer Spalten zum neuen 1,5 mL Fläschchen und laden die Kinase-Reaktionen auf die Spalten. Spin die Spalten 2 min bei 735 X g. verwerfen die Spalten und legen Sie die Rohre mit gesammelten Reaktionen auf Eis oder Lagerung bei-80 ° c

3. 3 blockieren ' endet mit Cordycepin Triphosphat

Hinweis: Es ist wichtig, die 3 blockieren ' Enden der RNA-Fragmente zu vermeiden, ihre Concatemerization in die nachfolgende Ligation Reaktionen. 3 ' enden, die nicht bereits blockiert sind durch ein ( zyklische) Phosphat nach Hydrolyse werden durch Zugabe eines 3 ' dATP (Cordycepin Triphosphat) Kette Terminator Nukleotid mit Hilfe von poly(A) Polymerase. Hier wurde Hefe poly(A) Polymerase (yPAP), die zum Ausdruck gebracht und gereinigt wie in 8 beschrieben wurde bei einer Konzentration von 0,5 mg/mL verwendet. Hefe oder E. Coli PAP beide haben fast die gleiche Tätigkeit für die Zugabe von 3 ' dATP und können kommerziell erworben werden (siehe Tabelle of Materials).

  1. Hinzufügen 13,5 µL 5 x konzentrierte poly(A) Polymerase-Reaktion-Puffer, 2 µL 10 mM 3 ' dATP, 1 µL RNase-Inhibitor und 1 µL poly(A) Polymerase, die Reaktion von Schritt 2.2.1. Mix und Spin für 1 s. Inkubation bei 37 ° C für 30 min. hinzufügen 32.5 µL H 2 O, jede Reaktion. Reinigen Sie die RNA wie in Schritt 1.10.1. Eluieren die RNA mit 14 µL H 2 O.

4. Unterbindung der Reverse 3 ' Adapter an den 5 ' Ende der RNA-Fragmente

  1. legen Sie die Reaktionen in einem Vakuum Konzentrator für 10 min, 6 µL. Add 3 µL 10 x T4 RNA Ligation Puffer, 3 µL 10 mM ATP reduziert , 15 µL PEG­-8000, 1 µL RNase-Inhibitor, 1 µL 0.1 mM umgekehrte Ergänzung 3 ' Adapter " revRA3 " (siehe die Tabelle Materialien) und mischen Sie 1 µL hohe Konzentration RNA Ligase 1.
  2. Die Reaktionen bei 24 ° C 16 h auf einem beheizten Mischer mit intermittierenden mischen bei 1.000 u/min inkubieren Sie
  3. . Jede Reaktion 70 µL H 2 O hinzufügen und mischen. Reinigen Sie die RNA wie in Schritt 1.10.1. Eluieren die RNA mit 14 µL H 2 O. Proben können an dieser Stelle bei-80 ° C gelagert werden.

5. Reverse Transkription (RT)

  1. Ort Röhren die Eluate in einem Vakuum Konzentrator für 3 min auf 11 µL. Transferreaktionen zu 200 µL PCR das Volumen zu reduzieren. Fügen Sie 1 µL 0,05 mM RT Primer " Bio-dU-dT25 ". Hitze für 5 min bei 70 ° C in einem PCR Cycler und lassen bei RT 5 min
  2. Add 1 µL 10 mM dNTPs, 4 µL 5 x Reverse Transkriptase Puffer 1 µL 0.1 M DVB-t, 1 µL RNase-Inhibitor und 1 µL Reverse Transkriptase. Mischen Sie und erhitzen Sie die Reaktionen für 10 min. 55 ° C und 10 min auf 80 ° C in einem PCR Cycler. Halten Sie auf dem Eis oder bei-80 ° C für eine längere Lagerung.

6. Verdauung mit Uracil DNA Glycosylase Enzym-Mix

  1. Pipettieren 100 µL Streptavidin-Perlen in ein 1,5 mL Fläschchen in 800 µL Biotin Bindung Puffer Aufschwemmen und legen Sie auf einem magnetischen Rack. Invertieren Sie Röhren 2-3 Mal. Entfernen Sie den Puffer wenn klar. Wiederholen Sie die Waschschritt. Die Perlen in 200 µL Biotin Bindung Puffer Aufschwemmen.
  2. Reversen Transkription Reaktion auf die Perlen-Lösung hinzufügen und 20 min bei 4 ° C auf einem rotierenden Rad inkubieren. Waschen der Perlen, 2 X mit Biotin-Bindung Puffer wie in, Schritt 6.1 und 2 X mit zehn Puffer auf einem magnetischen Gestell. Aufschwemmen der Perlen in 50 µL zehn Puffer, 2 µL Uracil DNA Glycosylase Enzym-Mix hinzufügen und 1 h bei 37 ° C in einem Mischer mit intermittierenden mischen inkubieren.
  3. Fügen Sie 50 µL H 2 O, 11 µL RNase H Puffer und 1 µL RNase H auf die Reaktionen. Inkubation bei 37 ° C für 20 min. Ort Röhren auf einem magnetischen Gestell und übertragen Sie die Flüssigkeit, die gespalten cDNA zu einem neuen Schlauch
  4. reinigen die gespalten cDNA.
    1. Hinzufügen 550 µL Puffer PB aus dem PCR-Reinigung-Kit für die Spaltung Reaktionen. Fügen Sie 10 µL 3 M Natriumacetat, pH 5,2, den pH-Wert zu senken. Laden Sie die Reaktionen auf minimale Elution Spin Spalten und Spin bei 17.000 x g für 1 min.
    2. Fügen Sie 750 µL Puffer PE zu Spalten und Spin bei 17.000 x g für 1 min. verwerfen der durchströmten. Drehen Sie die Spalten bei 17.000 x g für 1 min trocknen lassen. Die Spalten zu einem 1,5 mL Fläschchen zu übertragen, fügen Sie 16 µL H 2 O und Spin bei 17.000 x g für 1 min. legen die Reaktionen in einem Vakuum Konzentrator für 8 min bis zu einem Volumen von 7 µL konzentrieren.

7. Ligatur der 5 ' Adapter für 5 ' Enden der cDNA

  1. der isolierten cDNA hinzufügen 3 µL 10 x T4 RNA Ligase 1 Puffer, 3 µL 10 mM ATP, 15 µL PEG­-8000, 1 µL 50 µM " revDA5 " Oligo , und 1 µL hohe Konzentration T4 RNA Ligase 1. Inkubation bei 24 ° C für 20 h. hinzufügen 70 µL H 2 O, jede Reaktion. Proben können an dieser Stelle bei-20 ° C gelagert werden.

8. Pilot, PCR, Verstärkung der Bibliotheken und Größenauswahl

  1. In einer Pilotphase Reaktion bestimmen die optimale Anzahl von PCR-Zyklen um Bibliothek Verstärkung in der exponentiellen Phase zu erreichen.
    1. Pipettieren 25 µL DNA-Polymerase Mix, 20 µL Ligatur Reaktion, 2 µL H 2 O, 1,5 µL 10 µM vorwärts PCR Primer (RP1) und 1,5 µL 10 µM rückwärts PCR-Index-Primer in 200 µL PCR-Röhrchen.
    2. Laufen der Cycler mit dem folgenden Programm: 3 min 95 ° C, gefolgt von 20 Zyklen von 20 s 98 ° C, 20 s 67 ° C und 30 s 72 ° C. sammeln 7 µL Aliquots nach 6, 8, 10, 12, 14, 16 und 18 Zyklen direkt aus der Cycler. Fügen Sie 1 µL 10 x Ladepuffer (50 % Glycerin, 0,05 % Xylol Cyanol). Hinweis: Bitte folgen Sie die Empfehlungen des Lieferanten, falls mit multiplexing beim Kombinieren von Barcodes.
    3. Separate Produkte in kleinen Schlitzen auf einem 2 % Agarose-Gel in 1 X TBE-Puffer mit einem 01:10, 00 Verdünnung der grünen Fluoreszenzfarbstoff.
      1. Last Aliquote auf eine 2 % Agarose gel und führen Sie das Gel bei 100 Volt für 15 min. Visualize Migration der PCR-Produkte auf ein Gel-Dokumentationssystem.
  2. Verwenden die Anzahl der Zyklen zu Beginn des exponentiellen Amplifikation in der pilot Reaktion für eine groß angelegte PCR-Reaktion mit zweimal das Volumen wie für die pilot-Reaktion ( Abbildung 2).
    1. Für großflächige PCR-Reaktionen konzentrieren und Entsalzen die Reaktionen zunächst mit einem PCR-Reinigung-Kit und die Produkte auf breite Schlitze auf 2 % Agarose-Gele in 1 X TBE-Puffer zu trennen.
  3. Schneiden Sie Gel Scheiben mit 200-350 nt DNA Produkte. Schmelzen Sie das Gel in die chaotropen Puffer bei RT für bis zu 30 Minuten. Extrahieren Sie DNA aus dem Gel Scheiben mit einem Gel Extraction Kit. Nicht erhitzen auf 50 ° C zu verhindern der Verzerrungen bei der Bindung von A-reiche DNA 9.
  4. Senden für die Sequenzierung.
    Hinweis: In der Regel 50 Hz Single-Read (SR50) sind ausreichend (siehe, z. B. https://www.illumina.com/technology/next-generation-sequencing.html).

9. Datenverarbeitung

Hinweis: die resultierende Sequenzierung (im Fastq-Format) Daten, die mit Software, die im Gitlab Repository (https://git.scicore.unibas.ch/zavolan_public/A-seq2-processing) zur Verfügung. Die Analyse umfasst vier Hauptschritte: (1) Download das Git-Repository, (2) die Installation einer virtuellen Umgebung spezifische Parameter (3) Einstellung in der Konfigurationsdatei und (4) startet die Analyse durch ‘ Snakemake ’ 10. die gesamte Analyse erfolgt in Schritt 4 benötigt nur einen Befehl. Eine detaillierte, schrittweise Beschreibung der Analyse finden Sie in der README-Datei im Repository Gitlab und eine kurze Beschreibung sind unterhalb erhältlich. Alle einzelnen Verarbeitungsschritte werden erreicht, indem die Ausführung von öffentlich verfügbaren Tools, entweder aus externen Quellen oder im eigenen Haus vorbereitet. Die rechnerische Pipeline hängt eine Anakonda-basierte 11 Python 3 virtuelle Umgebung mit dem Snakemake-Paket zur Verfügung- 10. Es läuft auf Maschinen mit Unix-ähnliches Betriebssystem und wurde getestet in einer Linux-Umgebung mit dem CentOS 6.5 Betriebssystem installiert und 40 GB RAM zur Verfügung. Software-Abhängigkeiten werden automatisch innerhalb der virtuellen Umgebung gesteuert. Die folgenden öffentlich verfügbare Software-Tools sind erforderlich und damit zusammen mit der Umgebung installiert: Snakemake (v3.9.1) 10, Fastx Toolkit (v0.0.14) 12, STAR (v2.5.2a) 13 , Cutadapt (v1. 12) 14, Samtools (v1.3.1) 14 , 15, Bedtools (v2.26.0) 16 , 17.

  1. Daten-Vorverarbeitung von lautet, cDNAs
    Hinweis: die Sequenzierung tiefe variieren zwischen den Läufen und je nach Instrument, können Daten aus einer Stichprobe über mehrere Sequenzdateien aufgeteilt werden. Wenn dies der Fall ist, verketten Sie die Dateien, die eine Probe in einer einzigen Eingabe-Datei entsprechen, die in den folgenden Schritten verwendet wird.
    1. Die Datei von Fastq in Fasta-Format konvertieren.
    2. Extrakt liest mit einer korrekten Struktur (3 Thymidines an den Positionen 5, 6 und 7 des Lesevorgangs).
      Hinweis: Ein Buch, das richtig nach dem experimentellen Protokoll beschriebenen bereit ist sollte die Struktur haben (von den 5 ' Ende): 4-Nukleotid Barcode - 3 Thymidines - reverse Ergänzung der Niederschrift 3 ' Ende.
    3. Speichern die Informationen über den Start Tetramer in der Sequenz die Beschreibungszeile.
      Hinweis: Die Tetramer dient als einen eindeutigen molekularen Bezeichner (UMI), die die Korrektur der Verstärkung Artefakte später in der Analyse erleichtert.
    4. Entfernen Sie die ersten sieben Nukleotide aus dem Lesen Sie ' s 5 ' Ende.
    5. Korrigieren für Verstärkung Artefakte indem man nur eine Kopie des lautet mit der gleichen Reihenfolge und UMI einfügen.
    6. Entfernen Sie den Teil der 3 ' Ende, das der Adapter Sequenz und dann umgekehrte Ergänzung der Sequenz entspricht. Gehen Sie nur mit liest, die eine Mindestlänge haben (Standard: 15 nt).
      Hinweis: abhängig von der Länge der ursprünglichen mRNA-Fragment und die Anzahl der Sequenzierung Zyklen, die 3 ' Ende der Lese enthalten Teil der 3 ' Adapter, die in diesem Schritt entfernt wird.
  2. Extrahieren alle Lesevorgänge, die folgenden Kriterien erfüllen: maximal 2 unbekannte Nukleotide (' N '), maximal 80 % als und letzten Nukleotid des Lesevorgangs nicht A. Diese liest gelten als ausreichender Qualität in der Analyse verwendet werden.
  3. Ordnen Sie der liest das Genom mit einem Tool das handhabt gespleißten liest und erzeugt eine Ausgabedatei im BAM Format.
    1. Wenn STAR verwendet wird, erstellen Sie eine Datei mit dem Index des Genoms der liest zugeordnet werden sollen. Für das menschliche Genom, dieser Schritt erfordert 35 GB an Arbeitsspeicher (RAM).
    2. Ordnen Sie der liest das Genom.
      Hinweis: (STAR-spezifische Anmerkungen) Soft-Clipping ist deaktiviert, um die Zuordnung der 3 zwingen ' Ende jeder lesen, da dies Das Nukleotid unmittelbar vor der Spaltstelle.
  4. Die BAM in ein Bett-Datei zu konvertieren. Wenn ein Buch mit mehreren Speicherorten zugeordnet wird, halten Sie nur diejenigen mit dem geringsten Abstand bearbeiten.
    Hinweis: Die Kopienzahl des Lesevorgangs an einer bestimmten Position zugeordnet wird als Ergebnis verwendet. Lesevorgänge, die mehreren Orten zugeordnet, sind geringfügig an jedem Standort mit einem Gewicht gleich 1/Anzahl der Standorte, der ein Buch zugeordnet, gezählt.
  5. Zusammenbruch liest, die durch einen Fehler wahrscheinlich Sequenzierung variieren. Wenn zwei unterschiedliche liest am selben Ort zuordnen (Start- und Endposition der Zuordnungen sind identisch) und sie teilen die gleichen UMI, betrachten sie als PCR Duplikate und halten nur eine.
  6. Schließen alle einzelnen Pre-mRNA 3 ' beenden Verarbeitung Websites.
    Hinweis: Eine individuelle Lektüre liefert Beweise für eine 3 ' enden, wenn seine letzten vier Nukleotide das Genom fehlerfrei zugeordnet sind. Die Position, an die die 3 ' Ende der lesen Sie Karten als Spaltstelle gespeichert.
  7. Detect 3 ' enden Websites, die von internen Priming entstanden sein könnte. Die Website als interne Priming Artefakt definieren, wenn die 10 nt flussabwärts der Spaltstelle im Genom erfüllen eines der folgenden Kriterien: enthält mehr als sechs wie, enthält sechs Mal in Folge als oder beginnt mit einer der folgenden Tetramers: AAAA, AGAA, AAGA, AAAG .
  8. Erzeugen eine Tabelle mit einzelnen 3 ' beenden Verarbeitung Websites im Bett Format.
  9. Identifizieren unabhängig geregelt poly(A) Website Clustern.
    Hinweis: Die hier beschriebenen Schritte der Prozedur, die eine Vorveröffentlichung 5 eingeführt wurde.
    1. Durch das Sammeln von einzelnen 3 starten ' beenden Verarbeitung Websites, die in allen Proben der Studie gewonnen wurden.
    2. Kommentieren bekannten poly(A) Signale 7 in der Region von 09:00 Nukleotide etwa jedes einzelnen 3 ' Ende Bearbeitungsstelle.
    3. Identifizieren poly(A) Websites über der Hintergrundebene in jeder Stichprobe wie folgt zum Ausdruck gebracht.
      1. Sortieren der Seiten durch ihre rohe Ausdruck innerhalb der aktuellen Probe. Durchlaufen Sie die Liste der Websites von oben nach unten, einen höheren Rang Seite niedrigerere bewertete Seiten zuordnen, wenn sie sich innerhalb einer vordefinierten Abstand im Genom befinden (Standard: 25 nt up- oder downstream) von der hochrangigen Website.
        Hinweis: Alle niederen Ranges Standorte verbunden mit einer hochrangigen Website definieren einen Cluster, deren Ausdruck ist die Anzahl der Lesevorgänge, die alle diese Seiten dokumentieren.
      2. Ausdruck dieser Cluster sortieren und durchqueren die Liste der Blöcke vom höchsten zum niedrigsten Ausdruck bestimmen den Ausdruck Schwelle c an dem signal der Prozentsatz der Cluster mit einer kommentierten poly(A) Unterschreitung der einen vordefinierten Schwellenwert ( Standard: 90 %).
      3. Webseiten, die auf jedem Cluster unterhalb des Grenzwertes zu verwerfen.
    4. Cluster verteilt eng 3 ' enden Seiten über Proben erhalten.
      Hinweis: Art 3 ' End-Verarbeitung Seiten zuerst durch die Anzahl der Proben zu unterstützen und dann durch die Summe der normalisierten lesen Graf (liest pro million (u/min)) über Proben. Durchlaufen der Liste von oben nach unten, ranghöheren Seiten schlechtere Seiten zuordnen, wenn ihre Entfernung zu den höheren Rang Seite nicht größer als einen vordefinierten Grenzwert ist (Standard: 12 nt). Wenn eines der konstituierenden 3 ' Ende Site überschneidet sich mit einem kommentierten poly(A) Signal oder hat ein Poly-Signal direkt flussabwärts, die entsprechenden Cluster für weitere Untersuchung zu internen Priming erkennen markiert ist.
    5. Merge poly(A) Website Clustern.
      Hinweis: Wenn ein Cluster als vermeintliche interne Priming Kandidat gekennzeichnet ist, es entweder eine nachgeschaltete Cluster zusammengeführt, wenn die beiden Cluster ihre Poly-Signale teilen oder beibehalten, wenn die meisten nachgelagerte Website im Cluster ein Poly-Signal befindet sich auf ein minimum flussaufwärts zu distanzieren (Standard: 15 nt). Zu guter Letzt eng beieinander liegenden Clustern werden zusammengeführt, wenn: (i) sie teilen die gleichen poly(A) Eröffnungsdialog, oder (Ii) die Zeitspanne von der daraus resultierenden Cluster ein Maximum nicht überschreitet (Standard: 25 nt).
    6. Speichern Cluster im Bett-Dateiformat mit der Summe normalisiert lesen Graf von allen 3 ' enden Seiten in jedem Cluster als Partitur.

Representative Results

Poly (A)-mit RNA wurde von kultivierten Zellen, fragmentiert durch alkalische Hydrolyse isoliert und cDNAs wurden durch reverse Transkription mit oligo(dT) Primer. Die daraus resultierende cDNA wurde auf Streptavidin Perlen immobilisiert, dU war gespalten in Uracil spezifische Exzision Reaktion, Adapter wurden ligiert, 5' und 3' Enden gespalten Fragment und die Einsätze wurden sequenziert. Abbildung 1 zeigt eine grafische Übersicht über das Experiment.

Für HeLa und HEK293 Zellen reichten 106 Zellen poly(A) Standorte für die überwiegende Mehrheit der Protein-kodierenden Gene am Ende des Verfahrens. Allerdings erhöht sich für andere Arten von Zellen oder Gewebe, die es möglicherweise erforderlich, die Sättigung als die Anzahl der Zellen in das Experiment in die Anzahl der identifizierten poly(A) Websites testen. Repräsentative Ergebnisse der pilot PCR Schritt und des DNA-Fragments Analyse der Probe vor der Sequenzierung in Abbildung 2dargestellt.

Abbildung 3 zeigt die Vorverarbeitung Schritte für die computergestützte Analyse ausgehend von der Fastq-Datei aus der Sequencer und endend mit der Qualität überprüft, Adapter-getrimmten liest, die bereit sind, das Genom zugeordnet werden. Abbildung 4 zeigt die Analyseschritte, die beginnen mit der Zuordnung der Lesevorgänge zu den entsprechenden Genom und das Ende mit dem Katalog von mRNA 3' End-Verarbeitung von Websites, die in einer bestimmten Probe identifiziert werden. Wenn mehrere Proben analysiert werden, sind zusätzliche Schritte entspricht dem 3' Ende Verarbeitung von Websites, die in einzelnen Proben gefunden wurden und melden ihre Fülle über Proben durchgeführt. Diese Schritte werden in Abbildung 5dargestellt.

So, nachdem Proben sequenziert haben, ist die Analyse der resultierenden Sequenzierung Dateien (im Fastq-Format) durch die verfügbaren Verarbeitungspipeline zu lesen einfach. Nach dem Hinzufügen der Informationen über die Proben in die Konfigurationsdatei, die Ausführung der Pipeline wird in zwei Haupttypen von Ausgabedateien führen: 1) Bett-Dateien mit allen 3' Ende Verarbeitung Standorte in einzelnen Proben (z. B. " sample1.3pSites.noIP.Bed.gz"), und 2) eine Bett-Datei mit allen poly(A) Website Clustern (clusters.merged.bed) über alle Proben der Studie. Die Ausgabe enthält auch die Genom-Koordinaten für alle Lesevorgänge aus jeder einzelnen Probe (z.B. "Beispiel1. STAR_out/aligned.sortedByCoord.out.BAM"), die später in einem Genom-Browser wie IGV16eingesehen werden können. Sichtprüfung der lesen Sie Firmenprofile bietet im Allgemeinen einen ersten Blick auf die Verteilung der Poly-Standorte in das Genom und die Veränderungen, die auf die spezifischen Störungen auftreten, die in der Studie durchgeführt wurden. Zum Beispiel ist in Abbildung 6 die Reaktion eines bestimmten Gens auf der Knock-down des HNRNPC Proteins dargestellt.

Zusammenfassungen dieser genomweiten Distributionen sind ebenfalls vorhanden (Tabelle 1). Im einzelnen enthalten Output-Dateien im Verzeichnis "zählt/Annotation_overlap" Bruchteile von Websites, die mit kommentierten Besonderheiten überlappen (aus der Gtf-Datei als Eingabe bereitgestellt; beschriftet sind: 3' UTR, terminal Exon Exon, Intron, intergenetischer). Zu guter Letzt werden Ergebnisse der einzelnen Bearbeitungsschritte für jede Probe auch (z. B. "sample1.summary.tsv") gespeichert. Hierunter fallen die Zahlen: roh liest in jeder Probe, liest, die die erwartete Struktur der 5'-Ende, mal gelesen, die nach einem Zusammenbruch vollständige PCR Duplikate bleiben, qualitativ hochwertige liest nach den Kriterien definiert bei Schritt 9.2, liest die Karte eindeutig auf das Genom (nach einem Zusammenbruch diejenigen, die durch Sequenzierung Fehler geführt, siehe Schritt 9,5), Multi-Mapping liest (nach einem Zusammenbruch diejenigen, die durch Sequenzierung Fehler geführt, siehe Schritt 9,5), roh (nicht geclusterten) 3' End-Verarbeitung Websites in jeder Probe, roh 3' End-Verarbeitung Websites ohne interne Priming Kandidaten enden einzigartige 3' Verarbeitung Websites aus allen Proben ohne interne Priming Kandidaten und abschließende Reihe von Poly-Website-Cluster.

Figure 1
Abbildung 1: Main Schritte des Protokolls A-seq2. Einzelnen Schritte sind auf der linken Seite der Abbildung angegeben. Insert-RNA-Fragmente sind als grüne Linien dargestellt, die nach der reversen Transkription für cDNA rot; Adapter sind in hellem Blau oder Orange gefärbt. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 2
Abbildung 2: Pilot PCR und endgültige Produktprofil. (ein) Aliquote aus der PCR-Reaktion wurden bei verschiedenen Zyklen gesammelt und getrennt auf 2 % Agarose-Gele. Zahlen auf der linken Seite geben Größe in Nukleotide der jeweiligen Bands in der DNA-Leiter. In diesem Experiment wurden 12 Zyklen (*) für die groß angelegte PCR Reaktion ausgewählt. (b) Beispiel einer Stichprobe nach Größe Auswahl führen Sie auf einem Fragment Größe Analysator enthüllt eine durchschnittliche Größe von rund 280 Nukleotiden. Zahlen auf der linken Seite [FU] relative Signalintensität. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 3
Abbildung 3: Übersicht über die Vorverarbeitung der Sequenzierung liest. Die Fastq-Dateien mit liest, die von der Sequenzierung Instrument-assoziierten Software generiert werden werden verarbeitet, um qualitativ hochwertige liest zu identifizieren, die das entsprechende Genom zugeordnet werden kann. Die Abbildung zeigt die input-/Output-Spezifikation der einzelnen Schritte in der Pipeline, mit Links zu den einzelnen Schritten des Protokolls beschrieben im Abschnitt "Datenverarbeitung". Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 4
Abbildung 4: Gliederung der Reihenfolge lesen Verarbeitung, aus dem Schritt des Mappings in das Genom der Generation der einzelnen 3' Ende Verarbeitung Websites. Die Abbildung zeigt die input-/Output-Spezifikation der einzelnen Schritte in der Pipeline, mit Links zu den igerne Schritte des Protokolls, die im Abschnitt "Datenverarbeitung" beschrieben. Die wichtigsten Ausgabedatei, die an den Benutzer übermittelt wird, ist fett markiert. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 5
Abbildung 5: Übersicht über die Schritte, die ergriffen werden, um Gruppen von Co geregelten 3' Ende Sequenzierung Websites generieren. Die Abbildung zeigt die input-/Output-Spezifikation der einzelnen Schritte in der Pipeline, mit Links zu den einzelnen Schritten des Protokolls beschrieben im Abschnitt "Datenverarbeitung". Die wichtigsten Ausgabedatei ist fett markiert. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 6
Abbildung 6: Beispiel-Ergebnisse des Profils der 3' Ende Verarbeitung liest entlang der terminal Exon des Gens NUP214, gezeigt in der IGV 16 Genom Browser. A-seq2 liest wurden aus zwei Proben von HEK-293-Zellen, behandelt mit einer Kontrolle-SiRNA oder mit einem HNRNPC SiRNA vorbereitet. Die Lesevorgänge, die Poly-Websites dokumentiert, die von der Pipeline Analyse kommentiert wurden waren im BAM-Format gespeichert, die als Eingabe für den IGV-Genom-Browser verwendet wurde. Die 3' Enden der lesen Sie Gipfel zuordnen mRNA 3' enden, die in Ensembl versehen sind. Die Profile zeigen eine verstärkte Nutzung der langen 3' UTR Isoform auf HNRNPC zerlegbar. Bitte klicken Sie hier für eine größere Version dieser Figur.

Si-Control replizieren 1 Si-Control replizieren 2
ID: 29765 ID: 32682
Anzahl der Roh-Lesevorgänge 44210258 68570640
Anzahl der gültigen liest nach dem Trimmen und Filterung 14024538 21211793
Anzahl der eindeutigen Zuordnung mal gelesen 6953674 13946436
Anzahl der Lesevorgänge, die Zuordnung zu mehreren loci 2040646 2925839
Anzahl der einzelnen 3' End-Verarbeitung Websites 1107493 1710353

Tabelle 1: Beispielausgabe der Pipeline Analyse. Zusammenfassungen der Lesevorgänge, die einzelnen Schritte erzielt wurden.

Discussion

Die Vielzahl von Kern und zusätzliche Faktoren, die in der Pre-mRNA 3' Ende Verarbeitung beteiligt sind spiegelt sich in einer entsprechend komplex Polyadenylation Landschaft. Darüber hinaus reagiert Polyadenylation auch zu Veränderungen in anderen Prozessen wie Transkription und Spleißen. 3' Ende Spaltstellen in Pre-mRNAs sind in der Regel identifiziert anhand der charakteristischen poly(A) Schwänzen, die 5'-Spaltprodukte hinzugefügt werden. Die meisten Methoden verwenden oligo(dT) Primer von variabler Länge, mit denen die spezifischen Umwandlung von Poly (A)-mit mRNAs zu cDNAs in einer reversen Transkription Reaktion. Ein häufiges Problem dieses Ansatzes ist interne Grundierung auf A-reiche Sequenzen Serums Spaltstellen führt. Zwei Methoden, die darauf abzielen, dieses Artefakt in der Phase der Vorbereitung der Probe zu umgehen sind vorgeschlagen worden. In den 3P-Seq Methode 1sind Adapter speziell an den Enden von poly(A) Tails mit Hilfe einer Schiene Oligo gefolgt von teilweise RNase T1 Verdauung und reversen Transkription mit TTP in der Reaktion als die einzige Deoxynucleotide ligiert. Die daraus resultierende poly(A)-poly(dT) Heteroduplexes werden dann mit RNase H verdaut und die restlichen RNA-Fragmente isoliert, Adapter ligiert und sequenziert. Ein einfacher und eleganter Methode, 2P-Seq, die verwendet eine benutzerdefinierte Sequenzierung Grundierung überspringen die restliche Strecke der oligo(dT) in der Sequenzierung Reaktion durch die gleichen Autoren 2berichtet wurde. In einer entsprechenden Methode 3' liest 3, eine ungewöhnlich lange Grundierung 5 uns und 45 Ts, auch mit Biotin ist geglüht, fragmentierte RNA, gefolgt von strengen Waschungen für RNA-Moleküle mit poly(A) Schwänzen von mehr als 50 Nukleotiden auswählen. Obwohl 3' liest drastisch die Häufigkeit von internen Priming reduziert, beseitigt es nicht völlig es 3. Protokolle für die direkte RNA Sequenzierung auch vorgeschlagen worden, aber die resultierende liest sind kurz und haben eine hohe Fehlerquote und dieser Ansatz wurde nicht weiter entwickelten 18,19,20. Der PolyA-Seq und kommerzialisierten Quant Seq-Protokolle kombinieren oligo(dT) basierte Grundierung mit einem zufälligen Priming Schritt für die cDNA zweiten Strang Synthese 20. Die Verwendung der Vorlage Schalter reversen Transkription Reaktion mit Moloney Murine Leukämie Virus (MMLV) Reverse Transkriptase führt zu der Generation von cDNAs mit linker in einem einzigen Schritt und damit können keine Adapter-Dimere in der PAS-Seq und SAPAS Methoden erscheinen 21 , 22.

Die A-seq2 Methode hier vorgestellten zeichnet sich in der Nutzung eines spaltbaren Nukleotids (dU) innerhalb einer biotinylierte oligo(dT) Grundierung. Diese Modifikation verbindet das Dienstprogramm oligo(dT) hybridisiert, Polyadenylated Ziele mit der Entfernung von die meisten der Oligo (dT)25 Sequenz aus der isolierte Fragmente bevor Bibliotheken bereit sind und die Erhaltung der drei Ts zu bereichern, zeigen Sie vorherige poly(A) Schwanz. Im Gegensatz dazu lassen Sie Methoden, die RNase H um poly(A) nach dem Zufallsprinzip aus der RNA-Moleküle zu entfernen verwenden mehrere wie. Da im A-seq2, Sequenzierung von 3' Ende der Anti-Sense-Stränge erfolgt, sind Spaltstellen vorhergesagt befindet sich nach dem NNNNTTT Motiv zu Beginn des rohen Sequenz liest. Die randomisierte Tetramers dienen nicht nur Basis, sondern auch bei der Beseitigung von PCR-Amplifikation Artefakte aufrufen lassen. Längere UMIs können auch untergebracht werden. Die Möglichkeit der internen Grundierung bleibt in A-seq2 und richtet sich rechnerisch, zuerst durch verwerfen 3' endet mit einer genomisch kodiert, A-reiche nachgelagerten Sequenz und dann verwerfen 3' Ende Cluster, die durch interne Priming bei erklärt werden könnte die A-reiche poly(A) Signal selbst. Eine aktuelle Analyse von poly(A) Websites abgeleitet eindeutig durch eine Vielzahl von Protokollen zeigt, dass die Websites, die für A-seq2 einzigartig sind die erwarteten Nukleotid Verteilung und Plazierung Gene, ähnlich wie bei anderen 3' Sequenzierung Protokolle zu beenden.

Ein entscheidender Schritt in A-seq2 ist die Auswahl von Polyadenylated RNA und Entfernung der ribosomalen RNAs und verschiedenen kleinen RNAs. Dies geschieht am einfachsten durch eine mRNA-Isolierung-Kit mit Oligo (dT)25 magnetischen Kügelchen. Im Prinzip gibt total RNA isoliert mit Phenol auch Lösungen mit hochwertigen RNA, die weitere Auswahl durch die mRNA-Isolierung Kit oder Oligo (dT) Agarose unterzogen werden kann. Ein Schritt, der in A-seq2 variiert werden kann, ist die Behandlung mit alkalischen Hydrolyse, verkürzt oder verlängert um RNA-Fragmente unterschiedlicher Größe zu erhalten. Kritisch ist auch, dass Zusatz von 3' dATP bis 3' Ende der RNA-Fragmente von poly(A) Polymerase effizient ist. In dem hier beschriebenen Protokoll wird diese Behandlung alle RNA-Fragmente, um Concatemerization während der Ligatur Reaktion zu vermeiden. Endlich, wir beachten Sie, dass obwohl RNA Ligase 1 normalerweise als eine RNA-Ligase verwendet wird, es auch effizient single stranded DNA ligates, wie wir hier getan haben, um einen Adapter, um die 5'-Ende der DNA Moleküle verbinden.

So ist A-seq2 eine effiziente und einfach zu Protokoll für die Identifizierung der Pre-mRNA 3' End-Verarbeitung Websites zu implementieren. Zukünftige Entwicklungen zählen weitere Reduzierung der Komplexität des Protokolls und die Menge des benötigten Materials. Der damit verbundenen Satz von computergestützte Datenanalyse-Tools weiter ermöglichen die homogene Verarbeitung von 3' Ende Sequenzierung liest mit einer Vielzahl von Protokollen erhalten.

Disclosures

Die Autoren haben nichts preisgeben.

Acknowledgments

Die Autoren danken Frau Béatrice Dimitriades für Hilfe bei der Zellkultur. Diese Arbeit wurde unterstützt vom Schweizerischen Nationalfonds zur Förderung Zuschüsse #31003A_170216 und 51NF40_141735 (NFS RNA & Krankheit).

Materials

Name Company Catalog Number Comments
Materials
Agarose, ultra pure Invitrogen 16500-500
2100 Bioanalyzer Agilent G2940CA
Cordycepin triphosphate (3’ dATP) SIGMA C9137
DNA low bind vials, 1.5 ml Eppendorf 22431021
Dulbecco’s Phosphate Buffered Saline SIGMA D8637
Dynabeads mRNA-DIRECT Kit Ambion AM61012
GR-Green dye Excellgen EG-1071 use 1:10,000 dillution
HiSeq 2500 or NextSeq 500 next generation sequencers Illumina inquire with supplier
KAPA HiFi Hotstart DNA polymerase mix KAPA/Roche KK2602
Nuclease free water Ambion AM9937
Poly(A) polymerase, yeast Thermo Fisher Scientific 74225Z25KU
Poly(A) polymerase, E.coli New England Biolabs M0276L
Polynucleotide kinase Thermo Fisher Scientific EK0032
QIAEX II Gel Extraction Kit Qiagen 20021
QIAquick PCR Purification Kit Qiagen 28104
QIAquick Gel Extraction Kit Qiagen 28704
RNA ligase 1, high concentration New England Biolabs M0437M includes PEG-8000
RNeasy MinElute RNA Cleanup kit Qiagen 74204
RNase H New England Biolabs M0279
RNasin Plus, ribonuclease inhibitor Promega N2618
Superscript IV reverse transcriptase Thermo Fisher Scientiific 18090050
Turbo DNase Ambion AM2238
USER enzyme mix New England Biolabs M5505
Dyna-Mag-2 magnetic rack Thermo Fisher Scientific 12321D
Thermomixer C Eppendorf 5382000015 Heated mixer with heated lid
MicroSpin columns GE-Healthcare 27-5325-01
Name Company Catalog Number Comments
Buffers
Alkaline hydrolysis buffer, 1.5 x Mix 1 part 0.1 M Na2CO3 and 9 parts 0.1 M NaHCO3. Add EDTA to 1 mM. Adjust pH to 9.2. Store aliquots at -20 °C.
5x poly(A) polymerase buffer Thermo Fisher Scientiific 100 mM Tris-HCl, pH 7.0, 3 mM MnCl2, 0.1 mM EDTA, 1 mM DTT, 0.5 mg/ml acetylated BSA, 50% glycerol
Biotin binding buffer 20 mM Tris­Cl pH 7.5, 2 M NaCl, 0.1% NP­40
TEN buffer 10 mM Tris­Cl, pH 7.5, 1 mM EDTA, 0.02% NP­40
Name Company Catalog Number Sequence
Oligonucleotides according to Illumina TruSeq Small RNA Sample Prep Kits, for GA-IIx and Hiseq2000/2500 sequencers Microsynth
revRA3 (RNA) Microsynth 5’ amino­ CCUUGGCACCCGAGAAUUCCA­ 3’
revDA5 Microsynth 5’ amino­ GTTCAGAGTTCTACAGTCCGAC GATCNNNN-3’
Bio-dU-dT25, RT primer Microsynth 5' Biotin-TTTTTTTTTTTTTTTTTTTTTTTTTT-dU-TTTVN 3' (V = G, A or C)
PCR primer forward, RP1 Microsynth 5' AATGATACGGCGACCACCGAGA TCTACACGTTCAGAGTTCTACAG
TCCGA 3'
PCR primer reverse, RPI1, barcode in bold Microsynth 5' CAAGCAGAAGACGGCATACGAG
ATCGTGATGTGACTGGAGTTCCT
TGGCACCCGAGAATTCCA 3'
Name Company Catalog Number Comments
Oligonucleotides according to Illumina TruSeq HT-Small RNA Sample Prep Kits, for HiSeq2000/2500 and NextSeq500 sequencers
HT-rev3A (DNA/RNA) Microsynth 5'-amino-GTGACTGGAGTTCAGACGTGTG
CTCTTCCrGrAUrC-3'
HT-rev5A Microsynth 5' amino-ACACTCTTTCCCTACACGACGCT
CTTCCGATCTNNNN 3'
Bio-dU-dT25, RT primer Microsynth 5' Biotin-TTTTTTTTTTTTTTTTTTTTTTTTTT-dU-TTTVN 3'
PCR primers forward (D501-506) Microsynth or Illumina 5'-AATGATACGGCGACCACCGAGAT
CTACAC[i5]ACACTCTTTCCCTACA
CGACGCTCTTCCGATCT -3'
PCR primers reverse (D701-D712) Microsynth or Illumina 5'-CAAGCAGAAGACGGCATACGAG A[i7]GTGACTGGAGTTCAGACGTG TGCTCTTCCGATC-3'
Documentation for Illumina multiplexing: Illumina https://support.illumina.com/content/dam/illumina-support/documents/documentation/chemistry_documentation/experiment-design/illumina-adapter-sequences_1000000002694-01.pdf

DOWNLOAD MATERIALS LIST

References

  1. Jan, C. H., Friedman, R. C., Ruby, J. G., Bartel, D. P. Formation, regulation and evolution of Caenorhabditis elegans 3'UTRs. Nature. 469, (7328), 97-101 (2011).
  2. Spies, N., Burge, C. B., Bartel, D. P. 3' UTR-isoform choice has limited influence on the stability and translational efficiency of most mRNAs in mouse fibroblasts. Genome Res. 23, (12), 2078-2090 (2013).
  3. Hoque, M., Ji, Z., et al. Analysis of alternative cleavage and polyadenylation by 3' region extraction and deep sequencing. Nat. methods. 10, (2), 133-139 (2013).
  4. Martin, G., Gruber, A. R., Keller, W., Zavolan, M. Genome-wide analysis of pre-mRNA 3’ end processing reveals a decisive role of human cleavage factor I in the regulation of 3' UTR length. Cell Rep. 1, (6), 753-763 (2012).
  5. Gruber, A. R., Martin, G., et al. Global 3' UTR shortening has a limited effect on protein abundance in proliferating T cells. Nat. Commun. 5, 5465 (2014).
  6. Kivioja, T., Vähärautio, A., et al. Counting absolute numbers of molecules using unique molecular identifiers. Nat. methods. 9, (1), 72-74 (2011).
  7. Gruber, A. J., Schmidt, R., et al. A comprehensive analysis of 3' end sequencing data sets reveals novel polyadenylation signals and the repressive role of heterogeneous ribonucleoprotein C on cleavage and polyadenylation. Genome Res. 26, (8), 1145-1159 (2016).
  8. Lingner, J., Keller, W. 3'-end labeling of RNA with recombinant yeast poly(A) polymerase. Nucleic Acids Res. 21, (12), 2917-2920 (1993).
  9. Quail, M. A., Kozarewa, I., et al. A large genome center's improvements to the Illumina sequencing system. Nat. methods. 5, (12), 1005-1010 (2008).
  10. Rahmann, S. Snakemake--a scalable bioinformatics workflow engine. Bioinformatics. 28, (19), 2520-2522 (2012).
  11. Analytics, C. Anaconda Software Distribution. Available from: https://continuum.io (2016).
  12. Lab, H. FASTX-Toolkit - Hannon Lab. Available from: http://hannonlab.cshl.edu/fastx_toolkit/index.html (2017).
  13. Dobin, A., Davis, C. A., et al. STAR: ultrafast universal RNA-seq aligner. Bioinformatics. 29, (1), 15-21 (2013).
  14. Martin, M. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet.journal. 17, (1), 10-12 (2011).
  15. Li, H., Handsaker, B., et al. The Sequence Alignment/Map format and SAMtools. Bioinformatics. 25, (16), 2078-2079 (2009).
  16. Robinson, J. T., Thorvaldsdóttir, H., et al. Integrative genomics viewer. Nat. Biotechnol. 29, (1), 24-26 (2011).
  17. Quinlan, A. R., Hall, I. M. BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics. 26, (6), 841-842 (2010).
  18. Ozsolak, F., Platt, A. R., et al. Direct RNA sequencing. Nature. 461, (7265), 814-818 (2009).
  19. Yao, C., Biesinger, J., et al. Transcriptome-wide analyses of CstF64-RNA interactions in global regulation of mRNA alternative polyadenylation. Proc. Natl. Acad. Sci. U. S. A. 109, (46), 18773-18778 (2012).
  20. Lin, Y., Li, Z., et al. An in-depth map of polyadenylation sites in cancer. Nucleic Acids Res. 40, (17), 8460-8471 (2012).
  21. Shepard, P. J., Choi, E. -A., Lu, J., Flanagan, L. A., Hertel, K. J., Shi, Y. Complex and dynamic landscape of RNA polyadenylation revealed by PAS-Seq. RNA. 17, (4), 761-772 (2011).
  22. Fu, Y., Sun, Y., et al. Differential genome-wide profiling of tandem 3' UTRs among human breast cancer and normal cells by high-throughput sequencing. Genome Res. 21, (5), 741-747 (2011).
3' Ende Sequenzierung Bibliothek Vorbereitung mit A-seq2
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Martin, G., Schmidt, R., Gruber, A. J., Ghosh, S., Keller, W., Zavolan, M. 3' End Sequencing Library Preparation with A-seq2. J. Vis. Exp. (128), e56129, doi:10.3791/56129 (2017).More

Martin, G., Schmidt, R., Gruber, A. J., Ghosh, S., Keller, W., Zavolan, M. 3' End Sequencing Library Preparation with A-seq2. J. Vis. Exp. (128), e56129, doi:10.3791/56129 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter