Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

A-seq2 के साथ 3 ' अंत अनुक्रमण पुस्तकालय की तैयारी

doi: 10.3791/56129 Published: October 10, 2017

Summary

इस प्रोटोकॉल पूर्व mRNA 3 ' अंत प्रसंस्करण साइटों मानचित्रण के लिए एक विधि का वर्णन ।

Abstract

पिछले दशक में अध्ययन पूर्व mRNA दरार और polyadenylation प्रतिक्रियाओं के एक जटिल और गतिशील विविधता का पता चला है । mRNAs के साथ लंबे 3 ' unमराठीमध्ये क्षेत्रों (UTRs) विभेदित कोशिकाओं में उत्पन्न कर रहे हैं, जबकि proliferating कोशिकाओं को तरजीही छोटे 3 ' UTRs के साथ टेप व्यक्त. हम एक-seq प्रोटोकॉल का वर्णन, अब अपने दूसरे संस्करण है, जो polyadenylation साइटों जीनोम-चौड़ा नक्शा और पूर्व mRNA 3 ' अंत प्रसंस्करण के विनियमन अध्ययन के लिए विकसित किया गया था पर । इसके अलावा इस मौजूदा प्रोटोकॉल polyadenylate का लाभ लेता है (पाली (एक)) पूंछ है कि सबसे स्तनधारी mRNAs के लिए पूरी तरह से संसाधित mRNAs के लिए समृद्ध की उत्पत्ति के दौरान जोड़ रहे हैं । इसके चौथे स्थान पर deoxyuracil के साथ एक डीएनए अनुकूलक अनुक्रमण के लिए mRNA 3 ' अंत टुकड़े के सटीक प्रसंस्करण की अनुमति देता है । नहीं सेल संस्कृति और रात भर ligations सहित, प्रोटोकॉल के बारे में 8 घंटे के समय पर हाथ की आवश्यकता है । इसके साथ, व्युत्पन्न sequencing डेटा के विश्लेषण के लिए एक आसान करने के लिए उपयोग सॉफ्टवेयर पैकेज प्रदान की जाती है. A-seq2 और संबद्ध विश्लेषण सॉफ़्टवेयर पूर्व-mRNA 3 ' की मैपिंग के लिए एक कुशल और विश्वसनीय समाधान प्रदान करते हैं, जो 106 या कम कक्षों से शर्तों की एक विस्तृत श्रृंखला में समाप्त होता है ।

Introduction

कब्जा और mRNA 3 ' समाप्त होता है के अनुक्रमण mRNA प्रसंस्करण और जीन अभिव्यक्ति के ठहराव के अध्ययन की अनुमति देता है । उनके पॉली (क) मासा होने के कारण युकेरियोटिक mRNAs को मनका-मैटीरियल oligo-deoxythymidine (oligo (dT)) अणु के साथ कुल कोशिका lysates से कुशलतापूर्वक शुद्ध किया जा सकता है, जो सीडीएनए संश्लेषण को भी प्रधानमंत्री कर सकता है. हालांकि, इस approach में दो कमियां हैं । सबसे पहले, एक है कि टेप करने के लिए आंतरिक भी प्रधानमंत्री सीडीएनए संश्लेषण कर सकते हैं, नकली पाली (एक) साइटों में जिसके परिणामस्वरूप के हिस्सों । दूसरा, सजातीय पाली (एक) हिस्सों अनुक्रमण के लिए विशिष्ट चुनौतियों का एक तरफ, प्रतिलिपि पहचान के लिए जानकारीपूर्ण नहीं किया जा रहा से मुद्रा । इन सीमाओं को दरकिनार करने के लिए विभिन्न दृष्टिकोण प्रस्तावित किए गए हैं, जैसे पाली के माध्यम से रिवर्स प्रतिलेखन (क) RNase एच पाचन द्वारा पीछा पूंछ (3P-seq 1), एक कस्टम sequencing प्राइमर का उपयोग 20 Ts में समाप्त (2P-seq 2), के चयन एक घन5टी४५ प्राइमर RNase एच पाचन के द्वारा पीछा (3 ' 3पढ़ता है) के साथ ५० से अधिक न्यूक्लियोटाइड की पूंछ (एक) के साथ आरएनए टुकड़े, और एक oligo-डीटी प्राइमर है कि एक कांटा में 3 ' अनुकूलक (एक-seq 4) शामिल का उपयोग करें ।

हाल ही में विकसित एक-seq2 विधि 5 को पाली (a) के माध्यम से अनुक्रमण बाईपास और एक ही समय में dimers कि स्व द्वारा उत्पंन कर रहे है के अनुपात को कम करने के लिए करना है-बंधाव एडेप्टर, विशेष रूप से होने वाली जब दाढ़ एकाग्रता एडेप्टर संमिलित एकाग्रता को घटाया जाता है । इस समस्या को समाप्त किया जा सकता है जब दोनों एडेप्टर एक ही प्रकार के polynucleotide समाप्त होता है के रूप में एक-seq2 में, जहां 3 ' एडेप्टर आरएनए टुकड़े के 5 ' अंत करने के लिए ligated है और 5 ' एडाप्टर के लिए 5 ' समाप्त होता है के बाद रिवर्स प्रतिलेखन के बाद cDNAs । विधि हमारे पहले प्रस्तावित एक-seq-जिसमें अनुक्रमण 5 '-to-3 ' दिशा में किया गया था से अधिक सुविधाजनक है, जिससे ठीक से नियंत्रित आरएनए विखंडन की आवश्यकता-, जबकि पाली की एक उच्च सटीकता को बनाए रखने (ए) साइट पहचान । के आसपास ८०% अनुक्रम ठेठ नमूने में पढ़ता है जीनोम के लिए विशिष्ट नक्शा और २०,००० से अधिक की पहचान करने के लिए नेतृत्व (एक) साइट क्लस्टर, अधिक से अधिक ७०% जो व्याख्या 3 ' UTRs के साथ अतिव्यापी ।

संक्षेप में, एक-seq2 प्रोटोकॉल mRNA विखंडन और रिवर्स के बंधाव के साथ शुरू होता है, 3 आरएनए टुकड़े के 5 ' समाप्त होता है । पाली (ए) RNAs युक्त तो एक 25 न्यूक्लियोटाइड (nt) लंबे oligo (डीटी) प्राइमर है कि 3 ' अंत में एक लंगर न्यूक्लियोटाइड होता है के साथ लिखित रिवर्स हैं, 4 की स्थिति में एक dU और 5 ' अंत में एक बायोटिन, चुंबकीय streptavidin मोतियों को सीडीएनए के बंधन की अनुमति । के अधिकांश प्राइमर, बायोटिन सहित, ड्यू पर दरार द्वारा सीडीएनए से उपयोगकर्ता एंजाइम मिश्रण से हटा दिया जाता है, युक्त Uracil डीएनए glycosylase (UDG) और डीएनए glycosylase-lyase Endonuclease आठवीं । यह प्रतिक्रिया एक 5 ' एडाप्टर के बंधाव के लिए बरकरार समाप्त होता है, और तीन टीएस दरार के बाद छोड़ दिया पाली (ए) पूंछ के स्थान को चिह्नित करने के लिए रह जाता है । 5 ' और 3 ' एडेप्टर बंधाव प्राप्तकर्ता 5 ' समाप्त होता है के द्वारा अनुलग्न हैं, क्योंकि कोई एडेप्टर dimers उत्पन्न होते हैं । चार न्यूक्लियोटाइड यादृच्छिक-mers पढ़ता की शुरुआत में शुरू की अनुमति देता है राज्य के-the-कला अनुक्रमण उपकरणों पर क्लस्टर संकल्प और भी पता लगाने और पीसीआर प्रवर्धन कलाकृतियों को हटाने के लिए अद्वितीय आणविक पहचानकर्ता (UMI) के रूप में सेवा कर सकते हैं । UMI के आकार को और अधिक के रूप में अंय अध्ययन में किया 6वृद्धि हो सकती है । प्रोटोकॉल पढ़ता है कि mRNA 3 ' समाप्त होता है के लिए पूरक रिवर्स कर रहे हैं उत्पन्न करता है, सभी एक यादृच्छिक tetramer के साथ शुरू 3 टीएस द्वारा पीछा किया. पढ़ता है कि उनके 5 ' अंत में 3 नैदानिक टीएस है के प्रसंस्करण से पीसीआर प्रवर्धन कलाकृतियों के सुधार के साथ प्रारंभ होता है ूमिस का दोहन, 3 अनुकूलक दृश्यों को हटाने, और पूरक रिवर्स । पढ़ता है कि oligo से उत्पंन हो सकता है (डीटी) आंतरिक एक संपंन साइटों पर भड़काना भी गणना की पहचान कर रहे है और खारिज कर दिया । नकली साइटों को आम तौर पर 18 की कमी अच्छी तरह से एक विशेषता है और पाली (एक) संकेत है जो स्थित होना चाहिए ~ 21 न्यूक्लियोटाइड स्पष्ट दरार साइट 7के ऊपर) ।

प्रोटोकॉल के बारे में 8 एच हाथ समय पर की आवश्यकता है, गिनती सेल संस्कृति और रातोंरात ligations नहीं है । संबद्ध पठन विश्लेषण सॉफ़्टवेयर एक अत्यधिक सटीक पाली (a) साइट पहचान सक्षम करता है । पाली से (क) साइट पर 4 नमूनों के आधार पर बनाई गई समूहों आगे इस पांडुलिपि में प्रकाश डाला (नियंत्रण सिरना और si-HNRNPC-इलाज कोशिकाओं के दो जैविक प्रतिकृति) ८४% एक व्याख्या की जीन के साथ ओवरलैप, और इनमें से, ७५% एक 3 ' UTR के साथ ओवरलैप, और ८६% के साथ या तो एक 3 ' UTR या एक टर्मिनल एक्सॉन । पियरसन सहसंबंध गुणांक की अभिव्यक्ति का ' 3 की प्रतिकृति नमूने में समाप्त होता है ०.९२, और ०.९ से अधिक के मान सामांयतया विधि के साथ प्राप्त होते हैं । इस प्रकार, एक-seq2 एक सुविधाजनक तरीका है कि बहुत प्रतिलिपि परिणाम देता है ।

Protocol

< p class = "jove_title" > 1. सेल ग्रोथ और mRNA आइसोलेशन

  1. अपने प्रयोगात्मक डिजाइन के अनुसार कोशिकाओं को विकसित 6-well प्लेट्स करने के लिए ~ 1 x 10 6 कोशिकाओं प्रति अच्छी तरह से ८०% संगम पर ।
  2. विकास मध्यम निकालें और एक बार फॉस्फेट बफर खारा के साथ कोशिकाओं को धोने । सीधे प्लेट पर mRNA-आइसोलेशन किट से lysis बफर की 1 मिलीलीटर जोड़कर कोशिकाओं को लाइसे । एक 1 मिलीलीटर पिपेट टिप के साथ एक 15 मिलीलीटर प्लास्टिक ट्यूब में चिपचिपा lysate स्थानांतरण । पूरी तरह से प्लेट की सतह से सेल सामग्री को अलग करने के लिए एक रबर रंग का प्रयोग करें ।
  3. कतरनी एक 1 मिलीलीटर के साथ चिपचिपा डीएनए युक्त lysate एक 23 ग्राम hypodermic सुई से जुड़ी कई जोरदार ऊपर और नीचे आंदोलनों सवार जब तक lysate अब चिपचिपा है । नीचे के केंद्र के लिए सिरिंज सुई बिंदु ट्यूब से बाहर lysate बाहर निकालने से बचने के लिए.
  4. एक १.५ मिलीलीटर ट्यूब सिरिंज का उपयोग में lysate हस्तांतरण । स्पिन 5 मिनट पर २०,००० x g और 4 & #176; C मलबा हटाने के लिए । प्रोटोकॉल भर में डीएनए कम बांध १.५ मिलीलीटर शीशियों का उपयोग करें.
  5. जबकि केंद्रापसारक चल रहा है, धो ३०० & #181; reसस्पैंड oligo (dT) के 25 चुंबकीय मोतियों के साथ एक चुंबकीय रैक पर ५०० & #181; lysis बफर के एल । मिश्रण ट्यूबों रैक पर 2-3 बार । समाधान साफ़ होने के बाद बफ़र को निकालें । १.४ कदम से स्पष्ट supernatant लीजिए और मोतियों को जोड़ें । reसस्पेंड और 10 मिनट के लिए एक घूर्णन पहिया पर ट्यूबों जगह
  6. एक चुंबकीय रैक पर ट्यूबों जगह है । 2 मिनट के बाद स्पष्ट तरल निकालें । mRNA-आइसोलेशन किट से ०.८ मिलीलीटर बफर A जोड़ें । बारी ट्यूब द्वारा १८० & #176; रैक पर डिग्री, 2-3 बार । इस धुलाई कदम एक बार और बफर A.
  7. के साथ दोहराएं
  8. धो मोती 2 बार १.६ चरण में वर्णित के रूप में बफर बी की ०.८ मिलीलीटर के साथ ।
  9. को मोतियों से बंधे mRNA को elute, जोड़ ३३ & #181; L ज 2 हे और मोतियों को फिर से सस्पेंड कर दो. ७५ के लिए हीट & #176; सी के लिए 5 मिनट एक गर्म ब्लॉक पर । तुरंत 1 एस के लिए ट्यूबों स्पिन और उंहें चुंबकीय रैक पर जगह है । supernatant एक नई ट्यूब के लिए स्थानांतरण । नमूनों पर संग्रहित किया जा सकता है-८० & #176; C आगे जब तक उपयोग.
  10. Add ६६ & #181; l क्षार hydrolysis बफर को ३३ & #181; l mRNA (चरण १.८), मिश्रण और हीट के लिए ठीक 5 मिनट पर ९५ & #176; C पर एक हीटिंग ब्लॉक. तुरंत बर्फ पर चिल ट्यूबों.
  11. एक आरएनए सफाई किट के साथ आरएनए अलग.
    नोट: खंड की पुष्टि करें; यह होना चाहिए १०० & #181; L.
    1. Add ३५० & #181; किट से l RLT बफर और २५० & #181; l इथेनॉल । स्तंभ पर लोड और 30 एस के लिए स्पिन कमरे के तापमान (आरटी) में ८,००० x g पर । किट से ५०० & #181; L RPE बफर से धोएं । धो के साथ ५०० & #181; L ८०% इथेनॉल. २०,००० x जी पर 5 मिनट के लिए स्पिन कॉलम सूखी । जोड ३६ & #181; ल H 2 O को कॉलम और स्पिन के लिए 1 मिनट में २०,००० x g । कॉलम त्यागें और eluate को बचाएं.
< p class = "jove_title" > 2.5 & #39; समा फास्फारिलीकरण व DNase उपचार

  1. Add 5 & #181; l polynucleotide कळेनासे बफर, 5 & #181; l 10 mM एटीपी, 1 & #181; l ribonuclease अवरोधक, 1 & #181; l DNase व 2 & #181; l polynucleotide कळेनासे नमूनों और मशीन पर ३७ & #176; ग के लिए 30 min. वैकल्पिक रूप से तैयार मास्टर रिएक्शन प्रत्येक घटक के १.१ संस्करणों x n (n = नमूनों की संख्या) मिश्रण से प्रोटोकॉल भर में घोला जा सकता है.
  2. परिवर्तन बफर और अगले चरण में पाली (एक) को रोकने के लिए एक स्पिन-कॉलम पर एटीपी निकालें.
    1. स्पिन-कॉलम ७३५ x g पर 1 मिनट के लिए कॉलम नई १.५ मिलीलीटर शीशियों के लिए स्थानांतरण और स्तंभों पर कळेनासे प्रतिक्रियाओं लोड । ७३५ x पर कॉलम 2 मिनट स्पिन कॉलम त्यागें और बर्फ या स्टोर पर एकत्र प्रतिक्रियाओं के साथ ट्यूबों जगह-८० & #176; C.
< p class = "jove_title" > 3. blocking 3 & #39; Cordycepin के साथ समाप्त होता है ट्राइफॉस्फेट

< p class = "jove_content" > नोट: यह 3 & #39 को ब्लॉक करने के लिए आवश्यक है; आरएनए अंशों के सिरों को बाद में बंधाव प्रतिक्रियाओं में उनके concatemerization से बचने के लिए । 3 & #39; समाप्त होता है जो पहले से अवरोधित नहीं है एक ( चक्रीय) फास्फेट के बाद hydrolysis एक 3 & #39 के अलावा द्वारा इलाज कर रहे हैं; dATP (cordycepin ट्राइफॉस्फेट) चेन टर्मिनेटर न्यूक्लियोटाइड की सहायता से पाली (क) पोलीमरेज़. यहां, खमीर पाली (क) पोलीमरेज़ (yPAP), कि व्यक्त की और शुद्ध < सुप वर्ग में वर्णित के रूप में = "xref" > 8 ०.५ मिलीग्राम/एमएल की एकाग्रता में इस्तेमाल किया गया था । खमीर या ई. कोलाई पीएपी दोनों 3 & #39;d एटीपी के अलावा के लिए लगभग एक ही गतिविधि है और व्यावसायिक रूप से खरीदा जा सकता है (सामग्री की तालिका देखें) ।

  1. Add १३.५ & #181; l 5x केंद्रित पाली (क) पोलीमरेज़ प्रतिक्रिया बफर, २ & #181; l के 10 एमएम 3 & #39; dATP, 1 & #181; l RNase अवरोधक और 1 & #181; l पाली (क) पोलीमरेज़ से कदम 2.2.1 की प्रतिक्रिया. मिश्रण और स्पिन 1 एस के लिए ३७ & #176; C के लिए 30 min. Add ३२.५ & #181; L ज 2 हे प्रत्येक प्रतिक्रिया. चरण 1.10.1 के रूप में आरएनए शुद्ध । 14 & #181 के साथ आरएनए Elute; L ज 2 ओ.
< p class = "jove_title" > 4. रिवर्स 3 & #39 का बंधाव; एडाप्टर 5 & #39; आरएनए अंशों का अंत

  1. एक निर्वात संकेंद्रक में प्रतिक्रियाओं को 10 मिनट के लिए मात्रा को कम करने के लिए 6 & #181; l 3 & #181 जोड़ें; l 10x टी-4 आरएनए बंधाव बफर, 3 & #181; l 10 एमएम एटीपी , 15 & #181; L खूंटी & #173;-८०००, 1 & #181; l RNase अवरोधक, 1 & #181; l का ०.१ mM रिवर्स पूरक 3 & #39; एडेप्टर & #34; revRA3 & #34; (सामग्री की तालिका देखें) और 1 & #181; l उच्च एकाग्रता आरएनए ligase 1, mix.
  2. 24 & #176 पर प्रतिक्रियाओं के साथ आंतरायिक मिश्रण के साथ एक गर्म मिक्सर पर 16 ज के लिए सी १,००० rpm । Add ७० & #181; L ज 2 हे ते प्रत्येक रिएक्शन आणि मिक्स करा. चरण 1.10.1 के रूप में आरएनए शुद्ध । 14 & #181 के साथ आरएनए Elute; ल H 2 O. नमूनों पर संग्रहित किया जा सकता है-८० & #176; C इस बिंदु पर.
< p class = "jove_title" > 5. रिवर्स प्रतिलेखन (RT)

  1. वॉल्यूम को कम करने के लिए 3 मिनट के लिए एक वैक्यूम संकेंद्रक में eluates को जगह 11 & #181; l. स्थानांतरण प्रतिक्रियाओं को २०० & #181; l पीसीआर ट्यूबों. Add 1 & #181; L ०.०५ mM RT प्राइमरी & #34; Bio-dU-dT25 & #34;. ७० में 5 मिनट के लिए हीट & #176; सी एक पीसीआर साइकिल चालक में और 5 मिनट के लिए आर टी पर छोड़
  2. Add 1 & #181; l 10 mM dNTPs, 4 & #181; l 5x रिवर्स transcriptase बफर, 1 & #181; l ०.१ M डीटीटी, 1 & #181; l RNase अवरोधक, व 1 & #181; l उलट transcriptase. मिश्रण और 10 मिनट के लिए प्रतिक्रियाओं को गर्मी ५५ & #176; सी और 10 मिनट के लिए ८० & #176; सी एक पीसीआर साइकिल चालक में । बर्फ पर या पर रखें-८० & #176; ग लंबे समय तक भंडारण के लिए.
< p class = "jove_title" > 6. Uracil डीएनए के साथ पाचन Glycosylase एंजाइम मिक्स

  1. प्लास्टिक १०० & #181; L Streptavidin-मोतियों को एक १.५ मिलीलीटर की शीशी में डालकर फिर से सस्पेंड ८०० & #181; एल बायोटिन बाध्यकारी बफर और एक चुंबकीय रैक पर जगह है । पलटन ट्यूबों 2-3 बार । बफ़र साफ़ करते समय निकालें । धुलाई कदम दोहराएं । २०० में मोतियों को फिर से सस्पेंड & #181; L बायोटिन बाइंडिंग बफ़र.
  2. मोती समाधान के लिए रिवर्स प्रतिलेखन प्रतिक्रिया जोड़ें और 4 & #176 पर 20 मिनट की मशीन एक घूर्णन पहिया पर सी; धोने के रूप में कदम ६.१ और 2x एक चुंबकीय रैक पर दस बफर के साथ के रूप में बायोटिन बाध्यकारी बफर के साथ 2x मोती । ५० में मोतियों का रिसस्पेंड & #181; l दस बफर, जोड़ 2 & #181; l Uracil डीएनए glycosylase एंजाइम मिक्स, और मशीनी 1 ज पर ३७ & #176; C एक मिक्सर में आंतरायिक मिश्रण के साथ.
  3. Add ५० & #181; l ज 2 O, 11 & #181; l के RNase H बफर व 1 & #181; l RNase h त प्रतिक्रियाओं को. ३७ पर मशीन & #176; सी के लिए 20 min. Place ट्यूबों एक चुंबकीय रैक पर और एक नई ट्यूब करने के लिए सट सीडीएनए युक्त तरल हस्तांतरण
  4. शुद्ध सट सीडीएनए.
    1. Add ५५० & #181; पीसीआर शोधन किट से बफर पीबी के दरार प्रतिक्रियाओं को एल । इसमें 10 & #181; 3 एम सोडियम एसीटेट की एल, पीएच ५.२ कम करने के लिए पीएच । प्रतिक्रियाओं को लोड पर मिनिमल रेफरेंस स्पिन कॉलम और स्पिन के लिए १७,००० x g पर 1 min.
    2. Add ७५० & #181; L बफर पे कॉलम और स्पिन के लिए १७,००० x g पर 1 min. प्रवाह के माध्यम से त्यागें । शुष्क करने के लिए 1 मिनट के लिए १७,००० x g पर कॉलम स्पिन । स्तंभों को एक १.५ मिलीलीटर की शीशी में स्थानांतरित करें, 16 & #181 जोड़ें; एल एच 2 ओ और स्पिन 1 मिनट के लिए १७,००० x g पर । 8 मिनट के लिए एक वैक्यूम संकेंद्रण में प्रतिक्रियाओं प्लेस 7 & के एक खंड के लिए ध्यान दें #181; L.
< p class = "jove_title" > 7. बंधाव 5 & #39; एडेप्टर 5 & #39 के लिए, अलग सीडीएनए को सीडीएनए

  1. के छोर, add 3 & #181; l 10x टी-4 आरएनए ligase 1 बफर, 3 & #181; l 10 एमएम एटीपी, 15 & #181; l खूंटी & #173;-८०००, 1 & #181; l ५० & #181; म & #34; revDA5 & #34; oligo , व 1 & #181; L उच्च एकाग्रता टी-4 आरएनए ligase 1. पर गर्मी म 24 & #176; ग के लिए 20 ज. Add ७० & #181; ल h 2 हे येक प्रतिक्रिया. नमूनों को इस बिंदु पर-20 & #176; C में संग्रहित किया जा सकता है ।
< p class = "jove_title" > 8. पायलट पीसीआर, पुस्तकालयों और आकार के चयन का प्रवर्धन

  1. एक पायलट प्रतिक्रिया में, घातीय चरण के भीतर पुस्तकालय प्रवर्धन तक पहुंचने के लिए पीसीआर चक्र की इष्टतम संख्या का निर्धारण ।
    1. प्लास्टिक 25 & #181; L डीएनए पोलीमरेज़ mix, 20 & #181; l बंधाव प्रतिक्रिया, 2 & #181; l ज 2 O, १.५ & #181; l 10 & #181; मी फॉरवर्ड पीसीआर प्राइमरी (RP1) और १.५ & #181; l 10 & #181; मी रिवर्स पीसीआर इंडेक्स प्राइमरी में २०० & #181; l पीसीआर ट्यूब.
    2. निंनलिखित कार्यक्रम के साथ साइकिल चलाना: 3 min ९५ & #176; सी, 20 एस के 20 चक्र के बाद ९८ & #176; ग, 20 s ६७ & #176; ग र 30 स s ७२ & #176; ग. कलेक्ट 7 & #181; L aliquots 6, 8, 10, 12, 14, 16 और 18 चक्र के बाद सीधे साइकिल चालक से । Add 1 & #181; L 10x लोडिंग बफर (५०% ग्लिसरॉल, ०.०५% xylene cyanol). नोट: बारकोड संयोजन जब मल्टीप्लेक्स का उपयोग कर अगर आपूर्तिकर्ता की सिफारिशों का पालन करें.
    3. एक 1 से युक्त 1x TBE बफर में 2% agarose जेल पर छोटे स्लॉट में अलग उत्पादों: 10, 00 फ्लोरोसेंट हरी डाई के कमजोर पड़ने ।
      1. लोड aliquots पर एक 2% agarose जेल और चलाने के लिए १०० वोल्ट पर जेल प्रलेखन प्रणाली पर पीसीआर उत्पादों के 15 min. visualize माइग्रेशन के लिए.
  2. पायलट प्रतिक्रिया के लिए इस्तेमाल के रूप में दो बार संस्करणों के साथ एक बड़े पैमाने पर पीसीआर प्रतिक्रिया के लिए पायलट प्रतिक्रिया में घातीय प्रवर्धन की शुरुआत में चक्र की संख्या का उपयोग करें (< सबल वर्ग = "xfig" > चित्रा २ ).
    1. बड़े पैमाने पर पीसीआर प्रतिक्रियाओं के लिए, ध्यान केंद्रित करने और एक पीसीआर शोधन किट के साथ पहले प्रतिक्रियाओं और नमक 1x TBE बफर में 2% agarose जैल पर वाइड स्लॉट पर उत्पादों को अलग ।
  3. 200-350 nt डीएनए उत्पादों से युक्त जेल स्लाइसें काट बाहर । 30 मिनट तक के लिए RT पर chaotropic बफर में जेल पिघला । एक जेल निष्कर्षण किट के साथ जेल स्लाइस से डीएनए निकालें । को आँच न ५० & #176; ग एक-अमीर डीएनए के बंधन में पूर्वाग्रह को रोकने के लिए < सुप वर्ग = "xref" > ९ .
  4. sequencing के लिए सबमिट करें ।
    नोट: सामान्यतया, ५० चक्र एकल-पठन (SR50) पर्याप्त हैं (देखें, जैसे , https://www.illumina.com/technology/next-generation-sequencing.html के लिए).
< p class = "jove_title" > 9. डाटा प्रोसेसिंग

< p class = "jove_content" > नोट: परिणामी sequencing डेटा (fastq स्वरूप में) gitlab रिपॉसिटरी (https://git.scicore.unibas.ch/zavolan_public/A-seq2-processing) में उपलब्ध सॉफ़्टवेयर के साथ संसाधित किए जाते हैं । विश्लेषण में चार मुख्य चरण शामिल हैं: (1) git भंडार डाउनलोड करना, (2) एक आभासी वातावरण की स्थापना, (3) विंयास फाइल में विशिष्ट मापदंडों को स्थापित करना और (4) & #8216 के माध्यम से विश्लेषण का शुभारंभ; snakemake & #8217; < सुप वर्ग = "xref" > 10 . पूरे चरण 4 में किया विश्लेषण केवल एक आदेश की आवश्यकता है । विश्लेषण का एक विस्तृत चरण दर चरण वर्णन gitlab रिपॉसिटरी में रीडमी फ़ाइल में पाया जा सकता है और एक संक्षिप्त वर्णन नीचे उपलब्ध है । सभी व्यक्तिगत संसाधन कदम सार्वजनिक रूप से उपलब्ध उपकरणों के निष्पादन के द्वारा पूरा कर रहे हैं, या तो बाहरी स्रोतों से या घर में तैयार । गणना पाइप लाइन एक एनाकोंडा आधारित < सुप वर्ग पर निर्भर करता है = "xref" > 11 अजगर 3 आभासी पर्यावरण snakemake पैकेज के साथ उपलब्ध < सुप वर्ग = "xref" > १० . यह Unix के साथ मशीनों पर चलाता है ऑपरेटिंग सिस्टम की तरह है और CentOS ६.५ ऑपरेटिंग सिस्टम स्थापित और ४० जीबी रैम उपलब्ध के साथ एक Linux के वातावरण में परीक्षण किया गया । सॉफ़्टवेयर निर्भरताएं स्वचालित रूप से वर्चुअल परिवेश के भीतर नियंत्रित होती हैं । निंन सार्वजनिक रूप से उपलब्ध सॉफ़्टवेयर उपकरण आवश्यक है और इस प्रकार वातावरण के साथ स्थापित है: snakemake (v 3.9.1) < सुप class = "xref" > 10 , fastx youth (v 0.0.14) < सुप क्लास = "xref" > 12 , STAR (v 2.5.2 a) < सुप क्लास = "xref" > 13 , cutadapt (v 1.12) < सुप class = "xref" > 14 , samtools (v 1.3.1) < सुप class = "xref" > 14 , < सुप class = "xref" > 15 , bedtools (v 2.26.0) < सुप class = "xref" > 16 , < सुप class = "xref" > 17 .

  1. डाटा प्री-प्रोसेसिंग से पढ़ता है cDNAs
    नोट: sequencing गहराई चलता है और, साधन के आधार पर के बीच भिन्न हो सकते हैं, एक नमूना से डेटा एकाधिक अनुक्रम फ़ाइलों पर विभाजित किया जा सकता है । यदि यह स्थिति है, तो निंन चरणों में उपयोग किया जाता है जो किसी एकल इनपुट फ़ाइल में एक नमूना के लिए संगत फ़ाइलों को श्रेणीबद्ध करें ।
    1. फ़ाइल fastq से फसता स्वरूप में कनवर्ट करें ।
    2. निकालें एक सही संरचना के साथ पढ़ता है (5 पदों पर 3 thymidines, 6 और पढ़ने के 7).
      नोट: एक पढ़ा है कि ऊपर वर्णित प्रयोगात्मक प्रोटोकॉल के अनुसार सही ढंग से तैयार की संरचना होनी चाहिए (से 5 & #39; अंत): 4-न्यूक्लियोटाइड बारकोड-3 thymidines-प्रतिलिपि के पूरक रिवर्स 3 & #39; समा.
    3. अनुक्रम की विवरण पंक्ति में प्रारंभिक tetramer के बारे में जानकारी संग्रहीत है ।
      नोट: tetramer एक अद्वितीय आणविक पहचानकर्ता (UMI) के रूप में कार्य करता है कि प्रवर्धन कलाकृतियों के सुधार की सुविधा के विश्लेषण में बाद में ।
    4. निकाल पहले सात न्यूक्लियोटाइड से पढ & #39; स 5 & #39; समा.
    5. एक ही डालने अनुक्रम और UMI.
    6. के साथ पढ़ता की केवल एक प्रतिलिपि रखकर प्रवर्धन कलाकृतियों के लिए सही
    7. 3 & #39 का भाग निकालें; एडेप्टर अनुक्रम से मेल खाता है और फिर रिवर्स अनुक्रम पूरक । केवल एक न्यूनतम लंबाई (डिफ़ॉल्ट: 15 nt) है पढ़ता के साथ आगे बढ़ें ।
      नोट: मूल mRNA अंश की लंबाई और sequencing चक्रों की संख्या के आधार पर, 3 & #39; पठन के अंत में 3 & #39; एडेप्टर का भाग हो सकता है, जो इस चरण में निकाल दिया गया है.
  2. निकालें सभी पढ़ता है कि निंनलिखित मानदंडों को पूरा: अधिकतम 2 अज्ञात न्यूक्लियोटाइड (& #39; N & #39;), अधिकतम ८०% के रूप में, और पढ़ें एक नहीं के अंतिम न्यूक्लियोटाइड । इन पढ़ता विश्लेषण में उपयोग करने के लिए पर्याप्त गुणवत्ता का होना माना जाता है ।
  3. नक्शा एक उपकरण के साथ जीनोम के लिए पढ़ता है कि ब्याह के हैंडल पढ़ता है और BAM प्रारूप में एक आउटपुट फ़ाइल उत्पंन करता है ।
    1. यदि STAR का उपयोग किया जाता है, तो उस जीनोम के इंडेक्स के साथ एक फ़ाइल बनाएं जिसमें पढ़ता मैप किया जाना चाहिए । मानव जीनोम के लिए, इस कदम के लिए ३५ GB स्मृति (RAM) की आवश्यकता है ।
    2. नक्शे के जीनोम को पढ़ता है.
      नोट: (STAR-विशिष्ट नोट्स) सॉफ्ट-कतरन अक्षम है ताकि 3 & #39 की मैपिंग को बाध्य किया जा सके; प्रत्येक पढ़ने के अंत के रूप में यह है न्यूक्लियोटाइड तुरंत दरार साइट के ऊपर ।
  4. BAM एक बिस्तर-फ़ाइल में कनवर्ट करें । यदि एक से अधिक स्थानों के लिए नक्शे पढ़ें, केवल सबसे कम दूरी संपादित करें के साथ उन रखें ।
    नोट: एक विशिष्ट स्थान पर मैप की गई पढ़ने की प्रतिलिपि संख्या स्कोर के रूप में उपयोग किया जाता है । पढ़ता है कि कई स्थानों के लिए नक्शे आंशिक रूप से एक 1 के बराबर वजन के साथ प्रत्येक स्थान पर गिने जाते हैं/
  5. संक्षिप्त किसी संभावित sequencing त्रुटि के द्वारा भिंन पढ़ता है । यदि दो अलग पढ़ता एक ही स्थान के लिए नक्शा (मैपिंग की शुरुआत और अंत स्थिति समान हैं) और वे एक ही UMI साझा, उन्हें पीसीआर डुप्लिकेट के रूप में विचार और केवल एक रखना.
  6. अनुमान केलेली वैयक्तिक प्री-mRNA ३ & #39; end processing sites.
    नोट: एक व्यक्ति पढ़ें एक 3 के लिए सबूत प्रदान करता है & #39; अंत जब उसके पिछले चार न्यूक्लियोटाइड त्रुटि के जीनोम के लिए मैप किए जाते हैं । जिस स्थिति को 3 & #39; पठन मानचित्रों के अंत को क्लीवेज साइट के रूप में संग्रहित किया जाता है ।
  7. का पता लगाने 3 & #39; अंत साइटों है कि आंतरिक भड़काना से उत्पंन हो सकता है । आंतरिक भड़काना विरूपण साक्ष्य के रूप में साइट को परिभाषित करें जब जीनोम में दरार साइट के 10 nt बहाव निंन मानदंडों में से एक को संतुष्ट: के रूप में छह से अधिक शामिल है, के रूप में लगातार छह शामिल हैं, या निंनलिखित tetramers में से एक के साथ शुरू होता है: AAAA, AGAA, AAGA, AAAG .
  8. अलग 3 & #39 के एक तालिका उत्पंन; बिस्तर प्रारूप में प्रसंस्करण साइटों को समाप्त ।
  9. स्वतंत्र रूप से विनियमित पाली (ए) साइट समूहों की पहचान ।
    नोट: यहाँ बताए गए चरणों का पालन करें प्रक्रिया एक पूर्व प्रकाशन में प्रस्तुत किया गया था < सुप वर्ग = "xref" > ५ . व्यक्तिगत 3 & #39 एकत्रित कर
    1. प्रारंभ करें; समाप्त प्रोसेसिंग साइटों है कि अध्ययन के सभी नमूनों में प्राप्त किया गया ।
    2. व्याख्या चचा पाली (क) संकेत < सुप वर्ग = "xref" > 7 के क्षेत्र में-६० से + 10 न्यूक्लियोटाइड के आसपास प्रत्येक व्यक्ति 3 & #39; अंत संसाधन साइट.
    3. की पहचान पाली (क) के रूप में प्रत्येक नमूने में पृष्ठभूमि के ऊपर व्यक्त की साइटों निंनानुसार है ।
      1. मौजूदा नमूना के भीतर उनके कच्चे अभिव्यक्ति के द्वारा साइटों को क्रमबद्ध करें । ऊपर से नीचे तक साइटों की सूची को पार, एक उच्च रैंक साइट के साथ कम क्रमित साइटों को जोड़ अगर वे जीनोम में एक पूर्वनिर्धारित दूरी के भीतर स्थित है (डिफ़ॉल्ट: 25 nt अप-या बहाव) उच्च रैंकिंग साइट से ।
        नोट: सभी कम रैंकिंग एक उच्च रैंकिंग साइट के साथ जुड़े साइटों को परिभाषित एक क्लस्टर जिसका अभिव्यक्ति की संख्या है इन साइटों के सभी दस्तावेजीकरण पढ़ता है ।
      2. अभिव्यक्ति द्वारा इन क्लस्टर सॉर्ट करें और क्लस्टर्स की सूची को उच्चतम से सबसे कम व्यंजक में ट्रैवर्स, व्यंजक थ्रेशोल्ड c का निर्धारण, जिस पर एक पूर्वनिर्धारित थ्रेशोल्ड के नीचे एक व्याख्या पाली (a) संकेत के साथ क्लस्टर का प्रतिशत ( डिफ़ॉल्ट: ९०%).
      3. कटऑफ के नीचे किसी भी क्लस्टर से साइटें छोड़ें ।
    4. क्लस्टर बारीकी से स्पेसेड 3 & #39; अंत नमूनों में प्राप्त साइटें.
      नोट: सॉर्ट 3 & #39; पहले नमूने की संख्या द्वारा और फिर सामान्यीकृत पठन गणना (प्रति दस लाख (RPM)) नमूनों में पढ़ता का योग द्वारा संसाधन साइटों को समाप्त । उच्च रैंक वाली साइट से उनकी दूरी किसी पूर्वनिर्धारित सीमा (डिफ़ॉल्ट: 12 nt) से बड़ी नहीं है, जब शीर्ष से नीचे तक की सूची को नीचे की ओर, उच्च-स्थान वाली साइटों से जोड़कर । जब भी कोई गठन 3 & #39; अंत साइट एक व्याख्या पाली (क) संकेत के साथ ओवरलैप या एक पाली (एक) संकेत सीधे बहाव है, इसी क्लस्टर आगे निरीक्षण के लिए आंतरिक भड़काना का पता लगाने के लिए चिह्नित है ।
    5. मर्ज पाली (A) साइट clusters.
      नोट: जब एक क्लस्टर एक ख्यात आंतरिक भड़काना उंमीदवार के रूप में चिह्नित किया गया है, यह या तो एक बहाव क्लस्टर में विलय कर दिया है अगर दो समूहों को उनके पाली (एक) संकेतों को साझा या बनाए रखा है, तो क्लस्टर में सबसे अनुप्रवाह साइट एक पाली (एक) संकेत एक ंयूनतम पर स्थित है दूरी ऊपर (डिफ़ॉल्ट: 15 nt) । अंत में, बारीकी से रिक्ति क्लस्टर यदि मर्ज किए गए हैं: (i) वे एक ही पाली (A) संकेत (s) साझा, या (ii) परिणामी क्लस्टर की अवधि एक अधिकतम (डिफ़ॉल्ट: 25 nt) से अधिक नहीं है ।
    6. सभी 3 & #39 से कुल सामान्यीकृत पढ़ें गिनती के साथ बिस्तर फ़ाइल स्वरूप में
    7. स्टोर क्लस्टर; स्कोर के रूप में प्रत्येक क्लस्टर में अंत साइटों ।

Representative Results

पाली (ए)-आरएनए युक्त-कल्चरल कोशिकाओं से पृथक किया गया, क्षारीय hydrolysis द्वारा खंडित और cDNAs oligo (डीटी) प्राइमरों के साथ रिवर्स प्रतिलेखन द्वारा किए गए थे । परिणामस्वरूप सीडीएनए streptavidin मोतियों पर मैटीरियल था, dU uracil विशिष्ट उत्पाद शुल्क प्रतिक्रिया में सट गया था, एडेप्टर 5 ' और 3 ' के सिरों के लिए ligated थे सट टुकड़ा और आवेषण अनुक्रम किया गया था । आरेख 1 प्रयोग की ग्राफ़िकल बाह्यरेखा को दर्शाया गया है ।

हेला और HEK293 कोशिकाओं के लिए, 106 कोशिकाओं को प्रोटीन के विशाल बहुमत की प्रक्रिया के अंत में जीन कोडिंग के लिए पाली (क) साइटों की पहचान करने के लिए पर्याप्त थे । हालांकि, अन्य सेल प्रकार या ऊतकों के लिए यह पहचान पाली की संख्या में संतृप्ति परीक्षण करने के लिए आवश्यक हो सकता है (ए) साइटों की संख्या के रूप में प्रयोग बढ़ जाती है में इस्तेमाल किया. पायलट पीसीआर के प्रतिनिधि परिणाम चरण और sequencing से पहले नमूने के डीएनए टुकड़ा विश्लेषण के चित्रा 2में दिखाए जाते हैं ।

चित्रा 3 गणनात्मक विश्लेषण के पूर्व प्रसंस्करण कदम से पता चलता है, sequencer से प्राप्त fastq फ़ाइल से शुरू और गुणवत्ता की जांच की, अनुकूलक ट्रिम कर दिया है कि जीनोम के लिए मैप किया जा करने के लिए तैयार कर रहे हैं पढ़ता के साथ समाप्त. चित्रा 4 विश्लेषण कदम है कि एक विशेष नमूना में पहचान कर रहे हैं mRNA 3 ' अंत प्रसंस्करण साइटों की सूची के साथ इसी जीनोम और अंत करने के लिए पढ़ता के मानचित्रण के साथ शुरू से पता चलता है. जब कई नमूनों का विश्लेषण कर रहे हैं, अतिरिक्त कदम बाहर किया जाता है 3 ' अंत प्रसंस्करण साइटों है कि व्यक्तिगत नमूनों में पाया गया और नमूनों भर में उनकी बहुतायत रिपोर्ट से मेल करने के लिए । ये चरण चित्र 5में दिखाए जाते हैं ।

इस प्रकार, एक बार नमूनों अनुक्रम किया गया है, परिणामी sequencing पढ़ें फ़ाइलें (fastq प्रारूप में) के माध्यम से उपलब्ध प्रसंस्करण पाइपलाइन के विश्लेषण सीधा है । नमूने के बारे में जानकारी को कॉन्फ़िगरेशन फ़ाइल में जोड़ने के बाद, पाइपलाइन का निष्पादन आउटपुट फ़ाइलों के दो मुख्य प्रकार में परिणाम होगा: 1) बिस्तर-सभी 3 ' अंत प्रसंस्करण व्यक्तिगत नमूनों में पहचान की साइटों के साथ फ़ाइलें (उदा. नमूना 1.3 psites. noIP. bed. gz "), और 2) सभी पाली (ए) साइट क्लस्टर (क्लस्टर्स. विलय. बिस्तर) के साथ एक बिस्तर फ़ाइल अध्ययन के सभी नमूनों में । आउटपुट भी सभी के लिए जीनोम निर्देशांक शामिल है प्रत्येक व्यक्ति के नमूने से पढ़ता (उदा sample1 । STAR_out/संरेखित. sortedByCoord. out. bam ") जिसे बाद में IGV16जैसे जीनोम ब्राउज़र में देखा जा सकता है । पढ़ें प्रोफ़ाइल (ओं) के दृश्य निरीक्षण आम तौर पर पाली के वितरण की पहली झलक प्रदान करता है (a) जीनोम में साइटों और परिवर्तन है कि विशिष्ट perturbations है कि अध्ययन में किए गए थे पर होते हैं । उदाहरण के लिए, चित्रा 6 में HNRNPC प्रोटीन की दस्तक नीचे करने के लिए एक विशिष्ट जीन की प्रतिक्रिया दिखाया गया है ।

इन जीनोम-वाइड वितरण के सारांश भी प्रदान की जाती है (तालिका 1) । विशेष रूप से, "counts/annotation_overlap" निर्देशिका में आउटपुट फ़ाइलें (इनपुट के रूप में प्रदान की gtf फ़ाइल से) विशिष्ट व्याख्या सुविधाओं के साथ ओवरलैप साइटों के भिन्न होते हैं; व्याख्या कर रहे हैं: 3 ' UTR, टर्मिनल एक्सॉन, एक्सॉन, intron, intergenic) । अंत में, प्रत्येक नमूने के लिए, व्यक्तिगत संसाधन चरणों के परिणाम भी सहेजे जाते हैं (उदा. "sample1. समरी. tsv"). यह की संख्या शामिल हैं: रॉ प्रत्येक नमूने में पढ़ता है, कि 5 ' अंत की उंमीद की संरचना है पढ़ता है कि पूरा पीसीआर डुप्लिकेट टूट के बाद रहना, उच्च गुणवत्ता पढ़ता ९.२ कदम पर परिभाषित मानदंडों के अनुसार, पढ़ता है कि नक्शा विशिष्ट जीनोम के लिए (उन है कि sequencing त्रुटियों से परिणाम के बाद, चरण ९.५ देखें), बहु-मानचित्रण पढ़ता (उन है कि sequencing त्रुटियों के परिणामस्वरूप, चरण ९.५ देखें), रॉ (नहीं संकुल) 3 ' अंत प्रसंस्करण साइटों के बाद से गिर के बाद एक नमूना, कच्चे 3 ' अंत प्रसंस्करण साइटों संभावित आंतरिक भड़काना उंमीदवारों के बिना, अद्वितीय 3 ' अंत सभी नमूनों से आंतरिक कण्ठ उंमीदवारों के बिना प्रसंस्करण साइटों, और पाली के अंतिम सेट (एक) साइट समूहों ।

Figure 1
चित्र 1: A-seq2 प्रोटोकॉल का मुख्य चरण. व्यक्तिगत कदम आंकड़ा के बाईं ओर इंगित कर रहे हैं । सम्मिलित करें आरएनए अंशों को हरी रेखाओं के रूप में दर्शाया गया है जो रिवर्स प्रतिलेखन के बाद सीडीएनए के लिए लाल हो जाते हैं; एडाप्टर हल्के नीले या नारंगी रंग में हैं । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 2
चित्रा 2: पायलट पीसीआर और अंतिम उत्पाद प्रोफ़ाइल । () पीसीआर प्रतिक्रिया से Aliquots अलग चक्र पर एकत्र और 2% agarose जैल पर अलग किया गया । बाईं ओर संख्या डीएनए सीढ़ी में संबंधित बैंड के न्यूक्लियोटाइड में आकार का संकेत मिलता है । इस प्रयोग में 12 चक्र (*) बड़े पैमाने पर पीसीआर प्रतिक्रिया के लिए चुना गया था । (b) आकार चयन के बाद एक नमूने का उदाहरण एक टुकड़ा आकार विश्लेषक पर चलाने के आसपास २८० न्यूक्लियोटाइड के एक औसत आकार का खुलासा । बाईं [फू] के लिए संख्या सापेक्ष संकेत तीव्रता संकेत मिलता है । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 3
चित्र 3: अनुक्रमण के पूर्व-संसाधन की बाह्यरेखा पढ़ता है. अनुक्रमण साधन-संबद्ध सॉफ़्टवेयर द्वारा जनरेट किया गया है जो पढ़ता के साथ fastq फ़ाइलें संबंधित जीनोम के लिए मैप की जाएगी जो उच्च-गुणवत्ता पढ़ता की पहचान करने के लिए संसाधित किए जाते हैं । आंकड़ा पाइप लाइन में व्यक्तिगत चरणों के इनपुट/आउटपुट विनिर्देश दिखाता है, खंड में वर्णित प्रोटोकॉल के व्यक्तिगत चरणों के लिंक के साथ "डाटा प्रोसेसिंग" । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 4
चित्रा 4: अनुक्रम की रूपरेखा पढ़ें प्रसंस्करण, अलग 3 ' अंत प्रसंस्करण साइटों की पीढ़ी के जीनोम के लिए मानचित्रण के कदम से । आंकड़ा पाइप लाइन में व्यक्तिगत चरणों के इनपुट/आउटपुट विनिर्देश से पता चलता है, मैं के लिंक के साथअनुभाग "डेटा संसाधन" में वर्णित प्रोटोकॉल के ndividual चरण । मुख्य आउटपुट फ़ाइल उपयोगकर्ता के लिए वितरित किया जाता है जो बोल्ड में चिह्नित किया गया है । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 5
चित्र 5: सह-विनियमित 3 ' अंत अनुक्रमण साइटों के समूहों उत्पन्न करने के लिए उठाए गए चरणों की रूपरेखा. आंकड़ा पाइप लाइन में व्यक्तिगत चरणों के इनपुट/आउटपुट विनिर्देश दिखाता है, खंड में वर्णित प्रोटोकॉल के व्यक्तिगत चरणों के लिंक के साथ "डाटा प्रोसेसिंग" । मुख्य आउटपुट फ़ाइल बोल्ड में चिह्नित किया गया है । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 6
चित्रा 6:3 ' अंत प्रसंस्करण के प्रोफ़ाइल के उदाहरण के परिणाम NUP214 जीन के टर्मिनल एक्सॉन साथ पढ़ता है, IGV 16 जीनोम ब्राउज़र में दिखाया । एक-seq2 पढ़ता HEK २९३ कोशिकाओं के दो नमूनों से तैयार किया गया था, या तो एक नियंत्रण के साथ इलाज-सिरना या एक HNRNPC सिरना के साथ. पढ़ता है जो पाली (A) साइट्स विश्लेषण पाइपलाइन द्वारा व्याख्या थे जो IGV जीनोम ब्राउज़र के लिए इनपुट के रूप में उपयोग किया गया था BAM स्वरूप में सहेजे गए थे । 3 mRNA के लिए पढ़ें चोटियों मानचित्र के समाप्त होता है 3 ' समाप्त होता है कि Ensembl में व्याख्या कर रहे हैं. प्रोफाइल HNRNPC नॉक-डाउन पर लांग 3 ' UTR isoform की एक वृद्धि का उपयोग इंगित करता है । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

si-नियंत्रण प्रतिकृति 1 si-नियंत्रण प्रतिकृति 2
आईडी: २९७६५ आईडी: ३२६८२
अपुष्ट पढ़ता है की संख्या ४४२१०२५८ ६८५७०६४०
ट्रिमिंग और फ़िल्टरिंग के बाद मांय पढ़ता की संख्या १४०२४५३८ २१२११७९३
विशिष्ट मैपिंग पढ़ता की संख्या ६९५३६७४ १३९४६४३६
एकाधिक loci के लिए मैपिंग पढ़ता की संख्या २०४०६४६ २९२५८३९
व्यक्तिगत 3 ' अंत प्रसंस्करण साइटों की संख्या ११०७४९३ १७१०३५३

तालिका 1: विश्लेषण पाइपलाइन का उदाहरण आउटपुट. व्यक्तिगत चरणों में प्राप्त किए गए पढ़ता के सारांश.

Discussion

कोर और सहायक कारकों है कि पूर्व में शामिल है की भीड़-mRNA 3 ' अंत प्रसंस्करण एक तदनुसार जटिल polyadenylation परिदृश्य में परिलक्षित होता है । इसके अतिरिक्त, polyadenylation भी प्रतिलेखन और ब्याह जैसे अंय प्रक्रियाओं में परिवर्तन के लिए उत्तरदाई है । 3 ' अंत में पूर्व दरार साइटों mRNAs आम तौर पर विशेषता पाली के आधार पर पहचाने जाते हैं (एक) पूंछ कि 5 ' दरार उत्पादों के लिए जोड़ रहे हैं. अधिकांश तरीकों oligo (डीटी) चर लंबाई की प्राइमरों का उपयोग करें कि पाली के विशिष्ट रूपांतरण की अनुमति (एक)-एक रिवर्स प्रतिलेखन प्रतिक्रिया में cDNAs को mRNAs युक्त । इस दृष्टिकोण की एक आम समस्या एक-अमीर artifactual दरार साइटों में जिसके परिणामस्वरूप दृश्यों के लिए आंतरिक भड़काने है । दो तरीकों कि नमूना तैयारी के स्तर पर इस विरूपण साक्ष्य दरकिनार उद्देश्य प्रस्तावित किया गया है । 3P-seq विधि 1में, एडाप्टर विशेष रूप से पाली (एक) एक पट्टी आंशिक RNase T1 पाचन और टीटीपी के साथ ही deoxynucleotide के रूप में प्रतिक्रिया में रिवर्स प्रतिलेखन द्वारा पीछा oligo की मदद से पूंछ के छोर करने के लिए ligated हैं । परिणामस्वरूप पाली (ए)-पाली (डीटी) heteroduplexes तो RNase एच के साथ पचा रहे हैं और शेष आरएनए टुकड़े अलग-थलग हैं, एडाप्टर के लिए ligated, और अनुक्रम । एक सरल और सुरुचिपूर्ण विधि, 2P-seq, कि sequencing प्रतिक्रिया में शेष oligo (डीटी) खंड लंघन एक कस्टम अनुक्रमण प्राइमर का उपयोग करता है एक ही लेखक 2द्वारा सूचित किया गया था । एक संबंधित विधि में, 3 ' 3 पढ़ता है, 5 अमेरिका और ४५ टीएस के एक असामांय रूप से लंबे समय से, यह भी युक्त एक बायोटिन खंडित आरएनए के लिए annealed है, कड़े बहाकर द्वारा पीछा किया पाली के साथ आरएनए अणुओं के लिए चयन करने के लिए (एक) ५० से अधिक न्यूक्लियोटाइड की पूंछ । हालांकि 3 ' पढ़ता काफी आंतरिक भड़काना की आवृत्ति को कम कर देता है, यह पूरी तरह से इसे खत्म नहीं करता है 3. प्रत्यक्ष आरएनए अनुक्रमण के लिए प्रोटोकॉल भी प्रस्तावित किया गया है, लेकिन जिसके परिणामस्वरूप पढ़ता कम कर रहे हैं और त्रुटि की एक उच्च दर है और इस दृष्टिकोण आगे विकसित नहीं किया गया है 18,19,20. PolyA-Seq और व्यावसायिक क्वांट Seq प्रोटोकॉल oligo दूसरा किनारा संश्लेषण के लिए एक यादृच्छिक भड़काना कदम के साथ (डीटी) आधारित भड़काने के गठबंधन के लिए 20. टेंपलेट का उपयोग Moloney Murine ल्यूकेमिया वायरस (MMLV) के साथ रिवर्स प्रतिलेखन प्रतिक्रिया स्विच रिवर्स transcriptase एक ही कदम में लिंकर्स के साथ cDNAs की पीढ़ी की ओर जाता है और इस तरह कोई एडेप्टर dimers क़दम-Seq और सापळे तरीकों में दिखाई दे सकते हैं 21 , 22.

एक-seq2 विधि यहां प्रस्तुत एक biotinylated oligo (डीटी) प्राइमर के भीतर एक सट न्यूक्लियोटाइड (dU) के अपने उपयोग में बाहर खड़ा है । इस संशोधन oligo (डीटी) संकर, oligo के अधिकांश को हटाने के साथ polyadenylated लक्ष्यों को समृद्ध करने की उपयोगिता को जोड़ती है (डीटी)25 अनुक्रम अलग टुकड़े से पहले पुस्तकालयों तैयार है और तीन टीएस के संरक्षण, जो पाली (क) पूंछ की पूर्व उपस्थिति का संकेत देते हैं । इसके विपरीत, विधि है कि RNase एच का उपयोग करने के लिए (एक) आरएनए अणु बेतरतीब ढंग से कई के रूप में छोड़ से पाली को दूर करने के लिए । के बाद से एक-seq2, अनुक्रमण विरोधी भावना किस्में के 3 ' अंत से किया जाता है, दरार साइटों की भविष्यवाणी कर रहे है कच्चे अनुक्रम की शुरुआत में NNNNTTT आकृति के बाद स्थित होना पढ़ता है । यादृच्छिक tetramers न केवल आधार फोन पर भी पीसीआर प्रवर्धन कलाकृतियों के उंमूलन में अनुमति देने के लिए सेवा करते हैं । अब ूमिस को भी समाहित किया जा सकता है । आंतरिक भड़काने की संभावना एक-seq2 में रहता है और एक genomically इनकोडिंग, एक अमीर बहाव अनुक्रम और फिर 3 ' अंत समूहों है कि आंतरिक भड़काना द्वारा समझाया जा सकता है खारिज करके एक के साथ समाप्त होता है 3 खारिज करके अभिकलन, पहले संबोधित किया है ए-रिच पॉली (a) सिग्नल ही । पाली की हाल ही में एक विश्लेषण (ए) साइटों प्रोटोकॉल की एक बड़ी संख्या के द्वारा विशिष्ट आस्थगित इंगित करता है कि एक-seq2 के लिए अद्वितीय है साइटों की उंमीद न्यूक्लियोटाइड वितरण और जीन के भीतर स्थान, अंय 3 ' अंत अनुक्रमण प्रोटोकॉल के समान है ।

एक-seq2 में एक महत्वपूर्ण कदम polyadenylated आरएनए और राइबोसोमल RNAs और विभिन्न छोटे RNAs को हटाने का चयन है । यह सबसे आसानी से oligo (डीटी)25 चुंबकीय मोतियों के साथ एक mRNA-आइसोलेशन किट द्वारा किया जाता है । सिद्धांत रूप में, कुल आरएनए phenol युक्त समाधान भी उच्च गुणवत्ता आरएनए कि आगे mRNA-अलगाव किट या oligo (डीटी) agarose द्वारा चयन करने के लिए अधीन किया जा सकता है देता है । एक कदम है कि एक-seq2 में विविध किया जा सकता है क्षारीय hydrolysis जो छोटा किया जा सकता है या विभिन्न आकारों की आरएनए टुकड़े प्राप्त करने के लिए विस्तारित के साथ उपचार है । विचारणीय यह भी है कि पाली (क) पोलीमरेज़ द्वारा आरएनए अंशों के ३ ' dATP से ३ ' के अतिरिक्त रूप में दक्ष होता है. यहां वर्णित प्रोटोकॉल में, इस उपचार सभी आरएनए टुकड़े करने के लिए लागू किया जाता है, बंधाव प्रतिक्रिया के दौरान concatemerization से बचने के लिए । अंत में, हम ध्यान दें कि हालांकि आरएनए ligase 1 आम तौर पर एक आरएनए ligase के रूप में प्रयोग किया जाता है, यह भी कुशलतापूर्वक ligates एक असहाय डीएनए, के रूप में हम यहाँ किया है के लिए एक एडाप्टर ligate सीडीएनए अणुओं की 5 अंत करने के लिए.

इस प्रकार, एक-seq2 है एक कुशल और आसान करने के लिए पूर्व की पहचान के लिए प्रोटोकॉल को लागू करने-mRNA 3 ' अंत प्रसंस्करण साइटों । भविष्य के घटनाक्रम आगे प्रोटोकॉल की जटिलता को कम करने और आवश्यक सामग्री की राशि को शामिल कर सकते हैं । गणनात्मक डेटा विश्लेषण उपकरण के संबद्ध सेट आगे 3 ' अंत अनुक्रमण प्रोटोकॉल की एक विस्तृत श्रृंखला के साथ प्राप्त पढ़ता के सजातीय प्रसंस्करण सक्षम करें ।

Disclosures

लेखकों का खुलासा करने के लिए कुछ नहीं है ।

Acknowledgments

लेखक श्रीमती Béatrice Dimitriades सेल संस्कृति के साथ मदद के लिए धंयवाद । इस कार्य को स्विस राष्ट्रीय विज्ञान फाउंडेशन पलाश #31003A_170216 और 51NF40_141735 (NCCR आरएनए & #38; रोग) के सहयोग से किया गया ।

Materials

Name Company Catalog Number Comments
Materials
Agarose, ultra pure Invitrogen 16500-500
2100 Bioanalyzer Agilent G2940CA
Cordycepin triphosphate (3’ dATP) SIGMA C9137
DNA low bind vials, 1.5 ml Eppendorf 22431021
Dulbecco’s Phosphate Buffered Saline SIGMA D8637
Dynabeads mRNA-DIRECT Kit Ambion AM61012
GR-Green dye Excellgen EG-1071 use 1:10,000 dillution
HiSeq 2500 or NextSeq 500 next generation sequencers Illumina inquire with supplier
KAPA HiFi Hotstart DNA polymerase mix KAPA/Roche KK2602
Nuclease free water Ambion AM9937
Poly(A) polymerase, yeast Thermo Fisher Scientific 74225Z25KU
Poly(A) polymerase, E.coli New England Biolabs M0276L
Polynucleotide kinase Thermo Fisher Scientific EK0032
QIAEX II Gel Extraction Kit Qiagen 20021
QIAquick PCR Purification Kit Qiagen 28104
QIAquick Gel Extraction Kit Qiagen 28704
RNA ligase 1, high concentration New England Biolabs M0437M includes PEG-8000
RNeasy MinElute RNA Cleanup kit Qiagen 74204
RNase H New England Biolabs M0279
RNasin Plus, ribonuclease inhibitor Promega N2618
Superscript IV reverse transcriptase Thermo Fisher Scientiific 18090050
Turbo DNase Ambion AM2238
USER enzyme mix New England Biolabs M5505
Dyna-Mag-2 magnetic rack Thermo Fisher Scientific 12321D
Thermomixer C Eppendorf 5382000015 Heated mixer with heated lid
MicroSpin columns GE-Healthcare 27-5325-01
Name Company Catalog Number Comments
Buffers
Alkaline hydrolysis buffer, 1.5 x Mix 1 part 0.1 M Na2CO3 and 9 parts 0.1 M NaHCO3. Add EDTA to 1 mM. Adjust pH to 9.2. Store aliquots at -20 °C.
5x poly(A) polymerase buffer Thermo Fisher Scientiific 100 mM Tris-HCl, pH 7.0, 3 mM MnCl2, 0.1 mM EDTA, 1 mM DTT, 0.5 mg/ml acetylated BSA, 50% glycerol
Biotin binding buffer 20 mM Tris­Cl pH 7.5, 2 M NaCl, 0.1% NP­40
TEN buffer 10 mM Tris­Cl, pH 7.5, 1 mM EDTA, 0.02% NP­40
Name Company Catalog Number Sequence
Oligonucleotides according to Illumina TruSeq Small RNA Sample Prep Kits, for GA-IIx and Hiseq2000/2500 sequencers Microsynth
revRA3 (RNA) Microsynth 5’ amino­ CCUUGGCACCCGAGAAUUCCA­ 3’
revDA5 Microsynth 5’ amino­ GTTCAGAGTTCTACAGTCCGAC GATCNNNN-3’
Bio-dU-dT25, RT primer Microsynth 5' Biotin-TTTTTTTTTTTTTTTTTTTTTTTTTT-dU-TTTVN 3' (V = G, A or C)
PCR primer forward, RP1 Microsynth 5' AATGATACGGCGACCACCGAGA TCTACACGTTCAGAGTTCTACAG
TCCGA 3'
PCR primer reverse, RPI1, barcode in bold Microsynth 5' CAAGCAGAAGACGGCATACGAG
ATCGTGATGTGACTGGAGTTCCT
TGGCACCCGAGAATTCCA 3'
Name Company Catalog Number Comments
Oligonucleotides according to Illumina TruSeq HT-Small RNA Sample Prep Kits, for HiSeq2000/2500 and NextSeq500 sequencers
HT-rev3A (DNA/RNA) Microsynth 5'-amino-GTGACTGGAGTTCAGACGTGTG
CTCTTCCrGrAUrC-3'
HT-rev5A Microsynth 5' amino-ACACTCTTTCCCTACACGACGCT
CTTCCGATCTNNNN 3'
Bio-dU-dT25, RT primer Microsynth 5' Biotin-TTTTTTTTTTTTTTTTTTTTTTTTTT-dU-TTTVN 3'
PCR primers forward (D501-506) Microsynth or Illumina 5'-AATGATACGGCGACCACCGAGAT
CTACAC[i5]ACACTCTTTCCCTACA
CGACGCTCTTCCGATCT -3'
PCR primers reverse (D701-D712) Microsynth or Illumina 5'-CAAGCAGAAGACGGCATACGAG A[i7]GTGACTGGAGTTCAGACGTG TGCTCTTCCGATC-3'
Documentation for Illumina multiplexing: Illumina https://support.illumina.com/content/dam/illumina-support/documents/documentation/chemistry_documentation/experiment-design/illumina-adapter-sequences_1000000002694-01.pdf

DOWNLOAD MATERIALS LIST

References

  1. Jan, C. H., Friedman, R. C., Ruby, J. G., Bartel, D. P. Formation, regulation and evolution of Caenorhabditis elegans 3'UTRs. Nature. 469, (7328), 97-101 (2011).
  2. Spies, N., Burge, C. B., Bartel, D. P. 3' UTR-isoform choice has limited influence on the stability and translational efficiency of most mRNAs in mouse fibroblasts. Genome Res. 23, (12), 2078-2090 (2013).
  3. Hoque, M., Ji, Z., et al. Analysis of alternative cleavage and polyadenylation by 3' region extraction and deep sequencing. Nat. methods. 10, (2), 133-139 (2013).
  4. Martin, G., Gruber, A. R., Keller, W., Zavolan, M. Genome-wide analysis of pre-mRNA 3’ end processing reveals a decisive role of human cleavage factor I in the regulation of 3' UTR length. Cell Rep. 1, (6), 753-763 (2012).
  5. Gruber, A. R., Martin, G., et al. Global 3' UTR shortening has a limited effect on protein abundance in proliferating T cells. Nat. Commun. 5, 5465 (2014).
  6. Kivioja, T., Vähärautio, A., et al. Counting absolute numbers of molecules using unique molecular identifiers. Nat. methods. 9, (1), 72-74 (2011).
  7. Gruber, A. J., Schmidt, R., et al. A comprehensive analysis of 3' end sequencing data sets reveals novel polyadenylation signals and the repressive role of heterogeneous ribonucleoprotein C on cleavage and polyadenylation. Genome Res. 26, (8), 1145-1159 (2016).
  8. Lingner, J., Keller, W. 3'-end labeling of RNA with recombinant yeast poly(A) polymerase. Nucleic Acids Res. 21, (12), 2917-2920 (1993).
  9. Quail, M. A., Kozarewa, I., et al. A large genome center's improvements to the Illumina sequencing system. Nat. methods. 5, (12), 1005-1010 (2008).
  10. Rahmann, S. Snakemake--a scalable bioinformatics workflow engine. Bioinformatics. 28, (19), 2520-2522 (2012).
  11. Analytics, C. Anaconda Software Distribution. Available from: https://continuum.io (2016).
  12. Lab, H. FASTX-Toolkit - Hannon Lab. Available from: http://hannonlab.cshl.edu/fastx_toolkit/index.html (2017).
  13. Dobin, A., Davis, C. A., et al. STAR: ultrafast universal RNA-seq aligner. Bioinformatics. 29, (1), 15-21 (2013).
  14. Martin, M. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet.journal. 17, (1), 10-12 (2011).
  15. Li, H., Handsaker, B., et al. The Sequence Alignment/Map format and SAMtools. Bioinformatics. 25, (16), 2078-2079 (2009).
  16. Robinson, J. T., Thorvaldsdóttir, H., et al. Integrative genomics viewer. Nat. Biotechnol. 29, (1), 24-26 (2011).
  17. Quinlan, A. R., Hall, I. M. BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics. 26, (6), 841-842 (2010).
  18. Ozsolak, F., Platt, A. R., et al. Direct RNA sequencing. Nature. 461, (7265), 814-818 (2009).
  19. Yao, C., Biesinger, J., et al. Transcriptome-wide analyses of CstF64-RNA interactions in global regulation of mRNA alternative polyadenylation. Proc. Natl. Acad. Sci. U. S. A. 109, (46), 18773-18778 (2012).
  20. Lin, Y., Li, Z., et al. An in-depth map of polyadenylation sites in cancer. Nucleic Acids Res. 40, (17), 8460-8471 (2012).
  21. Shepard, P. J., Choi, E. -A., Lu, J., Flanagan, L. A., Hertel, K. J., Shi, Y. Complex and dynamic landscape of RNA polyadenylation revealed by PAS-Seq. RNA. 17, (4), 761-772 (2011).
  22. Fu, Y., Sun, Y., et al. Differential genome-wide profiling of tandem 3' UTRs among human breast cancer and normal cells by high-throughput sequencing. Genome Res. 21, (5), 741-747 (2011).
A-seq2 के साथ 3 ' अंत अनुक्रमण पुस्तकालय की तैयारी
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Martin, G., Schmidt, R., Gruber, A. J., Ghosh, S., Keller, W., Zavolan, M. 3' End Sequencing Library Preparation with A-seq2. J. Vis. Exp. (128), e56129, doi:10.3791/56129 (2017).More

Martin, G., Schmidt, R., Gruber, A. J., Ghosh, S., Keller, W., Zavolan, M. 3' End Sequencing Library Preparation with A-seq2. J. Vis. Exp. (128), e56129, doi:10.3791/56129 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter