Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Erkennung von Enterohemorrhagic Escherichia Coli Besiedlung in murinen Host durch nicht-invasive In Vivo Biolumineszenz-System

doi: 10.3791/56169 Published: April 9, 2018

Summary

Ein detailliertes Protokoll von einem Maus-Modell für Enterohemorrhagic E. Coli (EHEC) Besiedlung durch mit Hilfe von Bakterien mit der Bezeichnung der Biolumineszenz wird vorgestellt. Die Erkennung dieser biolumineszenten Bakterien durch eine nicht-invasive in Vivo imaging-System mit lebenden Tieren kann unser gegenwärtige Verständnis der EHEC Besiedlung voraus.

Abstract

Enterohemorrhagic E. Coli (EHEC) O157: H7, das ist ein durch Lebensmittel übertragene Erreger, Causesdiarrhea, hämorrhagische Kolitis (HS) und Hämolytisch-Urämischen Syndrom (HUS), um den Darm-Trakt des Menschen besiedeln. Um detaillierte Mechanismus der EHEC Kolonisation in vivo Studie unbedingt Tiermodellen zu überwachen und zu quantifizieren, EHEC Besiedlung haben. Wir zeigen hier ein Maus-EHEC Kolonisation Modell durch die Umwandlung der biolumineszenten mit dem Ausdruck ihrer Plasmids, EHEC zu überwachen und zu quantifizieren EHEC Kolonisation in lebenden Gastgeber. Tiere mit Biolumineszenz-Label EHEC beimpft zeigen intensive Biolumineszenz Signale bei Mäusen durch Erkennung mit einem nicht-invasive in Vivo imaging-System. Nach 1 bis 2 Tage-Infektion Post, konnte Biolumineszenz Signale noch bei infizierten Tieren nachgewiesen werden, was darauf hindeutet, dass EHEC besiedeln in Gastgeber für mindestens 2 Tage. Wir zeigen auch, dass diese Biolumineszenz EHEC suchen, Maus Darm, speziell in den Blinddarm und Dickdarm, von Ex-Vivo -Bilder. Dieses Maus-EHEC Kolonisation Modell kann als ein Werkzeug, um das aktuelle Wissen des EHEC Kolonisation Mechanismus voraus dienen.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

EHEC O157: H7 ist ein Erreger, der Durchfall1, HS2, HUS3und sogar Akutes Nierenversagen4 durch verunreinigtes Wasser oder Lebensmittel verursacht. EHEC ist eine pathogene Enterobacterium und besiedelt mit dem Magen-Darm-Trakt des Menschen1. Wenn EHEC zunächst halten an Host Darmepithel, Spritzen sie die Kolonisation Faktoren in Wirtszellen durch die Typ III-Sekretion System (T3SS), das Funktionen wie ein molekularer Spritze induzieren eine Befestigung und auszulöschen (A/E) Läsion anschließend zur Durchsetzung Adhäsion (Kolonisation)5. Diese Gene in A/E Läsion Bildung beteiligt sind durch den Ort der Enterozyten Auslöschung (LEE) Pathogenität Insel5kodiert.

Biolumineszenz ist eine Licht-produzierende chemische Reaktion in die Luciferase seine Substrat Luciferin zum sichtbaren Licht6generieren katalysiert. Dieser enzymatischen Prozess erfordert oft das Vorhandensein von Sauerstoff oder Adenosintriphosphat (ATP)6. Biolumineszenz imaging (BLI) erlaubt Forschern, die Visualisierung und die Quantisierung der Wirt-Pathogen Interaktionen in lebenden Tieren7. BLI kann bakterielle Infektionszyklus mit lebenden Tieren charakterisieren, indem Sie die folgenden biolumineszenten Bakterien, wie sie zu migrieren und dringen in verschiedenen Geweben7; Dies zeigt eine dynamische Weiterentwicklung der Infektion. Darüber hinaus bezieht sich die bakterielle Belastung bei Tieren auf die Biolumineszenz Signal8; So ist es ein bequemer Indikator, die pathologischen Zuständen von Versuchstieren in eine einfache und direkte Weise zu schätzen.

Das hier verwendete Plasmid enthaltenen Luciferase Operon, LuxCDABE, die aus dem Bakterium Photorhabdus Luminescens , die eine eigene Luciferase Substrat7,9kodiert. Durch die Umwandlung dieser Luciferase exprimierenden Plasmid in Bakterien, können die Kolonisation und Infektion Prozesse überwacht werden, durch die Beobachtung dieser biolumineszenten Bakterien mit lebenden Tieren. Insgesamt erlauben BLI und Biolumineszenz-Label Bakterien Forschern, überwachen die bakterielle Zahlen und Lage, bakterielle Lebensfähigkeit mit Antibiotika-Therapie Behandlung und bakterielle Genexpression in Infektion/Kolonisation6, 7. zahlreiche Pathogene Bakterien gemeldet wurden, äußern, die LuxCDABE -Operon, deren Infektion Zyklus und/oder Gen-Ausdruck in Infektion zu untersuchen. Diese Bakterien, einschließlich adhärent E. Coli10, EHEC8,11,12,13, enteropathogenic E. Coli (EPEC)8, Citrobacter Rodentium14,15, Salmonella Typhimurium16, Listeria Monocytogenes17, Yersinia Enterocolitica18,19, und Vibrio Cholerae20, dokumentiert wurden.

Einige experimentelle Modelle wurden entwickelt, um die Studie von EHEC Kolonisation in Vitro und in Vivo21,22,23zu erleichtern. Allerdings gibt es einen Mangel an geeigneten Tiermodellen, die EHEC Kolonisation in Vivozu studieren, und damit einen daraus resultierenden Mangel an Details. Um die Studie des EHEC Kolonisation Mechanismus in Vivozu erleichtern, ist es wertvoll, Tiermodellen zu beobachten und quantifizieren EHEC Besiedlung mit lebenden Tieren in eine nicht-invasive Methode zu bauen.

Dieses Manuskript beschreibt ein Maus-EHEC-Kolonisation-Modell, das eine Biolumineszenz mit dem Ausdruck ihrer System verwendet, um EHEC Kolonisation im Laufe der Zeit unter lebenden-Hosts zu überwachen. Mäuse sind intragastrically mit Biolumineszenz-Label EHEC beimpft und die biolumineszente Signal bei Mäusen mit einem nicht-invasive in Vivo imaging System13erkannt wird. Mäuse mit Biolumineszenz-Label EHEC zeigten signifikante Biolumineszenz Signale in ihrem Darm, nach 2 Tagen-Infektion, die vorgeschlagen Post, dass diese Bakterien im Darm Host kolonisiert, nach 2 Tagen-Infektion Post infiziert. Ex-Vivo Bilddaten zeigte, dass diese Kolonisierung speziell in den Blinddarm und Dickdarm von Mäusen. Mithilfe dieses Maus-EHEC-Modell kann die biolumineszente EHEC Kolonisierung erkannt werden im Leben Wirt durch ein in-Vivo imaging-System, um die detaillierten Mechanismen der magensaftresistenten Bakterien Kolonisation, zu untersuchen, die in weiteren Verständnis fördern kann EHEC-induzierte physiologische und pathologische Veränderungen.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Achtung: EHEC O157: H7 ist eine Sicherheitsstufe 2 (BSL-2) Erreger nach der Centers for Disease Control and Prevention (CDC) biologische Sicherheit Anweisung (https://www.cdc.gov/). Daher müssen alle experimentellen Verfahren, die EHEC in einem BSL-2 Anlage durchgeführt werden. Kittel und Handschuhe zu tragen, während der Durchführung des Experiments. Arbeiten Sie in einem zertifizierten Biosafety Kabinett (BSC). Desinfizieren Sie die experimentelle Bank vor und nach der Versuchsdurchführung mit 70 % Ethanol. Alle Instrumente oder Geräte, die mit 70 % Ethanol oder Bleichmittel Kontakt (oder potenziell Kontakt) EHEC desinfiziert werden sollte. Kontaminierte (oder verunreinigter) Abfälle sollte sorgfältig abgedichtet und autoklaviert. Tragen Sie eine Maske, Augenschutz, doppelte Handschuhe oder einen Overall, falls erforderlich. Die 6 Wochen alten C57BL/6 weibliche Mäuse waren gekauft und im Labor Animal Center der National Cheng Kung University (NCKU) gepflegt. Die Tierversuche wurden von den institutionellen Animal Care und Nutzung Ausschuss der NCKU (Zulassungsnummer 104-039) genehmigt.

1. Bioluciferase-Label EHEC-Bakterien-Generation

  1. Mix 50 ng Desoxyribonukleinsäure (DNA), 1 μL von 10 μM weiterleiten und reverse Primer, 2 μl 2,5 mM Deoxynucleotides (dNTPs), 2 μl 10-fach Puffer, 0,2 μl DNA Polymerase und sterile bidestilliertem Wasser (DdH2O) zu einem Endvolumen von 20 μL verstärken die Anti-Kanamycin Kassette, NptII -gen24. Das DNA-Template ist von pBSL18024, das von der nationalen BioResource Projekt (NBRP) gekauft wird. Die PCR-Bedingungen sind in Tabelle 1 aufgeführt und die Grundierung-Sequenz ist in Tabelle 2zur Verfügung.
  2. Verbinden Sie die PCR-Produkte zu einem kommerziellen klonen Vektor nach Kit-Protokoll (siehe Tabelle der Materialien).
  3. Das NptII -gen-Fragment aus dem Klonen Vektor Rentenantrag und SmaI Verbrauchsteuern und Klonen in pBBR1MCS4, die von den Rentenantrag und ScaI von pAKlux29 erstelle ich beständige Kanamycin Plasmid verdaut ist, pWF27813.
  4. Verbrauchssteuern LuxCDABE -Operon, aus der Luciferase mit dem Ausdruck Plasmid9, pAKlux2, von SpeI-HF und ScaI und Klon zu SpeI-HF und SmaI verdaut pWF278 Kanamycin generieren resistent und Luciferase Plasmid, pWF27913zum Ausdruck zu bringen.
    Hinweis: Für die Plasmid-Extraktionen und die ausgeschnittenen Fragment Reinigungen, verwenden Sie die kommerzielle Plasmid-Extraktion und das Gel Extraction Kit bzw.. Mischen Sie für die Enzym-Verdauung 100 ng DNA, 1 μl 10-fach Puffer, 1 μL jeder ausgewählten Restriktionsenzym und sterile DdH2O auf ein Gesamtvolumen von 10 μL und Inkubation bei 37 ° C für 2,5-3 h.
  5. Verwandeln Sie das Plasmid pWF279 in E. Coli O157: H7 EDL933 kompetente Zellen durch Elektroporation mit 2.500 V für 4 ms.
  6. Inkubieren Sie die transformierten Bakterienzellen in 1 mL Luria-Bertani (LB)-Medium bei 37 ° C für 1 h.
  7. Platte die Bakterien auf eine LB-Agar-Platte ergänzt mit 50 µg/mL Kanamycin bei 37 ° C für 16-18 h.
  8. Überprüfen Sie die biolumineszente Signal der Platte durch ein in-Vivo Bildgebung Maschine am nächsten Tag. Eine einzige Kolonie von der Platte nehmen und Kultur es in 3 mL LB ergänzt mit 50 µg/mL Kanamycin bei 37 ° C für 16-18 h.
  9. Bereiten Sie bakterielle Lager Medium durch Verdünnung 100 % Glycerin in sterilen DdH2O, die 30 % Glycerin-Lösung zu machen.
  10. Einfrieren Kanamycin-resistente E. Coli O157: H7 EDL933 Bakterien beherbergen die Luciferase-Plasmid als bakterielle Stock in eine Schraubkappe Cryoröhrchen als ein 1:1 Verhältnis von Bakterien-Kultur und 30 % Glycerin-Lösung bei-80 ° C. Die letztendliche Konzentration an Glycerin beträgt 15 %.

(2) Biolumineszenz EHEC Bakterien Vorbereitung für orale Impfung

Hinweis: Die Timeline Flussdiagramm der experimentellen Verfahren für die EHEC-Vorbereitung und Maus orale Magensonde ist in Abbildung 1 experimentelle Vorbereitung unterstützen dargestellt.

  1. Streak E. Coli O157: H7 EDL933 Bakterien beherbergen Luciferase Plasmid auf eine LB-Agar-Platte mit 50 µg/mL Kanamycin von-80 ° C Lager. Wachsen Sie die Bakterien für 16-18 h bei 37 ° C.
  2. Wählen Sie eine einzige Kolonie von der Übernachtung Platte und Kultur in 3 mL LB-Medium mit 50 µg/mL Kanamycin für 16-18 h in einem 37 ° C Inkubator bei 220 u/min.
  3. Subkultur der Bakterien (1: 100 Verdünnung) in Kanamycin (50 µg/mL) mit LB Brühe für 2,5-3 h in einem 37 ° C Inkubator bei 200 u/min. (Zum Beispiel fügen Sie 2 mL über Nacht Bakterien auf 200 mL LB-Medium mit Kanamycin (50 µg/mL) ergänzt kultiviert).
  4. Die Bakterien für 2,5-3 h Inkubation und Messung den optischen Dichte-Wert bei 600 nm (OD600) bis der Wert liegt zwischen 0,9 bis 1. Die Bakterienzelle Zahl liegt bei einer Dichte von etwa 108 Kolonie bildende Einheiten (KBE) / mL.
  5. Zentrifugieren Sie die neu gebildeten Bakterien bei 8.000 x g für 30 min, 4 ° C.
  6. Verwerfen Sie den überstand, ohne zu rühren das Pellet von Bakterien und waschen Sie das Pellet mit 100 mL 0,9 % sterile normale Kochsalzlösung durch sanfte Bewegung.
  7. Wiederholen Sie die Schritte 2.5 und 2.6 einmal.
  8. Nach der Wäsche die Bakterienkultur bei 8.000 x g für 30 min, 4 ° C zentrifugiert und den überstand sanft entsorgen.
  9. Kondensat der Pellets bei 100-fold mit 0,9 % sterile normale Kochsalzlösung. Zum Beispiel, wenn 200 mL Bakterien zentrifugiert werden, fügen Sie 2 mL normale Kochsalzlösung um die Pellets zu unterbrechen.
  10. Bestätigen Sie die Bakterien KBE (es sollten etwa 109 CFU/100 μL nach Kondensation in normalen Kochsalzlösung sein) durch Ausplattieren konzentrierte Bakterien durch eine 10-divisibel serielle Verdünnung25.

3. Maus orale Magensonde von EHEC

  1. 6 Wochen alten weibliche C57BL/6 Mäusen mit Streptomycin Wasser (5 g/L) für 24 h zu behandeln.
  2. Nach 24 h wechseln Sie zur regelmäßigen Trinkwasser für ein weiteres 24 h vor der Magensonde. Nach der Behandlung mit Wasser für 24 h, sind die Mäuse bereit für orale Magensonde von EHEC.
  3. Füllen Sie die Spritze mit 100 μL EHEC-Bakterien durch den Kolben zurückziehen. Stellen Sie sicher, dass keine Luftblasen in der Spritze sind. Entfernen Sie die Luftblasen durch Einrasten der Spritze mit den Fingern.
  4. Heben Sie das Tier vorsichtig und legen Sie es auf der Oberseite Käfig mit Sorgfalt.
  5. Die Maus am Schwanz sorgfältig zu erfassen, und das Tier wird oben auf den Käfig zu greifen und versuchen, sich zu bewegen.
  6. Sanft Zurückhalten der Maus durch das Greifen der losen Haut im Nacken und Rücken des Tieres mit Daumen und Zeigefinger zu verhindern, dass der Kopf der Maus verschieben.
  7. Halten Sie die Maus in vertikaler Position die Magensonde Nadel und sicherstellen, dass der Leiter der Maus immobilisiert und senkrecht ist.
  8. Nadel die Magensonde in die Maus Mund nach dem Dach des Mundes und nach unten in die Speiseröhre und den Magen.
  9. Wenn die eingefügte Nadel die Hälfte oder zwei Drittel Länge in der Maus ist, injizieren Sie 100 μL EHEC-Bakterien, die ungefähr 109 KBE Zellen enthalten.

(4) Visualisierung

  1. Erkennen Sie nach der oralen Magensonde die Biolumineszenz Signale auf 1 bis 2 Tage.
  2. Vor der Prüfung die Biolumineszenz Signale der Tiere, sie zu betäuben, indem man sie in eine Kammer mit 2,5 % Isofluran mit 1,5 L/min Sauerstoff.
  3. 2-5 min. warten Sie, bis alle Mäuse bewusstlos und Anschlag bewegt werden. Tiere sind bereit für in Vivo Nachweis von Biolumineszenz.
  4. Erkennen und Bild Biolumineszenz Signale der Tiere durch ein in-Vivo imaging-System. Betrieb der Software finden Sie in Abschnitt 5 "Datenerfassung". Während den imaging-Prozess sind alle Tiere unter eine kontinuierliche Versorgung mit 2,5 % Isofluran mit 1,5 L/min Sauerstoff.
    1. Klicken Sie auf Datei > live und manuell fokussieren auf die Maus.
    2. Wählen Sie die Belichtung Zeit und Laser Intensität.
    3. Erwerben, klicken Sie auf > erfassen.
  5. Für die ex-Vivo Bildgebung einschläfern Sie die Mäuse durch zervikale Dislokation und entfernen Sie den gesamten Darm von infizierten Mäusen. Legen Sie den Darm in eine 9 cm Petrischale und Bild, durch das in-Vivo imaging-System. Die Einstellung ist identisch mit der in-Vivo imaging außer das Sichtfeld ist als A/B. Weitere Informationen finden Sie Abschnitt 5 "Datenerfassung".
    Hinweis: Methode für zervikale Dislokation: zurückhalten die Mäuse auf der Oberseite Käfig durch die Rute mit einer Hand greifen, damit die Tiere den Käfig greifen. Legen Sie einen Filzstift oder Daumen und Zeigefinger der anderen Hand gegen die Rückseite des Halses an der Basis des Schädels. Schnell mit der Hand oder das Objekt während der Ruhigstellung des Kopfes nach vorne schieben und mit der Hand die Rute nach hinten ziehen.
    Prüfen Sie genau, Atemstillstand und kein Herzschlag zu bestätigen.

5. die Datenerfassung

Hinweis: Die Software für die Datenerfassung wird in der Tabelle der Materialienaufgeführt.

  1. Für die Bildaufnahme die Systemsteuerung Erwerb der Software (Abbildung 2).
  2. Wählen Sie "leuchtende" "Fotografieren" und "Overlay".
  3. Eingestellten Belichtungszeit als "Auto". Legen Sie Binning als "Medium."
  4. Ƒ/Stopp 1 für leuchtende und 8 festgelegt für Foto. Ƒ/Stop steuert die Menge des Lichtes von der CCD-Detektor empfangen.
  5. Legen Sie das Sichtfeld, basierend auf dem Feld der Bilder, die von Interesse, zu erwerben. Option "D" kann passen fünf 6 Wochen alten Mäusen und Bild sie alle gleichzeitig. "C" kann drei 6 Wochen alten Mäusen in einem Feld Bild.
  6. Wenn die Mäuse/Proben für die Bildgebung fertig sind, klicken Sie auf "Acquire" für die Bildaufnahme.
  7. Öffnen Sie die Bilddaten, die erworben wurde.
  8. Öffnen Sie die Tool-Palette (Abbildung 3).
  9. Wählen Sie die ROI-Tools. Es wird empfohlen, den Kreis (die am weitesten links ein) reichen die biolumineszenten Bereich auf Bilder (Abbildung 4).
  10. Klicken Sie auf "Maßnahme ROIs" (Stift-Symbol) zur Messung der Biolumineszenz oberflächenintensität (Abbildung 3). Das ROI-Messungen-Panel und die Quantifizierung Werte angezeigt (Abbildung 5).
  11. Verwenden Sie die konfigurieren Messung in der linken Ecke des Fensters ROI Messungen die Werte/Informationen benötigt (Abbildung 6) auswählen, andernfalls klicken Sie auf "Exportieren", um diese Datentabelle exportieren und speichern als CSV-Datei (Abbildung 5).
  12. Verwenden Sie die Werte der Spalte "Gesamtfluss (p/s)" als die Biolumineszenz Intensität Quantifizierung in der CSV-Datei.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Wir mit der Bezeichnung der Biolumineszenz EHEC verabreicht (~ 109 Bakterienzellen), 6 - Wochen alten weiblichen C57BL/6 Mäusen durch orale Magensonde. Nach der mündlichen Inokulation von EHEC Mäusen innerhalb von 1 h wurden die Tiere auf Biolumineszenz Signal durch die in-Vivo imaging-System wie in Abbildung 7dargestellt untersucht. Die Ergebnisse zeigten ein starkes Signal der biolumineszentes Magensonde Mäuse mit EHEC Biolumineszenz bezeichnet. Wir haben die Signale auf 2 Tage Post-Infektion untersucht. Wie in Abbildung 8Adargestellt, die Mäuse mit Biolumineszenz-Label Wildtyp EHEC EDL933 intensive Biolumineszenz Signale zeigte, auch nach 2 Tagen Infektion, post, die vorgeschlagen, dass EHEC in Gastgeber von 2 Tagen kolonisiert geimpft. Wir infiziert auch intragastrically Biolumineszenz-mit der Bezeichnung EDL933ΔrfaD (ΔrfaD) , Mäuse (Abb. 8A). Dieser Mutante übergelaufen in Lipopolysaccharid (LPS), hat gezeigt, dass Kolonisation in der Hostie in unseren vorangegangenen Studie zu reduzieren. Wie in Abbildung 8Adargestellt, gibt es kein Biolumineszenz Signal erkannt in ΔrfaD-infizierte Mäuse, was darauf hindeutet, dass es gibt keine oder weniger Bakterien Zellen besiedelt in den Mäusen. Quantifizierung der das Fluoreszenzsignal ist in Abbildung 8 bdargestellt. Als nächstes wurde die Position der Biolumineszenz-Label Bakterien bestimmt. Die infizierte Mäuse wurden geopfert, menschlich und ihren gesamten Darm entfernt. Der Darm von Mäusen 2 Tage Post-Infektion wurden auf 9 cm Petrischalen positioniert und ex Vivo (Abbildung 9A) abgebildet. Die intestinalen Geweben des Biolumineszenz-markierten EDL933 infizierte Mäuse zeigten eine signifikante Zunahme der Biolumineszenz Signale in den Blinddarm und Dickdarm, die darauf hindeuten, dass diese Biolumineszenz EHEC in den Blinddarm und Dickdarm von infizierten Mäusen 2 Tage bei kolonisiert zuletzt. Im Gegensatz dazu sank Mäuse infiziert mit Biolumineszenz-mit der Bezeichnung ΔrfaD (Abbildung 9A), offenbart Biolumineszenz Signal in ihre Darmgewebe, die im Einklang mit dem in-Vivo -Bild (Abbildung 8A ). Quantifizierung der das Fluoreszenzsignal ist in Abbildung 9dargestellt.

Figure 1
Abbildung 1 : Timeline des experimentellen Vorbereitung Ablaufdiagramms.
Überblick über das Timing erforderlich, um biolumineszente EHEC-Bakterien vorbereiten und Vorbehandeln Mäuse mit Streptomycin. (A) EHEC-Vorbereitung. (B) Mäuse Vorbereitung. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 2
Abbildung 2 : In vivo imaging System Erwerb Systemsteuerung.
Öffnen Sie vor imaging Proben IVIS Erwerb Systemsteuerung. Wählen Sie "leuchtende" "Fotografieren" und "Overlay". Eingestellten Belichtungszeit als "Auto". Legen Sie Binning als "Medium." Ƒ/Stopp 1 für leuchtende und 8 festgelegt für Foto. Ƒ/Stop steuert die Menge des Lichtes von der CCD-Detektor empfangen. Wenn Proben für die Bildgebung fertig sind, klicken Sie auf "Acquire" Bilder zu erwerben. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 3
Abbildung 3 : Werkzeug Farbleiste.
Verwenden Sie nach Bild erwerben die Tool-Palette-Panel zur Quantifizierung der Biolumineszenz Intensität. Öffnen Sie die Tool-Palette und Bilddaten Sie die. Wählen Sie eines der ROI-Tools für die Biolumineszenz Signale auf Bilder reichen. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 4
Abbildung 4 : Biolumineszenz Signal aus Probe für die Quantifizierung.
Biolumineszenz Signalbereich auf Bildern umgeben von ROI-Tools. Alle Biolumineszenz Signale, die hier gezeigt sind im roten Kreis. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 5
Abbildung 5 : ROI Messungen.
Nach Kreisen Biolumineszenz Signale und die Tool-Palette-Panel "Maßnahme ROIs" anklicken, werden Werte dargestellt, wie gezeigt. Die Werte der Spalte Gesamtfluss (p/s) sind für die Biolumineszenz Intensität Quantifizierung verwendet. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 6
Abbildung 6 : Verschiedene Quantifizierung Informationen hinzufügen.
Klicken Sie auf Konfigurieren Messung in der linken Ecke des Fensters ROI Messungen, können Sie andere gewünschte Quantifizierung Werte/Daten auswählen. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 7
Abbildung 7 : Repräsentatives Bild von Mäusen nach mit Biolumineszenz EHEC beimpft.
Repräsentatives Bild von Mäusen mit Biolumineszenz EHEC durch orale Magensonde innerhalb 1 h geimpft. Die Farbskala stellt den Glanz (p/s/cm2/sr). Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 8
Abbildung 8 : Bilder von Mäusen mit Biolumineszenz-Label EHEC nach 2 Tagen geimpft.
(A) repräsentieren Bild von Mäusen mit Biolumineszenz Wildtyp geimpft, EHEC-EDL933 und EDL933:ΔrfaD durch orale Magensonde nach 2 Tagen-Infektion Post. (B) Quantifizierung der Biolumineszenz Intensität von Mäusen mit EHEC infiziert. Fehlerbalken zeigen die Standardabweichungen. Repräsentative Bilder angezeigt werden. Alle Experimente wurden durchgeführt unabhängig dreimal mit 2-3 Tiere jedes Mal, und Fehlerbalken zeigen die Standardabweichungen. P-Werte kennzeichnen die Ergebnisse der statistischen Analyse durch t-Test. Die Farbskala stellt den Glanz (p/s/cm2/sr). Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 9
Abbildung 9 : Bilder der intestinalen Gewebe von infizierten Mäusen mit Biolumineszenz-Label EHEC.
(A) 2 Tage nach der Inokulation mit Biolumineszenz-Label EHEC, die Mäuse wurden eingeschläfert und ganze Darm Gewebe wurden entfernt und Ex Vivoabgebildet. Repräsentative Bilder angezeigt werden. (B) Quantifizierung der Biolumineszenz Intensität der intestinalen Gewebe von Mäusen mit EHEC infiziert. Alle Experimente wurden durchgeführt unabhängig dreimal mit 2-3 Tiere jedes Mal, und Fehlerbalken zeigen die Standardabweichungen. P-Werte kennzeichnen die Ergebnisse der statistischen Analyse durch t-Test. Die Farbskala stellt den Glanz (p/s/cm2/sr). Maßstabsbalken entspricht 1 cm. Bitte klicken Sie hier für eine größere Version dieser Figur.

Schritte Temperatur Zeit Anzahl der Zyklen
Anfängliche Denaturierung 95 ° C 10 min 1
Denaturierung 95 ° C 30 Sek. 35
Glühen 58,4 ° C 30 Sek.
Erweiterung 72 ° C 1,5 min.
Letzte Erweiterung 72 ° C 10 min 1
Halten 4 ° C 1

Tabelle 1: Polymerase-Kettenreaktion (PCR) Bedingungen

Primer-name Sequenz
NptII F 5' CCTATGCATAATAATTCCGCTAGCTTCACG3'
NptII R 5' GCTCCACCGATAATATTCCTGAGTCATACT3'

Tabelle 2: Primer-Sequenzen verwendet, um verstärken nptII

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Es wurde berichtet, dass EHEC mit Luciferase Plasmid transformiert verwendet worden ist, um seine Lokalisierung in Hosts oder Gen Ausdruck in Vivo8,11,12zu untersuchen. Das Mausmodell demonstriert hier berichtet auch das EHEC kolonisiert Timing und die Lokalisierung in murinen Host8erkennen. Dennoch bieten wir das Detail-Protokoll wie EHEC Impfung Mäuse intragastrically verwalten und wie sorgfältig die biolumineszenten Bakterien für orale Magensonde vorbereiten. Insbesondere ist die Position der Maus-Kopf für die Maus orale Magensonde von EHEC (Schritt 3,7), kritische, wenn die Magensonde Nadel eingeführt wird. Wenn die Position nicht senkrecht steht, es wird schwierig sein, die Nadel, und es könnte möglicherweise verletzen die Maus. Im Schritt 3,8 Wenn die Magensonde Nadel im Mund von der Maus ist legen die Zunge außerhalb der Mündung leicht. Wenn Widerstand gestoßen ist, wenn die Magensonde Nadel an der Speiseröhre übergeben wird, stoppen Sie die Nadel vorwärts und unverzüglich zurückziehen. Ändern Sie die Nadelposition um sicherzustellen, dass die Nadel die Speiseröhre eingibt. Die Nadel könnte eintreten die Luftröhre tritt Widerstand auf die Injektion von Bakterien in der Lunge statt des Magens zur Folge hätte.

Anwendung des grün fluoreszierenden Proteins (GFP) als eines Biosensors ist häufig in biologische Experimente. Jedoch mit GFP als Reporter um zu beobachten, dass die Erreger Infektion/Kolonisation mit lebenden Tieren durch in-Vivo Bildgebung wird nicht empfohlen, da die Extinktion von Hämoglobin, Proteine und Wasser sind hoch zwischen 200-650 nm26, die Überschneidungen mit GFP (Erregung 480 nm, Emission 510 nm)27. Daher kann mit GFP Signal als Reporter für die in-Vivo Bildgebung von Hämoglobin, Proteine und Wasser Tiere26unterbrochen werden. Die Nah-Infrarot (NIR) Fluoreszenz eignet sich ideal für in-Vivo imaging, da seine Absorption Fenster herum 650-900 nm,28, die in der Region der niedrigsten Absorptionskoeffizienten von Hämoglobin (< 650 nm) und Wasser (> 900 nm)26 ,28 . Darüber hinaus, wenn Gewebe Licht absorbiert, gibt es eine Chance, Autofluoreszenz zu induzieren. Wenn die Wellenlängen der Anregung und Emission im Fenster "GLP" reichen, induziert es viel mehr Autofluoreszenz als NIR29. Einsatz von NIR kann das Signal im Vergleich zu der GFP durch den Wegfall der Autofluoreszenz Hintergrund29Hintergrund-Verhältnis verbessern. Biolumineszenz benötigt keine Energie Erregung um sichtbares Licht zu erzeugen. Es hängt von der Reaktion zu katalysieren Substrat Luciferin durch seine Enzym Luciferase und Licht erzeugen. Da Biolumineszenz kein Licht direkt auf einer Probe erforderlich ist, ist das Hintergrundsignal aus einer Probe sehr gering. Verwenden Sie daher der Biolumineszenz, wie ein Reporter mehr allgemein und für die in-Vivo Bildgebung einfacher ist. Im Gegensatz dazu erfordert Fluoreszenz leichte Erregung, Signallampe zu induzieren. Wenn Gewebe Licht absorbieren, gibt es eine Chance, dass das Fluoreszenzlicht wird ausgegeben und Autofluoreszenz zu induzieren, so dass ihr Signal-Rausch-ist höher im Vergleich zu der Biolumineszenz.

Da EHEC ist natürlich weniger besiedelt in Mäusen durch orale Infektion2,22, einer natürlichen Schleimhaut Erreger von Mäusen, Citrobacter Rodentium, genannt verwendet worden, um die Kolonisation Mechanismus zur murinen Host als studieren ein Surrogate Bakterium22,30. Sowohl der EHEC und C. Rodentium besiedeln die Darmschleimhaut und induzieren die Bildung von A/E-Läsionen im Host22,30. Sie enthalten auch die LEE Pathogenität Insel, die kodiert ein T3SS und mehrere Effektor-Proteine, die A/E Läsion22,30induziert. Daher die Verwendung von Luciferase Plasmid auszudrücken, wie ein Reporter in C. Rodentium zu erkennen die Kolonisation Pathologie und studieren die Kolonisation Mechanismus über eine in-Vivo imaging-System auch wurde gemeldet14, 15. dennoch, während C. Rodentium Infektion der Mäuse ein sinnvolles Modell, die Funktion des T3SS und der Mechanismus der A/E-Läsion zu untersuchen ist, C. Rodentium enthält keine Shiga Toxin (Stx)30, das ist eine dominante Virulenzfaktor, das Nierenversagen bei EHEC, vor allem Serotyp O157: H73verursacht. Obwohl eine Stx exprimierenden C. Rodentium Belastung konstruiert worden vor kurzem31, die realistischer, EHEC-Infektion ist, andere potentiellen EHEC Virulenzfaktoren schließt nicht, die entscheidend für die Kolonisation und/oder Infektion. Darüber hinaus teilt C. Rodentium 67 % seiner Gene mit EHEC32, was darauf hindeutet, dass EHEC eine Virulenz unterscheidet sich von C. Rodentium während der Kolonisation und/oder Infektion verwenden dürfen.

Die Luciferase Plasmid verwendet hier, pWF27913, zum Ausdruck zu bringen wurde von pAKlux29 geändert, deren Rückgrat pBBR1MCS433ist. Obwohl pBBR1MCS4 getestet und in verschiedenen Bakterien33repliziert wurden, ist es wichtig, die Herkunft dieses Plasmid-Replikation (ORI) eignet sich für den bakteriellen Host vor der Verwendung dieses Plasmid-basierte Luciferase-Systems für das Experiment zu gewährleisten und und bestätigt damit, dass dieser Ausdruck Plasmid Luciferase in der bakteriellen Host replizieren kann. Wir verwenden zur Erhaltung der Stabilität des Plasmids in die Bakterien Antibiotika Stress. Wenn Bakterien in das Fehlen von Antibiotika Tiere eingeben, wurde die biolumineszente Signal von Wildtyp EHEC für mindestens 2 Tage festgestellt. Jedoch wir nicht nach Infektion länger als 2 Tage, weil wir bereits, einen signifikanten Unterschied in der leuchtenden Intensität zwischen EHEC WT und EHEC RfaD gesehen hatte (das ein Gen für EHEC Synthese intakt LPS erforderlichen kodiert) mutierte 2 Tage. Um das Plasmid stabil in Bakterien unter der Abwesenheit von Antibiotika erhalten, kann ein Plasmid pCM1710,34 für diesen Zweck verwendet werden. pCM17 kodiert eine Partitionierung zwei-Plasmid-System und ein post-segregational Tötung-Mechanismus des Plasmids in Bakterien ohne Antibiotika10,34aufrechtzuerhalten. Das Plasmid pCM17 mit der LuxCDABE -Operon, angetrieben durch den Projektträger OmpC durch Biolumineszenz Signal für mindestens 7 Tage8nachgewiesen werden kann. Eine alternative Methode, um eine kontinuierliche Biolumineszenz Ausdruck Bakterien in der Abwesenheit von Antibiotika zu erhalten ist, LuxABCDE gen in das bakterielle Chromosom35einführen. Francis Et Al. verwendet Transposon eingefügt LuxABCDE Operon und Antibiotika Kassette in das Chromosom von Streptococcus Pneumoniae der Biolumineszenz stabile Sorte35erhalten nach dem Zufallsprinzip eingefügt.

In unserem vorherigen Studie13haben wir dieses Modellsystem EHEC Kolonisation in einem Wirt zu untersuchen und vergleichen die Differenz der Kolonisation Fähigkeit zwischen den EHEC-Wildtyp (WT) und mutierten13verwendet. Bei Mäusen verabreicht wurden die Biolumineszenz EHEC RfaD Mutante, die Biolumineszenz Signale drastisch vermindert im Vergleich zu, dass der WT EHEC nach 2 Tagen-Infektion Post. Freuen Sie sich auf Beweise dafür, dass diese Mausmodell die Mutation Wirkung von EHEC Kolonisation im Aufnahmemitgliedstaat analysieren kann. Darüber hinaus therapeutische Behandlungen zur Reduzierung der Besiedlung von EHEC ist eine überlegte, potenzielle Lösung für EHEC-Infektion da der Einsatz von Antibiotika kontraindiziert5,36. Daher lohnt es sich testen ob dieses Modellsystem verwendet werden kann, die Wirksamkeit von Anti-Kolonisierung Medikamente/Behandlungen gegen Enterobakterien Kolonisation in den Host zu prüfen. Wir glauben, dass durch die Verwendung dieses Modellsystem, es möglich ist, den Zeitpunkt und Ort der nicht nur EHEC, aber auch andere Enterobakterien Kolonisation in Vivozu untersuchen. Mithilfe dieses Tiermodell lässt sich des Prozess der EHEC Kolonisation in Mäusen und die Kolonisation Belastung im Host quantifiziert werden kann, um räumliche und zeitliche Kolonisation von EHEC mit lebenden Tieren zu bestimmen. Die Visualisierung und Quantifizierung von Enterobakterien Besiedlung durch Verwendung dieses Modells ist es ein großartiges Werkzeug zu untersuchen und analysieren die feinen Mechanismen der enterobacterial Besiedlung und der Mangel an Kolonisation Forschung zu kompensieren und Aktuelles Wissen zu verbessern.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren haben nichts preisgeben.

Acknowledgments

Wir erkennen Chi-Chung Chen von der Abteilung der medizinischen Forschung, Chi Mei Medical Center (Tainan, Taiwan) für die Hilfe bei der Maus Infektion und die Unterstützung durch das Labor Animal Center der National Cheng Kung University. Diese Arbeit wird unterstützt durch den Minister für Wissenschaft und Technologie (MOST) gewährt (die meisten 104-2321-B-006-019, 105-2321-B-006-011, and106-2321-B-006-005) CC.

Materials

Name Company Catalog Number Comments
Shaker incubator YIH DER LM-570R bacteria incubation 
Orbital shaking incubator FIRSTEK S300 bacteria incubation 
pBSL180 source of nptII gene
pAKlux2 source of luxCDABE operon
T&A Cloning Kit Yeastern Biotech FYC001-20P use for TA cloning 
Nsi I NEB R0127S use for plasmid cloning 
Sca I NEB R0122S use for plasmid cloning 
Spe I-HF NEB R0133S use for plasmid cloning 
Sma NEB R0141S use for plasmid cloning 
T4 ligase NEB M0202S use for plasmid cloning 
Ex Taq TaKaRa RR001A use for PCR amplification
10X Ex Taq Buffer TaKaRa RR001A use for PCR amplification
dNTP Mixture  TaKaRa RR001A use for PCR amplification
PCR machine applied Biosystem  2720 thermal cycler   for PCR amplification
Glycerol SIGMA G5516-1L use for bacteria stocking solution
NaCl Sigma 31434-5KG-R chemical for making LB medium, 10 g/L
Tryptone CONDA pronadisa Cat 1612.00 chemical for making LB medium, 10 g/L
Yeast Extract powder Affymetrix 23547-1 KG chemical for making LB medium, 5 g/L
Agar CONDA pronadisa Cat 1802.00 chemical for making LB agar
kanamycin  Sigma K4000-5G antibiotics, use for seleciton
streptomycin  Sigma S6501-100G antibiotics, eliminate the microbiota in mice
EDL933 competent cell Homemade method is on supplemental document 
Electroporator MicroPulser for electroporation
Electroporation Cuvettes Gene Pulser/MicroPulser 1652086 for electroporation
High-speed centrifuge Beckman Coulter Avanti, J-26S XP use for centrifuging bacteria 
Fixed-Angle Rotor Beckman Coulter JA25.5 use for centrifuging bacteria 
Fixed-Angle Rotor Beckman Coulter JLA10.5 use for centrifuging bacteria 
centrifuge bottles Beckman Coulter REF357003 use for centrifuging bacteria 
centrifuge bottles Thermo Fisher scientific 3141-0500 use for centrifuging bacteria 
eppendorf biophotometer plus  eppendorf AG 22331 hamburg for measuring the OD600 value of bacteria
C57BL/6 mice  Laboratory Animal Center of NCKU
lab coat, gloves for personnel protection 
isoflurane  Panion & BF Biotech Inc. G-8669 for mice anesthesia, pharmaceutical grade
1ml syringe  use for oral gavage of mice
Reusable 22 G ball-tipped feeding needle φ0.9 mm X L 50 mm use for oral gavage of mice
surgical  scissors  use for mice experiment
Xenogen IVIS 200 imaging system Perkin Elmer IVIS spectrum use for bioluminescent image capture 
Living Image Software Perkin Elmer version 4.1 use for quantifying the image data

DOWNLOAD MATERIALS LIST

References

  1. Pennington, H. Escherichia coli O157. Lancet. 376, (9750), 1428-1435 (2010).
  2. Mayer, C. L., Leibowitz, C. S., Kurosawa, S., Stearns-Kurosawa, D. J. Shiga toxins and the pathophysiology of hemolytic uremic syndrome in humans and animals. Toxins (Basel). 4, (11), 1261-1287 (2012).
  3. Tarr, P. I., Gordon, C. A., Chandler, W. L. Shiga-toxin-producing Escherichia coli and haemolytic uraemic syndrome. Lancet. 365, (9464), 1073-1086 (2005).
  4. Obrig, T. G. Escherichia coli Shiga Toxin Mechanisms of Action in Renal Disease. Toxins (Basel). 2, (12), 2769-2794 (2010).
  5. Nguyen, Y., Sperandio, V. Enterohemorrhagic E. coli (EHEC) pathogenesis. Front Cell Infect Microbiol. 2, 90 (2012).
  6. Wiles, S., Robertson, B. D., Frankel, G., Kerton, A. Bioluminescent monitoring of in vivo colonization and clearance dynamics by light-emitting bacteria. Methods Mol Biol. 574, 137-153 (2009).
  7. Hutchens, M., Luker, G. D. Applications of bioluminescence imaging to the study of infectious diseases. Cell Microbiol. 9, (10), 2315-2322 (2007).
  8. Rhee, K. J., et al. Determination of spatial and temporal colonization of enteropathogenic E. coli and enterohemorrhagic E. coli in mice using bioluminescent in vivo imaging. Gut Microbes. 2, (1), 34-41 (2011).
  9. Karsi, A., Lawrence, M. L. Broad host range fluorescence and bioluminescence expression vectors for Gram-negative bacteria. Plasmid. 57, (3), 286-295 (2007).
  10. Lane, M. C., Alteri, C. J. S., Smith, S. N., Mobley, L. H. Expression of flagella is coincident with uropathogenic Escherichia coli ascension to the upper urinary tract. Proc Natl Acad Sci U S A. 104, (42), 16669-16674 (2007).
  11. Roxas, J. L., et al. Enterohemorrhagic E. coli alters murine intestinal epithelial tight junction protein expression and barrier function in a Shiga toxin independent manner. Lab Invest. 90, (8), 1152-1168 (2010).
  12. Siragusa, G. R., Nawotka, K., Spilman, S. D., Contag, P. R., Contag, C. H. Real-Time Monitoring of Escherichia coli O157:H7 Adherence to Beef Carcass Surface Tissues with a Bioluminescent Reporter. (1999).
  13. Kuo, C. J., et al. Mutation of the Enterohemorrhagic Escherichia coli Core LPS Biosynthesis Enzyme RfaD Confers Hypersusceptibility to Host Intestinal Innate Immunity In vivo. Front Cell Infect Microbiol. 6, 82 (2016).
  14. Wiles, S., et al. Organ specificity, colonization and clearance dynamics in vivo following oral challenges with the murine pathogen Citrobacter rodentium. Cell Microbiol. 6, (10), 963-972 (2004).
  15. Wiles, S., Pickard, K. M., Peng, K., MacDonald, T. T., Frankel, G. In vivo bioluminescence imaging of the murine pathogen Citrobacter rodentium. Infect Immun. 74, (9), 5391-5396 (2006).
  16. Contag, C. H., Contag, P. R., Mullins, J. I., Spillman, S. D., Stevenson, D. K., Benaron, D. A. Photonic detection of bacterial pathogens in living hosts. Mol Microbiol. 18, (4), 593-603 (1995).
  17. Hardy, J., Francis, K. P., DeBoer, M., Chu, P., Gibbs, K., Contag, C. H. Extracellular replication of Listeria monocytogenes in the murine gall bladder. Science. 303, (5659), 851-853 (2004).
  18. Kaniga, K., Sory, M. P., Delor, I., Saegerman, C., Limet, J. N., Cornelis, G. R. Monitoring of Yersinia enterocolitica in Murine and Bovine Feces on the Basis of the Chromosomally Integrated luxAB Marker Gene. Appl Environ Microbiol. 58, (3), 1024-1026 (1992).
  19. Trcek, J., Fuchs, T. M., Trulzsch, K. Analysis of Yersinia enterocolitica invasin expression in vitro and in vivo using a novel luxCDABE reporter system. Microbiology. 156, (Pt 9), 2734-2745 (2010).
  20. Morin, C. E., Kaper, J. B. Use of stabilized luciferase-expressing plasmids to examine in vivo-induced promoters in the Vibrio cholerae vaccine strain CVD 103-HgR. FEMS Immunol Med Microbiol. 57, (1), 69-79 (2009).
  21. Law, R. J., Gur-Arie, L., Rosenshine, I., Finlay, B. B. In vitro and in vivo model systems for studying enteropathogenic Escherichia coli infections. Cold Spring Harb Perspect Med. 3, (3), a009977 (2013).
  22. Ritchie, J. M. Animal Models of Enterohemorrhagic Escherichia coli Infection. Microbiol Spectr. 2, (4), EHEC-0022-2013 (2014).
  23. Chou, T. C., et al. Enterohaemorrhagic Escherichia coli O157:H7 Shiga-like toxin 1 is required for full pathogenicity and activation of the p38 mitogen-activated protein kinase pathway in Caenorhabditis elegans. Cell Microbiol. 15, (1), 82-97 (2013).
  24. Alexeyev, M. F., Shokolenko, I. N. Mini-Tnl 0 transposon derivatives for insertion mutagenesis and gene delivery into the chromosome of Gram-negative bacteria. Gene. 160, (1), 59-62 (1995).
  25. Wiegand, I., Hilpert, K., Hancock, R. E. Agar and broth dilution methods to determine the minimal inhibitory concentration (MIC) of antimicrobial substances. Nat Protoc. 3, (2), 163-175 (2008).
  26. Pansare, V., Hejazi, S., Faenza, W., Prud'homme, R. K. Review of Long-Wavelength Optical and NIR Imaging Materials: Contrast Agents, Fluorophores and Multifunctional Nano Carriers. Chem Mater. 24, (5), 812-827 (2012).
  27. Heim, R., Cubitt, A. B., Tsien, R. Y. Improved green fluorescence. Nature. 373, (6516), 663-664 (1995).
  28. Weissleder, R. A clearer vision for in vivo imaging. Nat Biotechnol. 19, (4), 316-317 (2001).
  29. Frangioni, J. In vivo near-infrared fluorescence imaging. Current Opinion in Chemical Biology. 7, (5), 626-634 (2003).
  30. Collins, J. W., et al. Citrobacter rodentium: infection, inflammation and the microbiota. Nat Rev Microbiol. 12, (9), 612-623 (2014).
  31. Mallick, E. M., et al. A novel murine infection model for Shiga toxin-producing Escherichia coli. J Clin Invest. 122, (11), 4012-4024 (2012).
  32. Petty, N. K., et al. The Citrobacter rodentium genome sequence reveals convergent evolution with human pathogenic Escherichia coli. J Bacteriol. 192, (2), 525-538 (2010).
  33. Kovach, M. E., Elzer, P. H., Hill, D. S., Robertson , G. T., Farris, M. A., Roop, R. M. II, Peterson, K. M. Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene. 166, (1), 175-176 (1995).
  34. Galen, J. E., Nair, J., Wang , J. Y., Wasserman, S. S., Tanner, M. K., Sztein , M. B., Levine, M. M. Optimization of Plasmid Maintenance in the Attenuated Live Vector Vaccine Strain Salmonella typhiCVD 908-htrA. Infect Immun. 67, (12), 6424-6433 (1999).
  35. Francis, K. P., et al. Visualizing pneumococcal infections in the lungs of live mice using bioluminescent Streptococcus pneumoniae transformed with a novel gram-positive lux transposon. Infect Immun. 69, (5), 3350-3358 (2001).
  36. Goldwater, P. N., Bettelheim, K. A. Treatment of enterohemorrhagic Escherichia coli (EHEC) infection and hemolytic uremic syndrome (HUS). BMC Med. 10, (2012).
Erkennung von Enterohemorrhagic <em>Escherichia Coli</em> Besiedlung in murinen Host durch nicht-invasive <em>In Vivo</em> Biolumineszenz-System
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Kuo, C. J., Wang, S. T., Chen, C. S. Detection of Enterohemorrhagic Escherichia Coli Colonization in Murine Host by Non-invasive In Vivo Bioluminescence System. J. Vis. Exp. (134), e56169, doi:10.3791/56169 (2018).More

Kuo, C. J., Wang, S. T., Chen, C. S. Detection of Enterohemorrhagic Escherichia Coli Colonization in Murine Host by Non-invasive In Vivo Bioluminescence System. J. Vis. Exp. (134), e56169, doi:10.3791/56169 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter