Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Vivo Bioluminescence System में गैर-इनवेसिव द्वारा Murine होस्ट में Enterohemorrhagic ई कोलाई औपनिवेशीकरण का पता लगाना

doi: 10.3791/56169 Published: April 9, 2018

Summary

bioluminescence-लेबल किए गए बैक्टीरिया का उपयोग करके enterohemorrhagic ई. कोलाई (EHEC) औपनिवेशीकरण के लिए माउस मॉडल का एक विस्तृत प्रोटोकॉल प्रस्तुत किया है । एक गैर द्वारा इन bioluminescent बैक्टीरिया का पता लगाने के जीवित पशुओं में vivo इमेजिंग प्रणाली में इनवेसिव EHEC औपनिवेशीकरण की हमारी वर्तमान समझ अग्रिम कर सकते हैं ।

Abstract

Enterohemorrhagic ई. कोलाई (EHEC) O157: H7, जो एक foodborne रोगज़नक़ कि causesdiarrhea, रक्तस्रावी कोलाइटिस (एच एस), और रक्तलायी uremic सिंड्रोम (ःस), मनुष्यों के आंत्र पथ के लिए उपनिवेश है । vivo में EHEC औपनिवेशीकरण के विस्तृत तंत्र का अध्ययन करने के लिए, यह EHEC औपनिवेशीकरण पर नजर रखने और अंदाज लगाने के लिए पशु मॉडलों के लिए आवश्यक है । हम यहां एक माउस-EHEC औपनिवेशीकरण मॉडल को बदलने के लिए EHEC एक्सप्रेस प्लाज्मिड के लिए निगरानी और रहने वाले मेजबान में EHEC औपनिवेशीकरण यों को दर्शाता है । bioluminescence के साथ inoculated जानवरों-लेबल EHEC vivo इमेजिंग प्रणाली में एक गैर इनवेसिव के साथ पता लगाने के द्वारा चूहों में तीव्र bioluminescent संकेतों दिखाएँ. 1 और 2 दिनों के बाद संक्रमण के बाद, bioluminescent संकेतों अभी भी संक्रमित पशुओं में पता लगाया जा सकता है, जो पता चलता है कि EHEC उपनिवेश मेजबान में कम 2 दिनों के लिए । हम यह भी प्रदर्शित करते है कि इन bioluminescent EHEC माउस आंत को खोजने के लिए, विशेष रूप से अंधान्त्र और बृहदांत्र में, पूर्व vivo छवियों से । इस माउस-EHEC औपनिवेशीकरण मॉडल EHEC औपनिवेशीकरण तंत्र के वर्तमान ज्ञान अग्रिम करने के लिए एक उपकरण के रूप में सेवा कर सकते हैं ।

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

EHEC O157: H7 एक रोगज़नक़ कि दस्त का कारण बनता है1, एच एस2, ःस3, और यहां तक कि तीव्र गुर्दे की विफलता4 दूषित पानी या भोजन के माध्यम से. EHEC एक रोगजनक enterobacterium और उपनिवेश करता मनुष्यों के जठरांत्र संबंधी मार्ग के लिए है 1 । जब EHEC पहले आंत्र उपकला मेजबान का पालन करें, वे प्रकार III स्राव प्रणाली के माध्यम से मेजबान कोशिकाओं में औपनिवेशीकरण कारकों सुई (T3SS) कि एक आणविक एक संलग्न और effacing के रूप में उत्प्रेरण सिरिंज के रूप में कार्य करता है (एक/ई) घाव बाद में लागू करने के लिए आसंजन (औपनिवेशीकरण)5. ए/ई घावों के गठन में शामिल इन जीनों enterocyte effacement (ली) pathogenicity द्वीप5के लोकस द्वारा इनकोडिंग हैं ।

Bioluminescence एक प्रकाश उत्पादन रासायनिक प्रतिक्रिया है, जिसमें luciferase catalyzes अपने सब्सट्रेट luciferin दृश्य प्रकाश6उत्पन्न करने के लिए है. इस एंजाइमी प्रक्रिया में अक्सर ऑक्सीजन या adenosine ट्राइफॉस्फेट (एटीपी) की उपस्थिति की आवश्यकता होती है6. Bioluminescence इमेजिंग (BLI) शोधकर्ताओं दृश्य और मेजबान के परिमाणीकरण-रहते जानवरों में रोगज़नक़ बातचीत की अनुमति देता है7. BLI bioluminescent बैक्टीरिया का पालन करके जीवित पशुओं में जीवाणु संक्रमण चक्र को चिह्नित कर सकते हैं के रूप में वे करने के लिए विस्थापित और विभिन्न ऊतकों पर आक्रमण7; यह संक्रमण की एक गतिशील प्रगति का पता चलता है । इसके अलावा, जानवरों में बैक्टीरियल लोड bioluminescent संकेत से संबंधित है8; इस प्रकार, एक सरल और प्रत्यक्ष तरीके से प्रयोगात्मक पशुओं की रोग स्थितियों का अनुमान लगाने के लिए एक सुविधाजनक संकेतक है ।

प्लाज्मिड यहां इस्तेमाल किया luciferase ऑपरोन, luxCDABE, जो जीवाणु Photorhabdus luminescens है कि अपने luciferase सब्सट्रेट7,9encodings से है निहित । इस luciferase-व्यक्त प्लाज्मिड को जीवाणुओं में परिवर्तित करके, औपनिवेशीकरण और संक्रमण प्रक्रियाओं को जीवित पशुओं में इन bioluminescent जीवाणुओं को देख कर निगरानी की जा सकती है. कुल मिलाकर, BLI और bioluminescence-लेबल बैक्टीरिया जीवाणु संख्या और स्थान की निगरानी करने के लिए शोधकर्ताओं की अनुमति, एंटीबायोटिक दवाओं के साथ बैक्टीरियल व्यवहार्यता/औपनिवेशीकरण6, और जीवाणु जीन अभिव्यक्ति संक्रमण में/ 7. कई रोगजनक बैक्टीरिया सूचित किया गया है कि एक्सप्रेस luxCDABE ऑपरोन अपने संक्रमण चक्र और संक्रमण में जीन अभिव्यक्ति की जांच करने के लिए । ये जीवाणु, जिनमें uropathogenic ई. कोलाई10, EHEC8,11,12,13, enteropathogenic ई. कोलाई (EPEC)8, Citrobacter rodentium14,15, साल्मोनेला typhimurium16, लिस्टिरिया monocytogenes17, Yersinia enterocolitica18,19, और Vibrio हैजा20, प्रलेखित किया गया है ।

कई प्रायोगिक मॉडल विकसित किया गया है EHEC औपनिवेशीकरण के अध्ययन की सुविधा के लिए इन विट्रो में और vivo में21,22,23. हालांकि, वहां उपयुक्त पशु मॉडलों की कमी के लिए vivo मेंEHEC औपनिवेशीकरण अध्ययन है, और इस तरह के विवरण के परिणामस्वरूप धनाभाव । vivo मेंEHEC औपनिवेशीकरण तंत्र के अध्ययन की सुविधा के लिए, यह एक गैर इनवेसिव विधि में जीवित पशुओं में EHEC औपनिवेशीकरण का पालन करने के लिए पशु मॉडल का निर्माण करने के लिए मूल्यवान है ।

इस पांडुलिपि का वर्णन एक माउस-EHEC औपनिवेशीकरण मॉडल है कि एक bioluminescent एक्सप्रेस प्रणाली का उपयोग करता है EHEC औपनिवेशीकरण के रहने वाले मेजबान में समय पर नजर रखने के लिए । चूहों bioluminescence-लेबल EHEC के साथ intragastrically inoculated है और bioluminescent संकेत चूहों में एक गैर इनवेसिव vivo इमेजिंग प्रणाली13 में पता चला है. चूहों bioluminescence से संक्रमित-लेबल EHEC 2 दिनों के बाद संक्रमण, जो सुझाव दिया कि उन बैक्टीरिया मेजबान आंत में बृहदांत्र के बाद 2 दिन के बाद संक्रमण के बाद उनकी आंत में महत्वपूर्ण bioluminescent संकेत दिखाया । पूर्व विवो छवि डेटा से पता चला है कि यह औपनिवेशीकरण विशेष रूप से चूहों की अंधान्त्र और बृहदांत्र में है । इस माउस-EHEC मॉडल का उपयोग करके, bioluminescent EHEC औपनिवेशीकरण में एक vivo इमेजिंग प्रणाली द्वारा जीवित मेजबान में पता लगाया जा सकता है, के लिए प्रवेश बैक्टीरिया औपनिवेशीकरण के विस्तृत तंत्र का अध्ययन, जो आगे की समझ को बढ़ावा देने में हो सकता है EHEC-प्रेरित शारीरिक और रोग परिवर्तन ।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

सावधानी: EHEC O157: H7 रोग नियंत्रण और रोकथाम (सीडीसी) के लिए केंद्र के अनुसार एक सुरक्षा स्तर 2 (बीएसएल-2) रोगज़नक़-सुरक्षा निर्देश (https://www.cdc.gov/) है । इसलिए, सभी प्रयोगात्मक EHEC शामिल प्रक्रियाओं एक बीएसएल में प्रदर्शन किया जाना चाहिए-2 सुविधा । प्रयोग प्रदर्शन करते हुए लैब कोट और दस्ताने पहनें । एक प्रमाणित सुरक्षा कैबिनेट (बीएससी) में काम करते हैं । प्रयोगात्मक पीठ से पहले और 70% इथेनॉल के साथ प्रयोगात्मक प्रक्रिया के बाद को संक्रमित । सभी उपकरणों या उपकरण है कि संपर्क (या संभावित संपर्क) EHEC 70% इथेनॉल या ब्लीच के साथ संक्रमित किया जाना चाहिए । दूषित (या संभावित रूप से दूषित) अपशिष्टों को सील किया जाना चाहिए और सावधानीपूर्वक autoclaved करना चाहिए । एक मुखौटा, आंख संरक्षण, डबल दस्ताने या एक jumpsuit, यदि आवश्यक पहनें । 6 सप्ताह पुराने C57BL/6 महिला चूहों को खरीदा गया था और राष्ट्रीय चेंग कुंग विश्वविद्यालय (NCKU) के प्रयोगशाला पशु केंद्र में बनाए रखा । पशु प्रयोगों को संस्थागत पशु परिचर्या और NCKU की उपयोग समिति (अनुमोदन संख्या 104-039) द्वारा अनुमोदित किया गया.

१. Bioluciferase-त्यसपछि EHEC जीवाणु उत्पादन

  1. मिश्रण 50 एनजी deoxyribonucleic एसिड (डीएनए), 1 μL 10 माइक्रोन फॉरवर्ड और रिवर्स प्राइमरों में से प्रत्येक, 2 μL 2.5 mM deoxynucleotides (dNTPs), 2 μL 10x बफर, 0.2 μL डीएनए पोलीमरेज़, और बाँझ डबल आसुत पानी (ddH2O) 20 μL के एक अंतिम मात्रा को बढ़ाना विरोधी कनमीसिन कैसेट, nptII जीन24। डीएनए टेम्प्लेट pBSL18024से है, जो नैशनल के रिसोर्स प्रोजेक्ट (NBRP) से खरीदा गया है । पीसीआर शर्तों तालिका 1 में सूचीबद्ध है और प्राइमर अनुक्रम तालिका 2में उपलब्ध है ।
  2. Ligate किट प्रोटोकॉल के बाद एक वाणिज्यिक क्लोनिंग वेक्टर के लिए पीसीआर उत्पादों ( सामग्री की तालिकादेखें) ।
  3. आबकारी की क्लोनिंग वेक्टर से nptII जीन अंश को NsiI और SmaI और क्लोन करके pBBR1MCS4 में, जो NsiI और ScaI से पच जाता है pAKlux29 से कनमीसिन प्रतिरोधी प्लाज्मिड बनाने के लिए, pWF278१३
  4. उत् पाद शुल् क को luxCDABE ऑपरोन, luciferase व्यक्त से प्लाज्मिड9, pAKlux2, द्वारा SpeI-HF और ScaI और क्लोन को SpeI-HF और SmaI पच pWF278 उत्पन्न करने कनमीसिन प्रतिरोधी र luciferase व्यक्त प्लाज्मिड, pWF279१३
    नोट: प्लाज्मिड निकालने और उत्पाद का टुकड़ा शुद्धिकरण के लिए, वाणिज्यिक प्लाज्मिड निष्कर्षण और जेल निष्कर्षण किट, क्रमशः का उपयोग करें । एंजाइम पाचन के लिए, मिश्रण 100 एनजी डीएनए, 1 μL 10x बफर, 1 प्रत्येक चयनित प्रतिबंध एंजाइम के μL, और बाँझ ddH2O की कुल मात्रा को 10 μL, और 2.5 के लिए 37 ° c-3 ज में मशीन ।
  5. pWF279 प्लाज्मिड को ई. कोलाई O157: H7 EDL933 सक्षम कोशिकाओं में रूपांतरित electroporation द्वारा 2,500 वी के लिए 4 ms.
  6. 1 एमएल Luria-Bertani (पौंड) मध्यम 37 डिग्री सेल्सियस में रूपांतरित जीवाणु कोशिकाओं को 1 एच के लिए मशीन ।
  7. प्लेट पर जीवाणु एक पौंड आगर प्लेट के साथ पूरक 50 µ g/एमएल कनमीसिन के 37 डिग्री सेल्सियस पर 16-18 ज के लिए ।
  8. एक vivo इमेजिंग मशीन में अगले दिन प्लेट के bioluminescent संकेत की जांच करें । थाली और संस्कृति से एक एकल कॉलोनी उठाओ यह 3 मिलीलीटर पौंड में 50 µ g/एमएल कनमीसिन 37 डिग्री सेल्सियस के लिए 16-18 ज के साथ पूरक ।
  9. कमजोर द्वारा बैक्टीरियल स्टॉक मीडियम तैयार करें 100% ग्लिसरॉल में बाँझ ddH2हे बनाने के लिए 30% ग्लिसरॉल समाधान.
  10. फ्रीज कनमीसिन प्रतिरोधी ई. कोलाई O157: H7 EDL933 बैक्टीरिया एक पेंच टोपी में एक जीवाणु शेयर के रूप में luciferase प्लाज्मिड बंदरगाह बैक्टीरिया संस्कृति और 30% cryovial समाधान पर-80 डिग्री सेल्सियस के एक 1:1 अनुपात के रूप में ग्लिसरॉल । ग्लिसरॉल की अंतिम एकाग्रता 15% है ।

2. ओरल टीका के लिए Bioluminescent EHEC बैक्टीरिया तैयार करना

नोट: EHEC तैयारी और माउस मौखिक gavage के लिए प्रयोगात्मक प्रक्रियाओं की समयरेखा फ़्लोचार्ट चित्रा 1 में प्रयोगात्मक तैयारी में सहायता करने के लिए प्रस्तुत किया है ।

  1. लकीर ई. कोलाई O157: H7 EDL933 बैक्टीरिया एक पौंड आगर प्लेट पर luciferase प्लाज्मिड के साथ 50 µ जी/एमएल कनमीसिन से-80 ° c स्टॉक । 37 डिग्री सेल्सियस पर 16-18 ज के लिए बैक्टीरिया बढ़ने ।
  2. 220 आरपीएम पर एक 37 डिग्री सेल्सियस में 16-18 एच के लिए 50 µ जी/एमएल कनमीसिन के साथ 3 मिलीलीटर पौंड मध्यम में रातोंरात थाली और संस्कृति से एक भी कॉलोनी उठाओ ।
  3. उपसंस्कृति बैक्टीरिया (कनमीसिन में 1:100 कमजोर पड़ने) (50 µ जी/एमएल) 2.5-3 एच के लिए पौंड शोरबा युक्त एक 37 डिग्री सेल्सियस में 200 rpm पर । (उदाहरण के लिए, कनमीसिन (50 µ g/एमएल) पूरक के साथ 200 मिलीलीटर पौंड मध्यम करने के लिए 2 मिलीलीटर रातोंरात संस्कृतिी बैक्टीरिया जोड़ें) ।
  4. 2.5-3 एच के लिए बैक्टीरिया की मशीन और 600 एनएम (आयुध डिपो600) पर ऑप्टिकल घनत्व मूल्य मापने जब तक मूल्य 0.9 के बीच है 1 । बैक्टीरियल कोशिका संख्या के बारे में 108 कॉलोनी बनाने इकाइयों (CFU) के घनत्व पर है/mL.
  5. 30 मिनट, 4 डिग्री सेल्सियस के लिए 8,000 x जी में फिर से संस्कृति वाले बैक्टीरिया केंद्रापसारक ।
  6. जीवाणुओं की गोली आंदोलन के बिना supernatant त्यागें और 100 मिलीलीटर 0.9% के साथ गोली धोने कोमल आंदोलन से बाँझ सामांय खारा ।
  7. दोहराएं चरण 2.5 और 2.6 एक बार ।
  8. धोने के बाद, 30 मिनट, 4 डिग्री सेल्सियस के लिए 8,000 x जी में बैक्टीरियल संस्कृति केंद्रापसारक और धीरे supernatant त्यागें ।
  9. घनीभूत 100 पर गोली-0.9% बाँझ सामांय खारा के साथ गुना । उदाहरण के लिए, यदि 200 मिलीलीटर बैक्टीरिया केंद्रापसारक हैं, 2 मिलीलीटर सामांय खारा को गोली से निलंबित जोड़ें ।
  10. बैक्टीरिया CFU की पुष्टि करें (यह लगभग होना चाहिए 109 CFU/100 μL सामांय खारा में संघनित्र के बाद) एक 10 गुना सीरियल कमजोर पड़ने के माध्यम से केंद्रित बैक्टीरिया चढ़ाना द्वारा25

3. माउस ओरल Gavage ऑफ EHEC

  1. 6-सप्ताहीय मादा C57BL/6 चूहों को streptomycin पानी (5 ग्राम/एल) के साथ 24 एच के लिए उपचारित करें ।
  2. 24 घंटे के बाद, gavage से पहले एक और 24 घंटे के लिए नियमित रूप से पीने के पानी के लिए स्विच । 24 ज के लिए नियमित रूप से पानी के साथ इलाज के बाद, चूहों EHEC के मौखिक gavage के लिए तैयार हैं ।
  3. गोताख़ोर पर वापस खींच कर 100 μL EHEC बैक्टीरिया के साथ सिरिंज भरें । सुनिश्चित करें कि कोई हवा बुलबुले सिरिंज में हैं । उंगलियों के साथ सिरिंज तड़क द्वारा बुलबुले निकालें.
  4. धीरे से जानवर उठा और यह देखभाल के साथ पिंजरे के शीर्ष पर जगह है ।
  5. पूंछ ध्यान से माउस समझ, और पशु पिंजरे के ऊपर पकड़ और दूर जाने का प्रयास करेंगे ।
  6. धीरे गर्दन और अंगूठे और तर्जनी के साथ पशु के पीछे की ढीली त्वचा लोभी द्वारा माउस के सिर को रोकने के लिए आगे बढ़ने से रोकना ।
  7. gavage सुई डालने और माउस के सिर स्थिर और ऊर्ध्वाधर है सुनिश्चित करने के लिए एक ऊर्ध्वाधर स्थिति में माउस पकड़ो ।
  8. मुंह की छत के बाद माउस मुंह में gavage सुई डालें और घेघा में नीचे ले जाएं और पेट की ओर ।
  9. जब डाला सुई माउस में आधा या दो तिहाई लंबाई है, 100 μL EHEC बैक्टीरिया है, जो लगभग 109 CFU कोशिकाओं को शामिल इंजेक्षन ।

4. दृश्य

  1. ओरल gavage के बाद, 1 और 2 दिन पर bioluminescent संकेतों का पता लगाएं ।
  2. जानवरों के bioluminescent संकेतों की जांच करने से पहले, उन्हें 1.5 L/न्यूनतम ऑक्सीजन के साथ 2.5% isoflurane के चैंबर में डाल कर anesthetize ।
  3. 2-5 मिनट के लिए रुको जब तक सभी चूहों बेहोश हो जाते है और चलती बंद करो । पशु bioluminescence का पता लगाने में के लिए तैयार हैं ।
  4. का पता लगाने और छवि एक vivo इमेजिंग प्रणाली में द्वारा पशुओं के bioluminescent संकेतों । कृपया सॉफ़्टवेयर कार्रवाई के लिए अनुभाग 5 "डेटा प्राप्ति" देखें । इमेजिंग प्रक्रिया के दौरान, सभी जानवरों 1.5 L/न्यूनतम ऑक्सीजन के साथ 2.5% isoflurane की एक निरंतर आपूर्ति के तहत कर रहे हैं ।
    1. फ़ाइल > लाइव क्लिक करें, और मैंयुअल रूप से माउस पर ध्यान दें ।
    2. जोखिम समय और लेजर तीव्रता का चयन करें ।
    3. मोल > कैप्चर पर क्लिक करें.
  5. पूर्व vivo इमेजिंग के लिए, गर्भाशय ग्रीवा विस्थापन द्वारा चूहों euthanize और संक्रमित चूहों की पूरी आंत को दूर । एक 9-cm पेट्री डिश और इमेज में आंतों को वीवो इमेजिंग सिस्टम में रखें । सेटिंग के समान है vivo इमेजिंग में को छोड़कर दृश्य के फ़ील्ड के रूप में सेट है A/B । विवरण के लिए कृपया अनुभाग 5 "डेटा प्राप्ति" देखें ।
    नोट: गर्भाशय ग्रीवा के विस्थापन के लिए विधि: पिंजरे के शीर्ष पर चूहों एक हाथ से पूंछ लोभी इतना है कि जानवरों के पिंजरे पकड़ द्वारा नियंत्रित । एक मार्कर पेन या अंगूठे और दूसरी हाथ की पहली उंगली खोपड़ी के आधार पर गर्दन के पीछे के खिलाफ रखें । हाथ या वस्तु के साथ जल्दी से आगे धक्का जबकि सिर निरोधक और पूंछ पकड़े हाथ से पिछड़े खींच ।
    बारीकी से जांच करने के लिए श्वसन गिरफ्तारी की पुष्टि, और नहीं दिल की धड़कन ।

5. डाटा अधिग्रहण

नोट: डेटा प्राप्ति के लिए उपयोग किया जाने वाला सॉफ़्टवेयर सामग्री तालिकामें सूचीबद्ध होता है ।

  1. छवि प्राप्ति के लिए, सॉफ़्टवेयर का प्राप्ति नियंत्रण कक्ष खोलें (चित्र 2) ।
  2. "Luminescent," "फोटोग्राफ" और "ओवरले" का चयन करें ।
  3. "स्वतः" के रूप में एक्सपोज़र समय सेट करें सेट बिन्नी के रूप में "मध्यम ।
  4. सेट ƒ/luminescent के लिए 1 के रूप में बंद और फोटोग्राफ के लिए 8 । ƒ/बंद करो प्रकाश सीसीडी डिटेक्टर द्वारा प्राप्त की मात्रा नियंत्रित करता है ।
  5. प्राप्त करने के लिए ब्याज की छवियों के क्षेत्र के आधार पर दृश्य के क्षेत्र सेट करें । विकल्प "डी" पांच 6 सप्ताह पुराने चूहों और छवि उन सब को एक समय में फिट कर सकते हैं । "सी" एक क्षेत्र में तीन 6 सप्ताह पुराने चूहों छवि कर सकते हैं ।
  6. एक बार जब चूहों/नमूने इमेजिंग के लिए तैयार हैं, छवि अधिग्रहण के लिए "मोल" पर क्लिक करें ।
  7. वह छवि डेटा खोलें जिसे प्राप्त किया गया था ।
  8. उपकरण पैलेट पैनल (चित्र 3) खोलें ।
  9. ROI टूल चुनें. हम सर्कल (बाएं सबसे एक) छवियों पर bioluminescent क्षेत्र रेंज (चित्रा 4) की सिफारिश.
  10. सतह bioluminescent तीव्रता (चित्रा 3) को मापने के लिए "माप ROIs" (पेंसिल आइकन) पर क्लिक करें. रॉय माप पैनल और ठहराव मान दिखाई देते हैं (चित्र 5) ।
  11. मूल्य/आवश्यक जानकारी (चित्र 6) का चयन करने के लिए ROI मापन पैनल के बाएँ कोने पर कॉन्फ़िगर मापन का उपयोग करें, अन्यथा इस डेटा तालिका को निर्यात करने के लिए "निर्यात" पर क्लिक करके. csv फ़ाइल (चित्र 5) के रूप में सहेजें.
  12. csv फ़ाइल में bioluminescent तीव्रता ठहराव के रूप में "कुल प्रवाह (p/s)" स्तंभ के मान का उपयोग करें ।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

हम प्रशासित bioluminescence-EHEC लेबल (~ 109 बैक्टीरियल सेल) 6 सप्ताह पुरानी महिला C57BL/ 1 घंटे के भीतर चूहों को EHEC के मौखिक टीका के बाद, जानवरों के रूप में चित्रा 7में दिखाया गया है के रूप में vivo इमेजिंग प्रणाली द्वारा bioluminescent संकेत के लिए जांच की गई. परिणाम bioluminescence-लेबल EHEC के साथ gavage चूहों में एक मजबूत bioluminescent संकेत दिखाया । हम 2 दिनों के बाद संक्रमण पर संकेतों की जांच की । के रूप में चित्रा 8Aमें दिखाया गया है, चूहों bioluminescence के साथ inoculated-लेबल जंगली प्रकार EHEC EDL933 तीव्र bioluminescent संकेतों को भी 2 दिनों के बाद संक्रमण है, जो 2 दिनों से मेजबानों में EHEC बृहदांत्र सुझाव के बाद दिखाया । हम भी चूहों (चित्रा ΔrfaD) को संक्रमित bioluminescence-त्यसपछि EDL933ΔrfaD (8A) intragastrically । इस उत्परिवर्ती, lipopolysaccharide (एलपीएस) में दोष है, हमारे पिछले अध्ययन में मेजबान में औपनिवेशीकरण को कम करने के लिए दिखाया गया है । चित्रा 8Aमें दिखाया गया है, ΔrfaD-संक्रमित चूहों में पता चला है कि कोई bioluminescent संकेत है, जो पता चलता है कि वहाँ कोई या कम बैक्टीरिया कोशिकाओं चूहों में बृहदांत्र. ठहराव फ्लोरोसेंट सिग्नल की फिगर 8Bमें दिखाया गया है । अगले, इन bioluminescence-लेबल बैक्टीरिया का स्थान निर्धारित किया गया था । संक्रमित चूहों humanely बलिदान और उनकी पूरी आंत हटा दिया गया । चूहों की आंतों 2 दिनों के बाद संक्रमण 9 सेमी पेट्री व्यंजन पर तैनात थे और छवि ex vivo (चित्रा 9A) । bioluminescence के आंतों के ऊतकों-EDL933 संक्रमित चूहों अंधान्त्र और बृहदांत्र में bioluminescent संकेतों में एक महत्वपूर्ण वृद्धि का पता चला, जो सुझाव है कि इन bioluminescent EHEC और संक्रमित चूहों के बृहदांत्र में 2 दिनों के लिए बृहदांत्र में कम. इसके विपरीत, चूहों bioluminescence से संक्रमित-लेबल ΔrfaD (चित्रा 9A), उनके आंत्र ऊतक में कम bioluminescent संकेत पता चला, जो vivo में छवि के अनुरूप है (चित्रा 8A ). ठहराव फ्लोरोसेंट सिग्नल की फिगर 9Bमें दिखाया गया है ।

Figure 1
चित्र 1 : समयरेखा प्रायोगिक तैयारी प्रवाह चार्ट की ।
bioluminescent EHEC बैक्टीरिया और streptomycin के साथ चूहों का इलाज तैयार करने के लिए आवश्यक समय का अवलोकन. () EHEC तयारी. (B) चूहों की तैयारी । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 2
चित्र 2 : vivo में इमेजिंग सिस्टम प्राप्ति नियंत्रण कक्ष.
इमेजिंग नमूनों से पहले, IVIS प्राप्ति नियंत्रण कक्ष खोलें । "Luminescent," "फोटोग्राफ" और "ओवरले" का चयन करें । "स्वतः" के रूप में एक्सपोज़र समय सेट करें सेट बिन्नी के रूप में "मध्यम । सेट ƒ/luminescent के लिए 1 के रूप में बंद और फोटोग्राफ के लिए 8 । ƒ/बंद करो प्रकाश सीसीडी डिटेक्टर द्वारा प्राप्त की मात्रा नियंत्रित करता है । एक बार नमूनों इमेजिंग के लिए तैयार हैं, क्लिक करें "मोल" छवियों को प्राप्त करने के लिए । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 3
चित्र 3 : उपकरण पैलेट पैनल.
छवि प्राप्त करने के बाद, bioluminescent तीव्रता को बढ़ाता के लिए उपकरण पैलेट पैनल का उपयोग करें । उपकरण पैलेट पैनल और छवि डेटा खोलें । छवियों पर bioluminescent संकेतों को श्रेणी देने के लिए ROI टूल में से एक चुनें. कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 4
चित्र 4 : ठहराव के लिए नमूना से Bioluminescent संकेत.
छवियों पर Bioluminescent संकेत क्षेत्र रॉय उपकरण द्वारा घेर । यहां दिखाए गए सभी bioluminescent सिग्नल लाल घेरे में हैं । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 5
चित्र 5 : ROI माप.
bioluminescent संकेतों चक्कर और उपकरण पैलेट पैनल पर "माप ROIs" पर क्लिक करने के बाद, मूल्यों के रूप में दिखाया प्रस्तुत कर रहे हैं । स्तंभ कुल प्रवाह (p/s) के मान bioluminescent तीव्रता ठहराव के लिए उपयोग किए जाते हैं । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 6
चित्र 6 : विभिन्न ठहराव जानकारी जोड़ें.
रॉय माप पैनल के बाएं कोने पर कॉन्फ़िगर माप पर क्लिक करके, आप अन्य वांछित ठहराव मूल्यों का चयन कर सकते हैं/ कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 7
चित्र 7 : bioluminescent EHEC के साथ inoculated के बाद चूहों की प्रतिनिधि छवि.
चूहों की प्रतिनिधि छवि bioluminescent EHEC के साथ ओरल gavage द्वारा 1 ज के भीतर inoculated. रंग स्केल चमक का प्रतिनिधित्व करता है (p/s/cm2/sr) । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 8
चित्र 8 : चूहों की छवियां bioluminescence के साथ inoculated-लेबल EHEC 2 दिनों के बाद ।
() bioluminescent वाइल्ड-टाइप EHEC EDL933 और EDL933 के साथ चूहों inoculated की छवि का प्रतिनिधित्व करते हैं: 2 दिनों के बाद संक्रमण के बाद मौखिक ΔrfaD द्वाराgavage . () EHEC से संक्रमित चूहों की bioluminescence तीव्रता का ठहराव । त्रुटि पट्टियां मानक विचलन का संकेत देती हैं । प्रतिनिधि छवियां दिखाई जाती हैं । सभी प्रयोगों स्वतंत्र रूप से तीन बार 2-3 जानवरों हर बार के साथ आयोजित किया गया, और त्रुटि सलाखों के मानक विचलन का संकेत मिलता है. P-मान t-test द्वारा सांख्यिकीय विश्लेषण के परिणामों को निरूपित करते हैं. रंग स्केल चमक का प्रतिनिधित्व करता है (p/s/cm2/sr) । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 9
चित्र 9 : bioluminescence-लेबल EHEC के साथ संक्रमित चूहों के आंतों के ऊतकों की छवियाँ.
(एक) 2 दिन bioluminescence-लेबल EHEC के साथ टीका के बाद, चूहों euthanized थे और पूरे आंतों के ऊतकों को हटा दिया गया था और पूर्व vivoछवि । प्रतिनिधि छवियां दिखाई जाती हैं । () EHEC से संक्रमित चूहों से आंतों के ऊतकों की bioluminescence तीव्रता का ठहराव । सभी प्रयोगों स्वतंत्र रूप से तीन बार 2-3 जानवरों हर बार के साथ आयोजित किया गया, और त्रुटि सलाखों के मानक विचलन का संकेत मिलता है. P-मान t-test द्वारा सांख्यिकीय विश्लेषण के परिणामों को निरूपित करते हैं. रंग स्केल चमक का प्रतिनिधित्व करता है (p/s/cm2/sr) । स्केल बार 1 सेमी का प्रतिनिधित्व करता है. इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें.

चरणों तापमान समय चक्रों की संख्या
प्रारंभिक विकार 95 ° c 10 min 1
विकार 95 ° c 30 सेकंड 35
एनीलिंग ५८.४ ° c 30 सेकंड
एक्सटेंशन 72 ° c 1.5 min
अंतिम विस्तार 72 ° c 10 min 1
पकड़ 4 ° c 1

तालिका 1: पोलीमरेज़ चेन रिएक्शन (पीसीआर) शर्तें

प्राइमरों का नाम अनुक्रम
nptII च 5 ' CCTATGCATAATAATTCCGCTAGCTTCACG3 '
nptII आर 5 ' GCTCCACCGATAATATTCCTGAGTCATACT3 '

तालिका 2: प्राइमरी दृश्यों को बढ़ाना इस्तेमाल nptII

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

यह बताया गया है कि luciferase प्लाज्मिड के साथ रूपांतरित EHEC को विवो8,11,12 मेंमेजबान या जीन अभिव्यक्ति में अपने स्थानीयकरण की जांच करने के लिए उपयोग किया गया है । murine मॉडल यहां का प्रदर्शन भी murine मेजबान8में EHEC बृहदांत्र समय और स्थानीयकरण का पता लगाने के लिए सूचित किया गया है । फिर भी, हम कैसे चूहों intragastrically करने के लिए EHEC टीका प्रशासन और कैसे ध्यान से मौखिक gavage के लिए bioluminescent बैक्टीरिया तैयार करने के विस्तार प्रोटोकॉल प्रदान करते हैं । विशेष रूप से, माउस के मौखिक gavage के लिए EHEC (3.7 कदम), माउस सिर की स्थिति महत्वपूर्ण है जब gavage सुई डाला जाता है । यदि स्थिति ऊर्ध्वाधर नहीं है, यह मुश्किल हो जाएगा सुई पारित करने के लिए, और यह संभवतः माउस को घायल कर सकता है । चरण 3.8 में, जब gavage सुई माउस के मुंह के अंदर है, जीभ मुंह के बाहर थोड़ा रखना होगा । जब घेघा के लिए gavage सुई गुजर प्रतिरोध का सामना करना पड़ा है, आगे सुई चलती बंद करो और इसे तुरंत वापस ले लो । सुई घेघा में प्रवेश कर रहा है कि यह सुनिश्चित करने के लिए सुई स्थिति में परिवर्तन. जब प्रतिरोध होता है सुई श्वासनली में प्रवेश किया जा सकता है, जो फेफड़ों में बैक्टीरिया के बजाय पेट के इंजेक्शन के लिए नेतृत्व करेंगे ।

एक जैव संवेदक के रूप में ग्रीन फ्लोरोसेंट प्रोटीन (GFP) के आवेदन जैविक प्रयोगों में आम है । हालांकि, एक रिपोर्टर के रूप में GFP का उपयोग करते हुए रोगज़नक़ संक्रमण का पालन करने के लिए/औपनिवेशीकरण लाइव जानवरों में vivo इमेजिंग द्वारा अनुशंसित नहीं है, क्योंकि हीमोग्लोबिन द्वारा अवशोषण, प्रोटीन और पानी 200-650 एनएम26के बीच उच्च रहे हैं, जो के साथ ओवरलैप GFP (उत्तेजना 480 एनएम, उत्सर्जन 510 एनएम)27। इसलिए, vivo इमेजिंग में के लिए एक रिपोर्टर के रूप में GFP संकेत का उपयोग हीमोग्लोबिन, प्रोटीन, और पशुओं में पानी26द्वारा बाधित किया जा सकता है । के पास अवरक्त (NIR) प्रतिदीप्ति आदर्श vivo इमेजिंग में के लिए अनुकूल है क्योंकि इसकी अवशोषित खिड़की के आसपास है 650-900 एनएम28, जो सबसे कम अवशोषण के क्षेत्र में है हीमोग्लोबिन का गुणांक (< 650 एनएम) और पानी (> 900 एनएम)26 ,28 . इसके अलावा, जब ऊतक प्रकाश अवशोषित, वहां एक autofluorescence प्रेरित करने का मौका है । जब GFP विंडो में उत्तेजना और उत्सर्जन रेंज की तरंग दैर्ध्य, यह NIR से अधिक autofluorescence अधिक लाती है29। NIR का उपयोग पृष्ठभूमि अनुपात करने के लिए संकेत में सुधार कर सकते हैं GFP की तुलना में autofluorescence पृष्ठभूमि को नष्ट करने के द्वारा29. Bioluminescence को दृश्यमान प्रकाश उत्पन्न करने के लिए ऊर्जा उत्तेजना की आवश्यकता नहीं होती. यह अपने एंजाइम luciferase द्वारा उत्प्रेरित सब्सट्रेट luciferin की प्रतिक्रिया पर निर्भर करता है और प्रकाश उत्पन्न करते हैं । चूंकि bioluminescence सीधे एक नमूने पर प्रकाश की आवश्यकता नहीं है, एक नमूना से पृष्ठभूमि संकेत बहुत कम है । इसलिए, एक रिपोर्टर के रूप में bioluminescence का उपयोग अधिक सामांय है और vivo में इमेजिंग के लिए आसान है । इसके विपरीत, प्रतिदीप्ति प्रकाश उत्तेजना संकेत प्रकाश प्रेरित करने की आवश्यकता है । जब ऊतकों प्रकाश को अवशोषित, वहां एक मौका है कि फ्लोरोसेंट रोशनी उत्सर्जित किया जाएगा और autofluorescence प्रेरित इतना है कि उनके संकेत करने के लिए शोर bioluminescence की तुलना में अधिक है ।

EHEC को ध्यान में रखते हुए स्वाभाविक रूप से कम चूहों में मौखिक संक्रमण2,22, चूहों की एक प्राकृतिक श्लैष्मिक रोगज़नक़, Citrobacter rodentiumकहा जाता है, के रूप में मेजबान औपनिवेशीकरण के लिए murine तंत्र का अध्ययन करने के लिए उपयोग किया गया है एक सरोगेट जीवाणु22,30। EHEC और C. rodentium के दोनों आंतों के म्यूकोसा को उपनिवेश और मेजबान22,30में एक/ उंहोंने यह भी ली pathogenicity द्वीप है, जो एक T3SS और कई effecter प्रोटीन है कि प्रेरित एक/घावों में शामिल है22,30। इसलिए, luciferase के उपयोग के लिए औपनिवेशीकरण विकृति का पता लगाने और vivo इमेजिंग प्रणाली में एक के माध्यम से औपनिवेशीकरण तंत्र का अध्ययन करने के लिए सी. rodentium में एक रिपोर्टर के रूप में व्यक्त प्लाज्मिड भी14सूचित किया गया है, 15. फिर भी, जबकि c. rodentium चूहों का संक्रमण T3SS के कार्य की जांच करने के लिए एक उपयोगी मॉडल है और a/E घावों का तंत्र, C. rodentium में शिगा विष (Stx)30शामिल नहीं है, जो एक प्रमुख है डाह कारक है कि EHEC में गुर्दे की विफलता का कारण बनता है, विशेष रूप से सीरोटाइप O157: H73। हालांकि एक Stx-व्यक्त सी. rodentium तनाव हाल ही में31का निर्माण किया गया है, जो अधिक EHEC संक्रमण के लिए यथार्थवादी है, यह अंय संभावित EHEC डाह कारकों है कि औपनिवेशीकरण और/या संक्रमण के लिए महत्वपूर्ण है शामिल नहीं है । इसके अलावा, C. rodentium EHEC32के साथ अपने जीन के 67% है, जो पता चलता है कि EHEC सी. rodentium से औपनिवेशीकरण के दौरान एक अलग डाह और/

luciferase व्यक्त प्लाज्मिड यहां में इस्तेमाल किया, pWF27913, pAKlux29 से संशोधित किया गया था जिसकी रीढ़ की pBBR1MCS433है । हालांकि pBBR1MCS4 परीक्षण किया गया है और विभिंन बैक्टीरिया में दोहराया33, यह इस प्लाज्मिड की प्रतिकृति (मूल) की उत्पत्ति सुनिश्चित करने के लिए महत्वपूर्ण है इस प्रयोग के लिए प्लाज्मिड आधारित luciferase प्रणाली का उपयोग करने से पहले बैक्टीरियल मेजबान के लिए उपयुक्त है और इस प्रकार की पुष्टि है कि इस luciferase व्यक्त प्लाज्मिड बैक्टीरिया की मेजबानी में नकल कर सकते हैं । बैक्टीरिया में प्लाज्मिड की स्थिरता को बनाए रखने के लिए हम एंटीबायोटिक तनाव का इस्तेमाल करते हैं । एंटीबायोटिक्स के अभाव में जब बैक्टीरिया जानवरों में प्रवेश करते हैं तो कम से 2 दिन तक वाइल्ड-टाइप EHEC के bioluminescent सिग्नल का पता लगाया गया है । हालांकि, हम संक्रमण के बाद से अधिक 2 दिनों के लिए नहीं था क्योंकि हम पहले से ही EHEC WT और EHEC के बीच luminescent तीव्रता में एक महत्वपूर्ण अंतर देखा था rfaD (कि encodes एक जीन EHEC synthesizing बरकरार एलपीएस के लिए आवश्यक) उत्परिवर्ती 2 दिन में । एंटीबायोटिक दवाओं के अभाव के तहत जीवाणुओं में छुरा प्लाज्मिड बनाए रखने के लिए, एक प्लाज्मिड pCM1710,34 इस प्रयोजन के लिए इस्तेमाल किया जा सकता है । pCM17 encodes एक दो प्लाज्मिड विभाजन प्रणाली और एक के बाद segregational हत्या तंत्र को एंटीबायोटिक दवाओं के अभाव में बैक्टीरिया में प्लाज्मिड के रखरखाव को सुनिश्चित करने के लिए10,34। OmpC प्रवर्तक द्वारा संचालित luxCDABE ऑपरोन से युक्त प्लाज्मिड pCM17 को bioluminescent सिग्नल द्वारा कम से8दिन के लिए पता लगाया जा सकता है । एक वैकल्पिक विधि एंटीबायोटिक दवाओं के अभाव में एक सतत bioluminescent अभिव्यक्ति बैक्टीरिया को प्राप्त करने के जीवाणु गुणसूत्र35में luxABCDE जीन डालने के लिए है । फ्रांसिस एट अल. प्रयुक्त transposon luxABCDE ऑपरोन और एंटीबायोटिक दवाओं बेतरतीब ढंग से स्ट्रेप्टोकोकस निमोनिया के गुणसूत्र में डाला bioluminescence स्थिर तनाव35प्राप्त करने के लिए डाला ।

हमारे पिछले अध्ययन13में, हम एक मेजबान में EHEC औपनिवेशीकरण की जांच करने और EHEC जंगली प्रकार (WT) और उत्परिवर्ती13के बीच औपनिवेशीकरण क्षमता के अंतर की तुलना करने के लिए इस मॉडल प्रणाली का उपयोग किया । जब चूहों bioluminescent EHEC rfaD उत्परिवर्ती प्रशासित थे, bioluminescent संकेत नाटकीय रूप से कम WT EHEC के 2 दिनों के बाद संक्रमण के बाद की तुलना में । यह सबूत है कि इस murine मॉडल मेजबान में EHEC औपनिवेशीकरण के उत्परिवर्तन प्रभाव का विश्लेषण कर सकते है प्रदान करता है । इसके अलावा, EHEC के औपनिवेशीकरण को कम करने के लिए चिकित्सीय उपचार एक माना जाता है, एंटीबायोटिक दवाओं के उपयोग के बाद से EHEC संक्रमण के लिए संभावित समाधान है contraindicated5,36। इसलिए, यह है कि इस मॉडल प्रणाली विरोधी औपनिवेशीकरण दवाओं की प्रभावकारिता की जांच करने के लिए इस्तेमाल किया जा सकता है परीक्षण लायक है/ हमारा मानना है कि इस मॉडल प्रणाली का उपयोग करके, यह समय और न केवल EHEC के स्थान की जांच करने के लिए संभव है, लेकिन यह भी अन्य enterobacteria औपनिवेशीकरण vivo में. इस पशु मॉडल का उपयोग करके, चूहों में EHEC औपनिवेशीकरण की प्रक्रिया पर नजर रखी जा सकती है और मेजबान में औपनिवेशीकरण बोझ जीवित पशुओं में औपनिवेशीकरण के स्थानिक और लौकिक EHEC का निर्धारण quantified किया जा सकता है. दृश्य और enterobacteria औपनिवेशीकरण के ठहराव इस मॉडल का उपयोग करके यह एक महान उपकरण की जांच करने के लिए और enterobacterial औपनिवेशीकरण के ठीक तंत्र का विश्लेषण करता है, और इस तरह औपनिवेशीकरण अनुसंधान की कमी के लिए क्षतिपूर्ति और वर्तमान ज्ञान में सुधार ।

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखकों का खुलासा करने के लिए कुछ नहीं है ।

Acknowledgments

हम ची चिकित्सा अनुसंधान विभाग से चुंग चेन स्वीकार करते हैं, ची मेई चिकित्सा केंद्र (ताइनान, ताइवान) माउस संक्रमण में मदद के लिए, और राष्ट्रीय चेंग कुंग विश्वविद्यालय के प्रयोगशाला पशु केंद्र से समर्थन करते हैं । इस काम के लिए विज्ञान और प्रौद्योगिकी मंत्री (अधिकांश) अनुदान (सबसे 104-2321-बी-006-019, 105-2321-बी-006 -011, and106-2321-बी-006 -005) सीसी के लिए समर्थन किया है ।

Materials

Name Company Catalog Number Comments
Shaker incubator YIH DER LM-570R bacteria incubation 
Orbital shaking incubator FIRSTEK S300 bacteria incubation 
pBSL180 source of nptII gene
pAKlux2 source of luxCDABE operon
T&A Cloning Kit Yeastern Biotech FYC001-20P use for TA cloning 
Nsi I NEB R0127S use for plasmid cloning 
Sca I NEB R0122S use for plasmid cloning 
Spe I-HF NEB R0133S use for plasmid cloning 
Sma NEB R0141S use for plasmid cloning 
T4 ligase NEB M0202S use for plasmid cloning 
Ex Taq TaKaRa RR001A use for PCR amplification
10X Ex Taq Buffer TaKaRa RR001A use for PCR amplification
dNTP Mixture  TaKaRa RR001A use for PCR amplification
PCR machine applied Biosystem  2720 thermal cycler   for PCR amplification
Glycerol SIGMA G5516-1L use for bacteria stocking solution
NaCl Sigma 31434-5KG-R chemical for making LB medium, 10 g/L
Tryptone CONDA pronadisa Cat 1612.00 chemical for making LB medium, 10 g/L
Yeast Extract powder Affymetrix 23547-1 KG chemical for making LB medium, 5 g/L
Agar CONDA pronadisa Cat 1802.00 chemical for making LB agar
kanamycin  Sigma K4000-5G antibiotics, use for seleciton
streptomycin  Sigma S6501-100G antibiotics, eliminate the microbiota in mice
EDL933 competent cell Homemade method is on supplemental document 
Electroporator MicroPulser for electroporation
Electroporation Cuvettes Gene Pulser/MicroPulser 1652086 for electroporation
High-speed centrifuge Beckman Coulter Avanti, J-26S XP use for centrifuging bacteria 
Fixed-Angle Rotor Beckman Coulter JA25.5 use for centrifuging bacteria 
Fixed-Angle Rotor Beckman Coulter JLA10.5 use for centrifuging bacteria 
centrifuge bottles Beckman Coulter REF357003 use for centrifuging bacteria 
centrifuge bottles Thermo Fisher scientific 3141-0500 use for centrifuging bacteria 
eppendorf biophotometer plus  eppendorf AG 22331 hamburg for measuring the OD600 value of bacteria
C57BL/6 mice  Laboratory Animal Center of NCKU
lab coat, gloves for personnel protection 
isoflurane  Panion & BF Biotech Inc. G-8669 for mice anesthesia, pharmaceutical grade
1ml syringe  use for oral gavage of mice
Reusable 22 G ball-tipped feeding needle φ0.9 mm X L 50 mm use for oral gavage of mice
surgical  scissors  use for mice experiment
Xenogen IVIS 200 imaging system Perkin Elmer IVIS spectrum use for bioluminescent image capture 
Living Image Software Perkin Elmer version 4.1 use for quantifying the image data

DOWNLOAD MATERIALS LIST

References

  1. Pennington, H. Escherichia coli O157. Lancet. 376, (9750), 1428-1435 (2010).
  2. Mayer, C. L., Leibowitz, C. S., Kurosawa, S., Stearns-Kurosawa, D. J. Shiga toxins and the pathophysiology of hemolytic uremic syndrome in humans and animals. Toxins (Basel). 4, (11), 1261-1287 (2012).
  3. Tarr, P. I., Gordon, C. A., Chandler, W. L. Shiga-toxin-producing Escherichia coli and haemolytic uraemic syndrome. Lancet. 365, (9464), 1073-1086 (2005).
  4. Obrig, T. G. Escherichia coli Shiga Toxin Mechanisms of Action in Renal Disease. Toxins (Basel). 2, (12), 2769-2794 (2010).
  5. Nguyen, Y., Sperandio, V. Enterohemorrhagic E. coli (EHEC) pathogenesis. Front Cell Infect Microbiol. 2, 90 (2012).
  6. Wiles, S., Robertson, B. D., Frankel, G., Kerton, A. Bioluminescent monitoring of in vivo colonization and clearance dynamics by light-emitting bacteria. Methods Mol Biol. 574, 137-153 (2009).
  7. Hutchens, M., Luker, G. D. Applications of bioluminescence imaging to the study of infectious diseases. Cell Microbiol. 9, (10), 2315-2322 (2007).
  8. Rhee, K. J., et al. Determination of spatial and temporal colonization of enteropathogenic E. coli and enterohemorrhagic E. coli in mice using bioluminescent in vivo imaging. Gut Microbes. 2, (1), 34-41 (2011).
  9. Karsi, A., Lawrence, M. L. Broad host range fluorescence and bioluminescence expression vectors for Gram-negative bacteria. Plasmid. 57, (3), 286-295 (2007).
  10. Lane, M. C., Alteri, C. J. S., Smith, S. N., Mobley, L. H. Expression of flagella is coincident with uropathogenic Escherichia coli ascension to the upper urinary tract. Proc Natl Acad Sci U S A. 104, (42), 16669-16674 (2007).
  11. Roxas, J. L., et al. Enterohemorrhagic E. coli alters murine intestinal epithelial tight junction protein expression and barrier function in a Shiga toxin independent manner. Lab Invest. 90, (8), 1152-1168 (2010).
  12. Siragusa, G. R., Nawotka, K., Spilman, S. D., Contag, P. R., Contag, C. H. Real-Time Monitoring of Escherichia coli O157:H7 Adherence to Beef Carcass Surface Tissues with a Bioluminescent Reporter. (1999).
  13. Kuo, C. J., et al. Mutation of the Enterohemorrhagic Escherichia coli Core LPS Biosynthesis Enzyme RfaD Confers Hypersusceptibility to Host Intestinal Innate Immunity In vivo. Front Cell Infect Microbiol. 6, 82 (2016).
  14. Wiles, S., et al. Organ specificity, colonization and clearance dynamics in vivo following oral challenges with the murine pathogen Citrobacter rodentium. Cell Microbiol. 6, (10), 963-972 (2004).
  15. Wiles, S., Pickard, K. M., Peng, K., MacDonald, T. T., Frankel, G. In vivo bioluminescence imaging of the murine pathogen Citrobacter rodentium. Infect Immun. 74, (9), 5391-5396 (2006).
  16. Contag, C. H., Contag, P. R., Mullins, J. I., Spillman, S. D., Stevenson, D. K., Benaron, D. A. Photonic detection of bacterial pathogens in living hosts. Mol Microbiol. 18, (4), 593-603 (1995).
  17. Hardy, J., Francis, K. P., DeBoer, M., Chu, P., Gibbs, K., Contag, C. H. Extracellular replication of Listeria monocytogenes in the murine gall bladder. Science. 303, (5659), 851-853 (2004).
  18. Kaniga, K., Sory, M. P., Delor, I., Saegerman, C., Limet, J. N., Cornelis, G. R. Monitoring of Yersinia enterocolitica in Murine and Bovine Feces on the Basis of the Chromosomally Integrated luxAB Marker Gene. Appl Environ Microbiol. 58, (3), 1024-1026 (1992).
  19. Trcek, J., Fuchs, T. M., Trulzsch, K. Analysis of Yersinia enterocolitica invasin expression in vitro and in vivo using a novel luxCDABE reporter system. Microbiology. 156, (Pt 9), 2734-2745 (2010).
  20. Morin, C. E., Kaper, J. B. Use of stabilized luciferase-expressing plasmids to examine in vivo-induced promoters in the Vibrio cholerae vaccine strain CVD 103-HgR. FEMS Immunol Med Microbiol. 57, (1), 69-79 (2009).
  21. Law, R. J., Gur-Arie, L., Rosenshine, I., Finlay, B. B. In vitro and in vivo model systems for studying enteropathogenic Escherichia coli infections. Cold Spring Harb Perspect Med. 3, (3), a009977 (2013).
  22. Ritchie, J. M. Animal Models of Enterohemorrhagic Escherichia coli Infection. Microbiol Spectr. 2, (4), EHEC-0022-2013 (2014).
  23. Chou, T. C., et al. Enterohaemorrhagic Escherichia coli O157:H7 Shiga-like toxin 1 is required for full pathogenicity and activation of the p38 mitogen-activated protein kinase pathway in Caenorhabditis elegans. Cell Microbiol. 15, (1), 82-97 (2013).
  24. Alexeyev, M. F., Shokolenko, I. N. Mini-Tnl 0 transposon derivatives for insertion mutagenesis and gene delivery into the chromosome of Gram-negative bacteria. Gene. 160, (1), 59-62 (1995).
  25. Wiegand, I., Hilpert, K., Hancock, R. E. Agar and broth dilution methods to determine the minimal inhibitory concentration (MIC) of antimicrobial substances. Nat Protoc. 3, (2), 163-175 (2008).
  26. Pansare, V., Hejazi, S., Faenza, W., Prud'homme, R. K. Review of Long-Wavelength Optical and NIR Imaging Materials: Contrast Agents, Fluorophores and Multifunctional Nano Carriers. Chem Mater. 24, (5), 812-827 (2012).
  27. Heim, R., Cubitt, A. B., Tsien, R. Y. Improved green fluorescence. Nature. 373, (6516), 663-664 (1995).
  28. Weissleder, R. A clearer vision for in vivo imaging. Nat Biotechnol. 19, (4), 316-317 (2001).
  29. Frangioni, J. In vivo near-infrared fluorescence imaging. Current Opinion in Chemical Biology. 7, (5), 626-634 (2003).
  30. Collins, J. W., et al. Citrobacter rodentium: infection, inflammation and the microbiota. Nat Rev Microbiol. 12, (9), 612-623 (2014).
  31. Mallick, E. M., et al. A novel murine infection model for Shiga toxin-producing Escherichia coli. J Clin Invest. 122, (11), 4012-4024 (2012).
  32. Petty, N. K., et al. The Citrobacter rodentium genome sequence reveals convergent evolution with human pathogenic Escherichia coli. J Bacteriol. 192, (2), 525-538 (2010).
  33. Kovach, M. E., Elzer, P. H., Hill, D. S., Robertson , G. T., Farris, M. A., Roop, R. M. II, Peterson, K. M. Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene. 166, (1), 175-176 (1995).
  34. Galen, J. E., Nair, J., Wang , J. Y., Wasserman, S. S., Tanner, M. K., Sztein , M. B., Levine, M. M. Optimization of Plasmid Maintenance in the Attenuated Live Vector Vaccine Strain Salmonella typhiCVD 908-htrA. Infect Immun. 67, (12), 6424-6433 (1999).
  35. Francis, K. P., et al. Visualizing pneumococcal infections in the lungs of live mice using bioluminescent Streptococcus pneumoniae transformed with a novel gram-positive lux transposon. Infect Immun. 69, (5), 3350-3358 (2001).
  36. Goldwater, P. N., Bettelheim, K. A. Treatment of enterohemorrhagic Escherichia coli (EHEC) infection and hemolytic uremic syndrome (HUS). BMC Med. 10, (2012).
Vivo Bioluminescence System <em>में</em> गैर-इनवेसिव द्वारा Murine होस्ट में Enterohemorrhagic <em>ई कोलाई</em> औपनिवेशीकरण का पता लगाना
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Kuo, C. J., Wang, S. T., Chen, C. S. Detection of Enterohemorrhagic Escherichia Coli Colonization in Murine Host by Non-invasive In Vivo Bioluminescence System. J. Vis. Exp. (134), e56169, doi:10.3791/56169 (2018).More

Kuo, C. J., Wang, S. T., Chen, C. S. Detection of Enterohemorrhagic Escherichia Coli Colonization in Murine Host by Non-invasive In Vivo Bioluminescence System. J. Vis. Exp. (134), e56169, doi:10.3791/56169 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter