Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Påvisande av entrohemoragiska Escherichia Coli koloniseringen i murina mottagande av icke-invasiva In Vivo Mareld System

doi: 10.3791/56169 Published: April 9, 2018

Summary

Ett detaljerat protokoll av en musmodell för entrohemoragiska E. coli (EHEC) koloniseringen med hjälp av Mareld-märkt bakterier presenteras. Påvisande av dessa självlysande bakterier av en icke-invasiv i vivo imaging system med levande djur kan avancera vår nuvarande förståelse av EHEC colonization.

Abstract

Entrohemoragiska E. coli (EHEC) O157: H7, som är en livsmedelsburna patogener som causesdiarrhea, hemorragisk kolit (HS), och Hemolytiskt uremiskt syndrom (HUS), kolonisera till tarmkanalen av människor. För att studera detaljerade mekanismen av EHEC colonization in vivo är det viktigt att ha djurmodeller att övervaka och kvantifiera EHEC colonization. Vi visar här en mus-EHEC colonization modell genom att omvandla självlysande uttrycker plasmiden att EHEC att övervaka och kvantifiera EHEC kolonisationen i levande värdar. Djur som inokulerats med Mareld-märkt EHEC Visa intensiva självlysande signaler hos möss genom detektion med en icke-invasiv i vivo imaging system. Efter 1 och 2 dagar efter infektion, kunde självlysande signaler fortfarande upptäckas hos infekterade djur, vilket antyder att EHEC kolonisera i värdar för minst 2 dagar. Vi visar också att dessa självlysande EHEC lokalisera till mus tarmen, speciellt i blindtarmen och tjocktarmen, från ex vivo bilder. Denna mus-EHEC colonization modell kan fungera som ett verktyg att avancera den aktuella kunskapen om EHEC colonization mekanismen.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

EHEC O157: H7 är en patogen som orsakar diarré1, HS2, HUS3och även akut njursvikt4 genom förorenat vatten eller mat. EHEC är en patogena enterobacterium och colonizes till mag-tarmkanalen människor1. När EHEC följer först värd intestinal epitel, injicera de colonization faktorerna i värdceller genom typ III-sekretionssystemet (T3SS) som fungerar som en molekylär spruta förmå en fästa och utplåna (A/E) lesion därefter att genomdriva adhesion (kolonisation)5. Dessa gener som är involverade i A/E lesion formation kodas av locus av enterocyter utplåning (LEE) patogenicitet island5.

Mareld är en ljus-producerande kemisk reaktion, i vilka luciferas katalyserar dess substrat luciferin för att generera synliga ljus6. Detta enzymatisk process kräver ofta närvaro av syre eller adenosintrifosfat (ATP)6. Mareld imaging (BLI) tillåter forskare visualisering och kvantisering av värd-patogen interaktioner i levande djur7. BLI kan karakterisera bakterieinfektion cykeln i levande djur genom att följa de självlysande bakterierna som de migrerar till och invadera olika vävnader7; Detta avslöjar en dynamisk progression av infektionen. Dessutom är bakteriehalten i djur relaterad till den självlysande signal8; Därför är det en bekväm indikator att uppskatta de sjukliga tillstånd försöksdjur på ett enkelt och direkt sätt.

Plasmiden används här innehöll luciferas operon, luxCDABE, som är från bakterien Photorhabdus hjälp som kodar egna luciferas substrat7,9. Genom att omvandla denna luciferas-uttryckande plasmid till bakterier, kan colonization och infektion processerna övervakas genom att observera dessa självlysande bakterier i levande djur. Sammantaget tillåter BLI och Mareld-märkt bakterier forskare att övervaka bakteriell siffrorna och läge, bakteriell bärkraft med antibiotika/terapi behandling och bakteriell genuttryck i infektion/kolonisering6, 7. många patogena bakterier har rapporterats att uttrycka den luxCDABE operon att undersöka deras infektion cykel och/eller gen uttryck i infektion. Dessa bakterier, inklusive uropathogenic E. coli10, EHEC8,11,12,13, enteropathogenic E. coli (EPEC)8, Citrobakter rodentium14,15, Salmonella typhimurium16, Listeria monocytogenes17, Yersinia enterocolitica18,19, och Vibriocholerae20, har dokumenterats.

Flera experimentella modeller har utvecklats för att underlätta studiet av EHEC colonization in vitro- och in-vivo21,22,23. Det finns dock en brist på lämplig djurmodeller studera den EHEC koloniseringen i vivo, och därmed en resulterande bristen på Detaljer. För att underlätta studiet av den EHEC colonization mekanism i vivo, är det värdefullt att bygga djurmodeller för att observera och kvantifiera EHEC kolonisationen i levande djur i en icke-invasiv metod.

Detta manuskript beskriver en mus-EHEC colonization modell som använder en självlysande uttrycker system för att övervaka EHEC colonization över tid i levande värdar. Möss är intragastrically inokuleras med Mareld-märkt EHEC och den självlysande signalen detekteras hos möss med en icke-invasiv i vivo imaging system13. Möss infekterade med Mareld-märkt EHEC visade betydande självlysande signaler i deras tarmen efter 2 dagar efter infektion, som föreslog att dessa bakterier koloniserade i tarmen värd efter 2 dagar efter infektion. Ex vivo bilddata visade att denna kolonisering är specifikt i blindtarmen och tjocktarmen av möss. Genom att använda denna mus-EHEC modell, kan självlysande EHEC koloniseringen upptäckas i den levande mottagande av en in-vivo imaging system, för att studera de detaljerade mekanismerna av enteriska bakterier kolonisering, som kan främja ytterligare förståelse i EHEC-inducerad fysiologiska och patologiska förändringar.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Varning: EHEC O157: H7 är en biosäkerhet nivå 2 (BSL-2) patogener enligt Centers for Disease Control and Prevention (CDC) biosäkerhet instruktion (https://www.cdc.gov/). Därför måste alla experimentella procedurer som involverar EHEC utföras i en BSL-2 anläggning. Använd lab rockar och skyddshandskar när de utför experimentet. Arbeta i en certifierad biosäkerhet skåp (BSC). Desinficera experimentella bänken före och efter det experimentella förfarandet med 70% etanol. Alla instrument eller utrustning att kontakt (eller potentiellt kontakt) EHEC bör desinficeras med 70% etanol eller blekmedel. Kontaminerade (eller potentiellt förorenade) avfall bör vara förseglade och autoklaveras noggrant. Bär en mask, skyddsglasögon, dubbla handskar eller en jumpsuit, om det behövs. De 6-vecka-gammal C57BL/6 honmöss köptes och underhålls på laboratorium djur Center av nationella Cheng Kung universitetar (NCKU). I djurförsök har godkänts av den institutionella djur vård och användning kommittén av NCKU (godkännandenummer 104-039).

1. Bioluciferase-märkt EHEC bakterier Generation

  1. Blanda 50 ng deoxiribonukleinsyra (DNA), 1 μL varje 10 μM framåt och bakåt primers, 2 μL 2.5 mM deoxinukleotider (dNTP), 2 μL 10 x buffert, 0.2 μL DNA-polymeras och sterilt dubbeldestillerat vatten (ddH2O) till en slutlig volym av 20 μL att förstärka den anti kanamycin kassett, nptII gen24. Den DNA-mallen är från pBSL18024, som köps från den nationella BioResource Project (NBRP). PCR-villkoren anges i tabell 1 och sekvensen primer finns i tabell 2.
  2. Ligera PCR-produkterna till en kommersiell kloning vektor efter satsen protokoll (se Tabell för material).
  3. Punktskatt nptII gen fragmentet från kloning vektorn av NsiI och Bruno och klona in pBBR1MCS4, som rötas av NsiI och ScaI från pAKlux29 för att skapa resistenta kanamycin plasmiden, pWF27813.
  4. Punktskatt på luxCDABE operon, från den luciferas uttrycker plasmid9, pAKlux2, av inskriptionen-HF och ScaI och klon till SpeI-HF och Bruno rötas pWF278 för att generera kanamycin resistenta och luciferas uttrycker plasmid, pWF27913.
    Obs: För de plasmiden extraktioner och de exciderad fragment reningar, använda kommersiella plasmid utvinning och gel utvinning kit, respektive. För enzym matsmältningen, blanda 100 ng DNA, 1 μL 10 x buffert, 1 μL av varje vald restriktionsenzym och sterila ddH2O till en total volym av 10 μL, och inkubera vid 37 ° C för 2,5-3 h.
  5. Omvandla pWF279 plasmiden till E. coli O157: H7 EDL933 behöriga celler genom elektroporation med 2.500 V för 4 ms.
  6. Inkubera transformerad bakterier cellerna i 1 mL Luria-Bertani (LB) medium vid 37 ° C i 1 h.
  7. Tallrik bakterier på en LB agarplatta kompletteras med 50 µg/mL kanamycin vid 37 ° C i 16-18 h.
  8. Kontrollera den självlysande signalen av plattan genom en in-vivo imaging maskin nästa dag. Plocka en enda koloni från plattan och kultur det i 3 mL LB kompletteras med 50 µg/mL kanamycin vid 37 ° C i 16-18 h.
  9. Förbereda bakteriell lager medium genom att späda ut 100% glycerol i sterila ddH2O att göra 30% glycerol lösningen.
  10. Frysa de kanamycin resistenta E. coli O157: H7 EDL933 bakterier härbärgerat luciferas plasmiden som en bakteriell lager i ett skruvlock cryovial som förhållandet 1:1 lösning för bakterier-kultur och 30% glycerol vid-80 ° C. Den slutliga koncentrationen av glycerol är 15%.

2. självlysande EHEC bakterier inför muntliga inympning

Obs: Tidslinje flödesschemat av experimentella procedurer för EHEC förberedelser och mus oral sondmatning presenteras i figur 1 till stöd i experimentell förberedelse.

  1. Strimma E. coli O157: H7 EDL933 bakterier härbärgerat luciferas plasmid på en LB agarplatta med 50 µg/mL kanamycin-80 ° C lagervara. Odla bakterier för 16-18 timmar vid 37 ° C.
  2. Plocka en enda koloni från övernattning plattan och kultur i 3 mL LB medium med 50 µg/mL kanamycin för 16-18 h i ett 37 ° C inkubator vid 220 rpm.
  3. Subkultur bakterierna (1: 100 spädning) till kanamycin (50 µg/mL) som innehåller LB buljong för 2,5-3 h i en 37 ° C inkubator på 200 rpm. (Till exempel Lägg till 2 mL över natten odlade bakterier till 200 mL LB medium med kanamycin (50 µg/mL) kompletteras).
  4. Inkubera bakterierna för 2,5-3 h och Mät det optiska densiteten värdet på 600 nm (OD600) tills värdet är mellan 0,9 till 1. Antalet bakteriella cellen är på en täthet av ca 108 kolonin bildar enheter (CFU) / mL.
  5. Centrifugera åter odlade bakterier vid 8000 x g i 30 min, 4 ° C.
  6. Kasta bort vätskefasen utan att agitera pelleten av bakterier och tvätta pelleten med 100 mL 0.9% steril fysiologisk koksaltlösning vaggning.
  7. Upprepa steg 2.5 och 2.6 en gång.
  8. Efter tvätten, Centrifugera bakteriella kulturen vid 8000 x g i 30 min, 4 ° C och kasta bort supernatanten försiktigt.
  9. Kondensat pelleten på 100-faldig med 0,9% steril fysiologisk koksaltlösning. Exempelvis om 200 mL bakterier centrifugeras, tillsätt 2 mL fysiologisk koksaltlösning för att centrifugerade.
  10. Bekräfta bakterierna CFU (det bör vara cirka 109 CFU/100 μL efter kondens i fysiologisk koksaltlösning) genom plätering koncentrerad bakterier genom en 10-faldig seriell utspädning25.

3. mus Oral sondmatning av EHEC

  1. Behandla 6-vecka-gammal kvinnlig C57BL/6 möss med streptomycin vatten (5 g/L) för 24 h.
  2. Efter 24 h, växla till regelbunden dricksvatten för en annan 24 h innan sondmatning. Efter att behandla med vanligt vatten för 24 h, är mössen redo för oral sondmatning av EHEC.
  3. Fyll sprutan med 100 μL EHEC bakterier genom att dra tillbaka kolven. Se till att inga luftbubblor finns i sprutan. Ta bort bubblorna genom att fästa sprutan med fingrarna.
  4. Lyft djuret försiktigt och placera den ovanpå buren med omsorg.
  5. Greppa musen i svansen noggrant, och djuret kommer grepp toppen av bur och försök att flytta bort.
  6. Försiktigt hålla musen genom att greppa den lösa huden på halsen och baksidan av djuret med tummen och pekfingret vill att chefen för musen flyttas.
  7. Håll musen i vertikal position att nålen sondmatning och säkerställa chefen för musen är immobiliserade och vertikala.
  8. Stick in sondmatning nålen i mus munnen efter taket i munnen och flytta ned i matstrupen och in mot magen.
  9. När infogade nålen är hälften eller två tredjedelar längden i musen, injicera 100 μL EHEC bakterier, som innehåller cirka 109 CFU celler.

4. visualisering

  1. Efter en oral sondmatning, upptäcka självlysande signalerna på 1 och 2 dagar.
  2. Innan man undersöker de självlysande signalerna av djur, söva dem genom att sätta dem i en kammare av 2,5% isofluran med 1,5 L/min syre.
  3. Vänta i 2-5 min tills alla möss blir medvetslös och stopp flytta. Djur är redo för i vivo detektion av Mareld.
  4. Upptäcka och bild självlysande signaler av djur genom en in-vivo imaging system. Vänligen se avsnitt 5 ”Data Acquisition” för programvara drift. Under avbildningsprocessen är alla djur under en fortsatt tillförsel av 2,5% isofluran med 1,5 L/min syre.
    1. Klicka på fil > live och manuellt fokus på musen.
    2. Välj exponering tid och laser intensitet.
    3. Klicka förvärva > fånga.
  5. För ex vivo imaging, eutanasi möss av cervikal dislokation och ta bort hela tarmen av infekterade möss. Placera tarmarna i en 9 cm petriskål och bilden av den i vivo imaging system. Inställningen är densamma som den i vivo imaging förutom synfältet anges som A/B. Vänligen se avsnitt 5 ”Data Acquisition” för detaljer.
    Obs: Metod för cervikal dislokation: hindra möss ovanpå buren genom att greppa svansen med ena handen så att djuren grepp buren. Placera en tuschpenna eller tummen och pekfingret av den andra handen mot baksidan av halsen vid basen av skallen. Snabbt tryck framåt med handen eller ett objekt medan besöksförbud huvudet och dra bakåt med handen som håller svansen.
    Kontrollera noga att bekräfta andningsstillestånd och inga hjärtslag.

5. data Acquisition

Obs: Den programvara som används för datainsamling är listade i Tabell för material.

  1. För bild förvärv, öppna Kontrollpanelen för förvärv av programvaran (figur 2).
  2. Välj ”självlysande”, ”fotografera”, och ”Overlay”.
  3. Ställ in exponeringstid som ”Auto”. Ange Binning som ”Medium”.
  4. Ställa in ƒ/stopp som 1 för självlysande och 8 för fotografi. Ƒ/stoppa styr mängden ljus som mottagits av CCD detektorn.
  5. Ange det synfält som baseras på fältet av bilder som är av intresse att förvärva. Alternativet ”D” kan passa fem 6 veckor gamla möss och bild dem alla på en gång. ”C” kan bilden tre 6-vecka-gammal möss i ett fält.
  6. När möss/proverna är redo för imaging, klickar du på ”Hämta” för bild förvärv.
  7. Öppna de bilddata som förvärvades.
  8. Öppna panelen Verktyg palett (figur 3).
  9. Välj ROI verktyg. Vi rekommenderar cirkeln (vänster ett) till området självlysande på bilder (figur 4).
  10. Klicka på ”åtgärd ROIs” (pennikonen) för att mäta ytan självlysande intensiteten (figur 3). Panelen ROI mätningar och kvantifiering värdena visas (figur 5).
  11. Använd konfigurera mätning i vänstra hörnet av panelen ROI mätningar att välja värden/information som behövs (figur 6), annars klicka på ”Exportera” för att exportera datatabellen och Spara som CSV-fil (figur 5).
  12. Använd värdena i kolumnen ”Total Flux (p/s)” som självlysande intensitet kvantifiering i CSV-filen.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Vi administrerade Mareld-märkt EHEC (~ 109 bakterieceller) till 6 - vecka-gammal kvinnlig C57BL/6 möss av oral sondmatning. Efter oral inokulering av EHEC till möss inom 1 h undersöktes djuren för självlysande signal av i vivo imaging systemet som visas i figur 7. Resultaten visade en stark självlysande signal i sondmatning möss med Mareld-märkt EHEC. Vi undersökte signalerna på 2 dagar efter infektion. Som visas i figur 8A, inokuleras möss med Mareld-märkt vildtyp EHEC EDL933 visade intensiva självlysande signaler även efter 2 dagar efter infektion, som föreslog EHEC koloniserade i värdar av 2 dagar. Vi smittade också intragastrically Mareld-märkt EDL933ΔrfaD (ΔrfaD) till möss (figur 8A). Denna mutant, hoppade i lipopolysackarid (LPS), har visat sig minska kolonisering i mottagande i vår tidigare studie. Som visas i figur 8A, det finns ingen självlysande signal detekteras i ΔrfaD-infekterade möss, vilket tyder på att det finns ingen eller mindre bakterier celler koloniserade i möss. Kvantifiering av fluorescerande signalen visas i figur 8B. Därefter bestämdes platsen för dessa Mareld-märkt bakterier. De infekterade möss offrades humant och deras hela tarmen tas bort. Tarmarna av möss 2 dagar post infektion var placerade på 9 cm petriskålar och avbildas ex vivo (figur 9A). Intestinal vävnader av Mareld-märkt EDL933 infekterade möss visade en betydande ökning i självlysande signaler i blindtarmen och tjocktarmen, som tyder på att dessa självlysande EHEC koloniserade i blindtarmen och tjocktarmen av infekterade möss under 2 dagar på minst. Däremot minskade möss som infekterats med Mareld-märkt ΔrfaD (figur 9A),, avslöjade självlysande signal i deras Tarmvävnaden, som stämmer överens med bilden i vivo (figur 8A ). Kvantifiering av fluorescerande signalen visas i figur 9B.

Figure 1
Figur 1 : Tidslinje i experimentell förberedelse flödesschemat.
Översikt över tidpunkten för att förbereda självlysande EHEC bakterier och förbehandla möss med streptomycin. (A), EHEC beredning. (B) möss förberedelse. Klicka här för att se en större version av denna siffra.

Figure 2
Figur 2 : In vivo imaging system förvärv Kontrollpanelen.
Innan imaging prover, öppna Kontrollpanelen IVIS förvärv. Välj ”självlysande”, ”fotografera”, och ”Overlay”. Ställ in exponeringstid som ”Auto”. Ange Binning som ”Medium”. Ställa in ƒ/stopp som 1 för självlysande och 8 för fotografi. Ƒ/stoppa styr mängden ljus som mottagits av CCD detektorn. När prover är redo för imaging, klickar du på ”Hämta” för att hämta bilder. Klicka här för att se en större version av denna siffra.

Figure 3
Figur 3 : Verktyg palettpanelen.
Efter bild förvärva, använda panelen Verktyg palett för att kvantifiera självlysande intensitet. Öppna panelen verktygspaletten och image data. Välj en av de ROI-verktyg för att variera självlysande signalerna på bilder. Klicka här för att se en större version av denna siffra.

Figure 4
Figur 4 : Självlysande signal från provet för kvantifiering.
Självlysande signal område på bilder omgiven av ROI verktyg. Alla självlysande signaler som visas här är i den röda cirkeln. Klicka här för att se en större version av denna siffra.

Figure 5
Figur 5 : ROI mätningar.
Efter kretsande självlysande signaler och klicka på ”åtgärd ROIs” på panelen verktygspaletten, presenteras värden som visas. Värdena i kolumnen Total Flux (p/s) används för självlysande intensitet kvantifiering. Klicka här för att se en större version av denna siffra.

Figure 6
Figur 6 : Lägga till olika kvantifiering information.
Genom att klicka på Konfigurera mätning i vänstra hörnet av panelen ROI mätningar, kan du välja annan önskad kvantifiering värden/information. Klicka här för att se en större version av denna siffra.

Figure 7
Figur 7 : Representativ bild av möss efter inokuleras med självlysande EHEC.
Representativ bild av möss inokuleras med självlysande EHEC av oral sondmatning inom 1 h. Färgskalan motsvarar strålglans (p/s/cm2/sr). Klicka här för att se en större version av denna siffra.

Figure 8
Figur 8 : Bilder av möss inokuleras med Mareld-märkt EHEC efter 2 dagar.
(A) representerar bilden av möss inokuleras med självlysande vildtyp EHEC EDL933 och EDL933:ΔrfaD av oral sondmatning efter 2 dagar efter infektion. (B) kvantifiering av Mareld intensiteten hos möss som infekterats med EHEC. Felstaplar visar standardavvikelserna. Representativa bilder visas. Alla experiment utfördes självständigt tre gånger med 2-3 djur varje gång och felstaplar visar standardavvikelserna. P-värden beteckna resultaten av statistisk analys av t-test. Färgskalan motsvarar strålglans (p/s/cm2/sr). Klicka här för att se en större version av denna siffra.

Figure 9
Figur 9 : Bilder av intestinal vävnader av infekterade möss med Mareld-märkt EHEC.
(A) 2 dagar efter inokulering med Mareld-märkt EHEC, mössen var euthanized och hela tarmens vävnader togs bort och avbildas ex vivo. Representativa bilder visas. (B) kvantifiering av Mareld intensitet av intestinal vävnader från möss som infekterats med EHEC. Alla experiment utfördes självständigt tre gånger med 2-3 djur varje gång och felstaplar visar standardavvikelserna. P-värden beteckna resultaten av statistisk analys av t-test. Färgskalan motsvarar strålglans (p/s/cm2/sr). Skalstapeln representerar 1 cm. vänligen klicka här för att visa en större version av denna siffra.

Steg Temperatur Tid Antal cykler
Inledande denaturering 95 ° C 10 min 1
Denaturering 95 ° C 30 SEK 35
Glödgning 58,4 ° C 30 SEK
Förlängning 72 ° C 1,5 min
Slutliga förlängning 72 ° C 10 min 1
Håll 4 ° C 1

Tabell 1: Polymeras-kedjereaktion (PCR) villkor

Primers namn Sekvens
nptII F 5' CCTATGCATAATAATTCCGCTAGCTTCACG3'
nptII R 5' GCTCCACCGATAATATTCCTGAGTCATACT3'

Tabell 2: Primer sekvenser används för att förstärka nptII

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Det har rapporterats att EHEC omvandlas med luciferas plasmid har utnyttjats för att undersöka dess lokalisering i värdar eller gen uttryck i vivo8,11,12. Murina modellen visat här har också rapporterats att upptäcka EHEC koloniserade timing och lokalisering i murina värd8. Dock ger vi protokollet detalj att administrera EHEC inympning till möss intragastrically och hur noggrant förbereda de självlysande bakterierna för oral sondmatning. Särskilt för den mus oral sondmatning av EHEC (steg 3,7) är positionen för mus huvudet kritiska när sondmatning nålen sätts. Om positionen inte är vertikal, det blir svårt att passera nålen och det kan möjligen skada musen. I steg 3.8, när sondmatning nålen är inne i munnen av musen, kommer tungan låg utanför munnen något. Om motstånd påträffas när du passerar sondmatning nålen till matstrupen, stoppa framåt nålen och återkalla det omedelbart. Ändra den nål ståndpunkten att kontrollera att nålen går in i matstrupen. Nålen kan vara att ange luftstrupen när motstånd uppstår, vilket skulle leda till injicera bakterier i lungorna istället för magen.

Tillämpning av grönt fluorescerande protein (GFP) som en biosensor är vanligt i biologiska experiment. Dock med GFP som en reporter för att iaktta den patogen infektion/koloniseringen i levande djur av i vivo imaging inte rekommenderas, eftersom absorbansen av hemoglobin, proteiner och vatten är hög mellan 200-650 nm26, som överlappar GFP (excitation 480 nm, emission 510 nm)27. Därför kan använder GFP signal som reporter för i vivo imaging avbrytas av hemoglobin, proteiner och vatten i djur26. Nära infrarött (NIR) fluorescensen är idealisk för i vivo imaging eftersom det absorbansen ligger runt 650-900 nm28, som ligger i regionen lägsta absorptionskoefficient av hemoglobin (< 650 nm) och vatten (> 900 nm)26 ,28 . När vävnad absorberar ljus, finns det dessutom en chans att inducera autofluorescens. När våglängderna av excitation och utsläpp varierar i fönstret GFP, inducerar det mycket mer autofluorescens än NIR29. Användning av NIR kan förbättra signalen till bakgrunden baserat på jämförelse med GFP genom att eliminera autofluorescens bakgrund29. Mareld kräver inte energi magnetisering att generera synligt ljus. Det beror på reaktionen katalysera substrat luciferin av dess enzymet luciferas och generera ljus. Eftersom Mareld inte kräver lampan direkt på ett prov, är bakgrunden signalen från ett prov mycket låg. Därför, användningen av Mareld som reporter är mer allmän och lättare för i vivo imaging. Däremot kräver fluorescens ljus magnetisering att inducera signalljus. När vävnader absorberar ljus, finns det en chans att det fluorescerande ljuset avges och inducera autofluorescens så att deras signal-brus är högre jämfört med det av Mareld.

Med tanke på EHEC är naturligtvis mindre koloniserade hos möss av oral infektion2,22, naturliga slemhinnor patogener av möss, kallas Citrobakter rodentium, har använts för att studera mekanismen kolonisering till murina värd som en surrogat bakterien22,30. Båda av EHEC och C. rodentium kolonisera tarmslemhinnan och inducera bildandet av A/E lesioner i värd22,30. De innehåller också LEE patogenicitet ön, som kodar en T3SS och flera effektor-proteiner som inducerad A/E lesion22,30. Därför, användningen av luciferas uttrycker plasmiden som reporter i C. rodentium att upptäcka colonization patologi och studera mekanismen kolonisering via ett in vivo imaging-system har också rapporterats14, 15. dock även C. rodentium infektion i möss är en användbar modell för att undersöka funktionen av T3SS och mekanismen av A/E lesion, C. rodentium innehåller inte Shiga toxin (Stx)30, vilket är en dominerande virulens faktor som orsakar njursvikt i EHEC, särskilt serotyp O157: H73. Även om en Stx-uttryckande C. rodentium stam byggts nyligen31, vilket är mer realistiskt att EHEC-infektion, det omfattar inte andra potentiella EHEC virulensfaktorer som är avgörande för kolonisering och/eller infektion. Dessutom delar C. rodentium 67% av sina gener med EHEC32, vilket tyder på att EHEC kan använda en skild från C. rodentium virulens under koloniseringen och/eller infektion.

Den luciferas uttrycker plasmiden används här, pWF27913, ändrades från pAKlux29 vars ryggrad är pBBR1MCS433. Även om pBBR1MCS4 har testats och replikeras i olika bakterier33, är det viktigt att kontrollera ursprunget för replikering (ORI) av denna plasmid är lämplig för bakteriell värd innan du använder denna plasmid-baserade luciferas för experimentet och således bekräftar att denna luciferas uttrycker Plasmiden kan replikera i den bakteriella mottagande. Vi använder antibiotika stress för att upprätthålla stabiliteten i plasmiden i bakterierna. När bakterier in djur i frånvaro av antibiotika, har självlysande signalera av vildtyp EHEC upptäckts för minst 2 dagar. Dock gjorde vi inte efter infektion längre än 2 dagar eftersom vi hade redan sett en signifikant skillnad i självlysande intensitet mellan EHEC WT och EHEC rfaD (som kodar en gen som krävs för EHEC syntetisera intakt LPS) mutant 2 dagar. För att bibehålla plasmiden stabilt i bakterier under frånvaro av antibiotika, kan en plasmid pCM1710,34 användas för detta ändamål. pCM17 kodar ett två-plasmid partitionering system och en post-segregational dödande mekanism för att säkerställa underhållet av Plasmiden i bakterier i frånvaro av antibiotika10,34. Den plasmiden pCM17 som innehåller de luxCDABE operon drivs av promotorn OmpC kan upptäckas av självlysande signal för minst 7 dagar8. En alternativ metod att få en kontinuerlig självlysande uttryck bakterier i frånvaro av antibiotika är att infoga luxABCDE gen i bakteriell kromosom35. Francis et al. används transposon införas luxABCDE operon och antibiotika kassetten slumpmässigt infogas i kromosomen av Streptococcus pneumoniae att erhålla Mareld stabil stam35.

I vår tidigare studie13utnyttjade vi detta modellsystem för att undersöka EHEC kolonisationen i en värd och jämföra skillnaden av colonization förmåga mellan EHEC vildtyp (WT) och muterade13. När möss administrerades självlysande EHEC rfaD mutant, självlysande signalerna minskat dramatiskt jämfört med att av WT EHEC efter 2 dagar efter infektion. Det ger bevis för att denna murina modell kan analysera mutation effekten av EHEC kolonisationen i värden. Terapeutiska behandlingar för att minska kolonisering av EHEC är vidare en övervägd, potentiella lösning till EHEC-infektion eftersom användningen av antibiotika är kontraindicerat5,36. Det därför värt att testa om detta modellsystem kan användas för att undersöka effekten av anti colonization läkemedel/behandlingar mot enterobakterier kolonisationen i värden. Vi tror att genom att använda denna modellsystem, det är möjligt att undersöka tidpunkten och platsen för inte bara EHEC, men också andra enterobakterier koloniseringen i vivo. Genom att använda denna djurmodell, processen för EHEC kolonisationen i möss kan övervakas och koloniseringen bördan i värden kan kvantifieras för att avgöra rumsliga och tidsmässiga koloniseringen av EHEC i levande djur. Det visualisering och kvantifiering av enterobakterier kolonisering med hjälp av denna modell gör det ett bra verktyg för att undersöka och analysera de fina mekanismerna för enterobacterial kolonisering och därmed kompensera för bristen på koloniseringen forskning och förbättra nuvarande kunskap.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna har något att avslöja.

Acknowledgments

Vi erkänner Chi-Chung Chen från Institutionen för medicinsk forskning, Chi Mei Medical Center (Tainan, Taiwan) för hjälpen i mus infektion och stöd från stadens laboratorium djur National Cheng Kung University. Detta arbete stöds av den Minister av vetenskap och teknik (de flesta) bidrag (mest 104-2321-B-006-019, 105-2321-B-006-011, and106-2321-B-006-005) till CC.

Materials

Name Company Catalog Number Comments
Shaker incubator YIH DER LM-570R bacteria incubation 
Orbital shaking incubator FIRSTEK S300 bacteria incubation 
pBSL180 source of nptII gene
pAKlux2 source of luxCDABE operon
T&A Cloning Kit Yeastern Biotech FYC001-20P use for TA cloning 
Nsi I NEB R0127S use for plasmid cloning 
Sca I NEB R0122S use for plasmid cloning 
Spe I-HF NEB R0133S use for plasmid cloning 
Sma NEB R0141S use for plasmid cloning 
T4 ligase NEB M0202S use for plasmid cloning 
Ex Taq TaKaRa RR001A use for PCR amplification
10X Ex Taq Buffer TaKaRa RR001A use for PCR amplification
dNTP Mixture  TaKaRa RR001A use for PCR amplification
PCR machine applied Biosystem  2720 thermal cycler   for PCR amplification
Glycerol SIGMA G5516-1L use for bacteria stocking solution
NaCl Sigma 31434-5KG-R chemical for making LB medium, 10 g/L
Tryptone CONDA pronadisa Cat 1612.00 chemical for making LB medium, 10 g/L
Yeast Extract powder Affymetrix 23547-1 KG chemical for making LB medium, 5 g/L
Agar CONDA pronadisa Cat 1802.00 chemical for making LB agar
kanamycin  Sigma K4000-5G antibiotics, use for seleciton
streptomycin  Sigma S6501-100G antibiotics, eliminate the microbiota in mice
EDL933 competent cell Homemade method is on supplemental document 
Electroporator MicroPulser for electroporation
Electroporation Cuvettes Gene Pulser/MicroPulser 1652086 for electroporation
High-speed centrifuge Beckman Coulter Avanti, J-26S XP use for centrifuging bacteria 
Fixed-Angle Rotor Beckman Coulter JA25.5 use for centrifuging bacteria 
Fixed-Angle Rotor Beckman Coulter JLA10.5 use for centrifuging bacteria 
centrifuge bottles Beckman Coulter REF357003 use for centrifuging bacteria 
centrifuge bottles Thermo Fisher scientific 3141-0500 use for centrifuging bacteria 
eppendorf biophotometer plus  eppendorf AG 22331 hamburg for measuring the OD600 value of bacteria
C57BL/6 mice  Laboratory Animal Center of NCKU
lab coat, gloves for personnel protection 
isoflurane  Panion & BF Biotech Inc. G-8669 for mice anesthesia, pharmaceutical grade
1ml syringe  use for oral gavage of mice
Reusable 22 G ball-tipped feeding needle φ0.9 mm X L 50 mm use for oral gavage of mice
surgical  scissors  use for mice experiment
Xenogen IVIS 200 imaging system Perkin Elmer IVIS spectrum use for bioluminescent image capture 
Living Image Software Perkin Elmer version 4.1 use for quantifying the image data

DOWNLOAD MATERIALS LIST

References

  1. Pennington, H. Escherichia coli O157. Lancet. 376, (9750), 1428-1435 (2010).
  2. Mayer, C. L., Leibowitz, C. S., Kurosawa, S., Stearns-Kurosawa, D. J. Shiga toxins and the pathophysiology of hemolytic uremic syndrome in humans and animals. Toxins (Basel). 4, (11), 1261-1287 (2012).
  3. Tarr, P. I., Gordon, C. A., Chandler, W. L. Shiga-toxin-producing Escherichia coli and haemolytic uraemic syndrome. Lancet. 365, (9464), 1073-1086 (2005).
  4. Obrig, T. G. Escherichia coli Shiga Toxin Mechanisms of Action in Renal Disease. Toxins (Basel). 2, (12), 2769-2794 (2010).
  5. Nguyen, Y., Sperandio, V. Enterohemorrhagic E. coli (EHEC) pathogenesis. Front Cell Infect Microbiol. 2, 90 (2012).
  6. Wiles, S., Robertson, B. D., Frankel, G., Kerton, A. Bioluminescent monitoring of in vivo colonization and clearance dynamics by light-emitting bacteria. Methods Mol Biol. 574, 137-153 (2009).
  7. Hutchens, M., Luker, G. D. Applications of bioluminescence imaging to the study of infectious diseases. Cell Microbiol. 9, (10), 2315-2322 (2007).
  8. Rhee, K. J., et al. Determination of spatial and temporal colonization of enteropathogenic E. coli and enterohemorrhagic E. coli in mice using bioluminescent in vivo imaging. Gut Microbes. 2, (1), 34-41 (2011).
  9. Karsi, A., Lawrence, M. L. Broad host range fluorescence and bioluminescence expression vectors for Gram-negative bacteria. Plasmid. 57, (3), 286-295 (2007).
  10. Lane, M. C., Alteri, C. J. S., Smith, S. N., Mobley, L. H. Expression of flagella is coincident with uropathogenic Escherichia coli ascension to the upper urinary tract. Proc Natl Acad Sci U S A. 104, (42), 16669-16674 (2007).
  11. Roxas, J. L., et al. Enterohemorrhagic E. coli alters murine intestinal epithelial tight junction protein expression and barrier function in a Shiga toxin independent manner. Lab Invest. 90, (8), 1152-1168 (2010).
  12. Siragusa, G. R., Nawotka, K., Spilman, S. D., Contag, P. R., Contag, C. H. Real-Time Monitoring of Escherichia coli O157:H7 Adherence to Beef Carcass Surface Tissues with a Bioluminescent Reporter. (1999).
  13. Kuo, C. J., et al. Mutation of the Enterohemorrhagic Escherichia coli Core LPS Biosynthesis Enzyme RfaD Confers Hypersusceptibility to Host Intestinal Innate Immunity In vivo. Front Cell Infect Microbiol. 6, 82 (2016).
  14. Wiles, S., et al. Organ specificity, colonization and clearance dynamics in vivo following oral challenges with the murine pathogen Citrobacter rodentium. Cell Microbiol. 6, (10), 963-972 (2004).
  15. Wiles, S., Pickard, K. M., Peng, K., MacDonald, T. T., Frankel, G. In vivo bioluminescence imaging of the murine pathogen Citrobacter rodentium. Infect Immun. 74, (9), 5391-5396 (2006).
  16. Contag, C. H., Contag, P. R., Mullins, J. I., Spillman, S. D., Stevenson, D. K., Benaron, D. A. Photonic detection of bacterial pathogens in living hosts. Mol Microbiol. 18, (4), 593-603 (1995).
  17. Hardy, J., Francis, K. P., DeBoer, M., Chu, P., Gibbs, K., Contag, C. H. Extracellular replication of Listeria monocytogenes in the murine gall bladder. Science. 303, (5659), 851-853 (2004).
  18. Kaniga, K., Sory, M. P., Delor, I., Saegerman, C., Limet, J. N., Cornelis, G. R. Monitoring of Yersinia enterocolitica in Murine and Bovine Feces on the Basis of the Chromosomally Integrated luxAB Marker Gene. Appl Environ Microbiol. 58, (3), 1024-1026 (1992).
  19. Trcek, J., Fuchs, T. M., Trulzsch, K. Analysis of Yersinia enterocolitica invasin expression in vitro and in vivo using a novel luxCDABE reporter system. Microbiology. 156, (Pt 9), 2734-2745 (2010).
  20. Morin, C. E., Kaper, J. B. Use of stabilized luciferase-expressing plasmids to examine in vivo-induced promoters in the Vibrio cholerae vaccine strain CVD 103-HgR. FEMS Immunol Med Microbiol. 57, (1), 69-79 (2009).
  21. Law, R. J., Gur-Arie, L., Rosenshine, I., Finlay, B. B. In vitro and in vivo model systems for studying enteropathogenic Escherichia coli infections. Cold Spring Harb Perspect Med. 3, (3), a009977 (2013).
  22. Ritchie, J. M. Animal Models of Enterohemorrhagic Escherichia coli Infection. Microbiol Spectr. 2, (4), EHEC-0022-2013 (2014).
  23. Chou, T. C., et al. Enterohaemorrhagic Escherichia coli O157:H7 Shiga-like toxin 1 is required for full pathogenicity and activation of the p38 mitogen-activated protein kinase pathway in Caenorhabditis elegans. Cell Microbiol. 15, (1), 82-97 (2013).
  24. Alexeyev, M. F., Shokolenko, I. N. Mini-Tnl 0 transposon derivatives for insertion mutagenesis and gene delivery into the chromosome of Gram-negative bacteria. Gene. 160, (1), 59-62 (1995).
  25. Wiegand, I., Hilpert, K., Hancock, R. E. Agar and broth dilution methods to determine the minimal inhibitory concentration (MIC) of antimicrobial substances. Nat Protoc. 3, (2), 163-175 (2008).
  26. Pansare, V., Hejazi, S., Faenza, W., Prud'homme, R. K. Review of Long-Wavelength Optical and NIR Imaging Materials: Contrast Agents, Fluorophores and Multifunctional Nano Carriers. Chem Mater. 24, (5), 812-827 (2012).
  27. Heim, R., Cubitt, A. B., Tsien, R. Y. Improved green fluorescence. Nature. 373, (6516), 663-664 (1995).
  28. Weissleder, R. A clearer vision for in vivo imaging. Nat Biotechnol. 19, (4), 316-317 (2001).
  29. Frangioni, J. In vivo near-infrared fluorescence imaging. Current Opinion in Chemical Biology. 7, (5), 626-634 (2003).
  30. Collins, J. W., et al. Citrobacter rodentium: infection, inflammation and the microbiota. Nat Rev Microbiol. 12, (9), 612-623 (2014).
  31. Mallick, E. M., et al. A novel murine infection model for Shiga toxin-producing Escherichia coli. J Clin Invest. 122, (11), 4012-4024 (2012).
  32. Petty, N. K., et al. The Citrobacter rodentium genome sequence reveals convergent evolution with human pathogenic Escherichia coli. J Bacteriol. 192, (2), 525-538 (2010).
  33. Kovach, M. E., Elzer, P. H., Hill, D. S., Robertson , G. T., Farris, M. A., Roop, R. M. II, Peterson, K. M. Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene. 166, (1), 175-176 (1995).
  34. Galen, J. E., Nair, J., Wang , J. Y., Wasserman, S. S., Tanner, M. K., Sztein , M. B., Levine, M. M. Optimization of Plasmid Maintenance in the Attenuated Live Vector Vaccine Strain Salmonella typhiCVD 908-htrA. Infect Immun. 67, (12), 6424-6433 (1999).
  35. Francis, K. P., et al. Visualizing pneumococcal infections in the lungs of live mice using bioluminescent Streptococcus pneumoniae transformed with a novel gram-positive lux transposon. Infect Immun. 69, (5), 3350-3358 (2001).
  36. Goldwater, P. N., Bettelheim, K. A. Treatment of enterohemorrhagic Escherichia coli (EHEC) infection and hemolytic uremic syndrome (HUS). BMC Med. 10, (2012).
Påvisande av entrohemoragiska <em>Escherichia Coli</em> koloniseringen i murina mottagande av icke-invasiva <em>In Vivo</em> Mareld System
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Kuo, C. J., Wang, S. T., Chen, C. S. Detection of Enterohemorrhagic Escherichia Coli Colonization in Murine Host by Non-invasive In Vivo Bioluminescence System. J. Vis. Exp. (134), e56169, doi:10.3791/56169 (2018).More

Kuo, C. J., Wang, S. T., Chen, C. S. Detection of Enterohemorrhagic Escherichia Coli Colonization in Murine Host by Non-invasive In Vivo Bioluminescence System. J. Vis. Exp. (134), e56169, doi:10.3791/56169 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter