Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Non-invaziv Vivo içinde Bioluminescence sistemi tarafından fare konak Enterohemorrhagic Escherichia Coli kolonizasyon algılama

doi: 10.3791/56169 Published: April 9, 2018

Summary

Bir fare modeli enterohemorrhagic bioluminescence etiketli bakteri kullanarak E. coli (EHEC) kolonizasyon için detaylı bir protokol sunulmuştur. Kollarındaki bu bakteriler tarafından bir non-invaziv görüntüleme sistemi içinde canlı hayvan vivo içinde tespiti geçerli anlayışımız EHEC kolonizasyon ilerletebilirsiniz.

Abstract

Enterohemorrhagic E. coli (EHEC) O157: H7, hangi o causesdiarrhea, Hemorajik kolit (HS), gıda kaynaklı patojen olduğunu ve hemolitik üremik Sendromu (HUS), kolonize insanlar bağırsak için. EHEC kolonizasyon içinde vivo detaylı mekanizması çalışmaya EHEC kolonizasyon ölçmek ve izlemek için hayvan modelleri olması esastır. Burada bir fare-EHEC kolonizasyon modeli kollarındaki ifade plazmid EHEC izlemek ve yaşam ana EHEC kolonizasyon ölçmek için dönüşüm tarafından göstermektedir. Bioluminescence etiketli EHEC ile aşılanmış hayvanlar yoğun kollarındaki sinyalleri farelerde algılama tarafından görüntüleme sistemi bir non-invaziv vivo içinde ile göstermek. Sonra 1-2 gün enfeksiyon sonrası, kollarındaki sinyalleri hala enfekte hayvanlarda da EHEC konaklarda en az 2 gün için kolonize gösterir tespit edilemedi. Biz de bu kollarındaki EHEC bulun ki fare Bağırsaklarda, özellikle çekum ve iki nokta üst üste, için ex vivo imge--dan göstermek. Bu fare-EHEC kolonizasyon model EHEC kolonizasyon mekanizma mevcut bilgi ilerlemek için bir araç olarak hizmet verebilir.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

EHEC O157: H7 nedenleri ishal1, HS2, HUS3ve hatta Akut böbrek yetmezliği4 kontamine su veya gıda ile bir patojen var. EHEC patojenik bir enterobacterium olduğunu ve insanların1gastrointestinal sistem colonizes. EHEC ilk uygun zaman ana bağırsak epiteli, kolonizasyon faktörler bir bağlama inducing ve daha sonra zorlamak için (A/E) lezyon effacing moleküler bir şırınga işlev gören tür III salgı sistemi (T3SS) ile ana hücreleri içine enjekte yapışma (kolonizasyon)5. Bu genlerin A/E lezyon oluşumunda yer alan Enterocytes efasman (LEE) patojenitesi ada5locus tarafından kodlanır.

Bioluminescence olduğunu ışık üreten kimyasal reaksiyon, görünür ışık6oluşturmak için onun substrat biyoluminesans hangi luciferase tromboksan. Enzimatik bu işlem genellikle oksijen veya adenozin trifosfat (ATP)6varlığını gerektirir. (BLI) görüntüleme bioluminescence araştırmacılar canlı hayvan7görselleştirme ve ana bilgisayar-patojen etkileşimlerin niceleme sağlar. Saçınıza canlı hayvan bakteriyel enfeksiyon döngüsünde onlar göç ve farklı dokular7istila kollarındaki bakteri izleyerek karakterize olabilir; Bu enfeksiyon dinamik bir ilerleme ortaya koymaktadır. Ayrıca, hayvanlarda bakteri yükü kollarındaki sinyal8' e ilişkilidir; Böylece, deneysel hayvan patolojik şartları basit ve doğrudan bir şekilde tahmin etmek için uygun bir göstergedir.

Burada kullanılan plazmid luciferase operon, bakteri, kendi luciferase substrat7,9kodlar Photorhabdus luminescens olan luxCDABE, yer. Bu luciferase ifade plazmid bakteri dönüştürerek, canlı hayvan kollarındaki bu bakteri gözlemleyerek kolonizasyon ve enfeksiyon işlemleri izlenebilir. Genel olarak, alma ve bioluminescence etiketli bakteri araştırmacılar bakteri numaraları ve konumu, bakteriyel canlılığı antibiyotikler/tedavi ve bakteri gen ekspresyonu enfeksiyon/kolonizasyon6, ile izlemek izin 7. çok sayıda patojen bakteri enfeksiyonu onların enfeksiyon döngüsü ve/veya gen ifade incelemek için luxCDABE operon express bildirilmiştir. Bu bakterilerin uropathogenic E. coli10, EHEC8,11,12,13, enteropathogenic de dahil olmak üzere, E. coli (EPEC)8, Sitrobacter rodentium14,15, Salmonella typhimurium16, Listeria Monositogenez17, Yersinia enterocolitica18,19, ve Vibrio cholerae20, dokümante edilmiştir.

EHEC kolonizasyon vitro ve in vivo21,22,23çalışma kolaylaştırmak için çeşitli modeller geliştirilmiştir. Ancak, EHEC kolonizasyon vivo içindeçalışmaya uygun hayvan modellerin eksikliği ve böylece ayrıntılar ortaya çıkan bir yetersizliği olduğunu. EHEC kolonizasyon mekanizması vivo içindeçalışma kolaylaştırmak için gözlemlemek ve non-invaziv bir yöntem canlı hayvan EHEC kolonizasyon ölçmek için hayvan modelleri oluşturmak için değerlidir.

Bu el yazması kollarındaki ifade sisteminin EHEC kolonizasyon zaman içinde yaşayan ana bilgisayarları izlemek için kullandığı bir fare-EHEC kolonizasyon modeli açıklar. Fareler intragastrically bioluminescence etiketli EHEC ile aşılanmış ve kollarındaki sinyal farelerde sistem13Imaging bir non-invaziv vivo içinde ile algılanır. Sonra 2 gün sonra 2 gün enfeksiyon sonrası bu bakteri konak bağırsaklarda kolonize önerilen enfeksiyon sonrası önemli kollarındaki sinyalleri onların bağırsaklarda gösterdi EHEC bioluminescence etiketli fareler bulaşmış. Ex vivo görüntü verilerini bu kolonizasyon özellikle çekum ve kolon farelerin olduğunu gösterdi. Bu fare-EHEC modelini kullanarak, kollarındaki EHEC kolonizasyon yaşam ana bilgisayarında bir görüntüleme sistemi daha fazla anlayış teşvik edebilir enterik bakteri kolonizasyonu detaylı mekanizmaları incelemek için in vivo tarafından tespit edilebilir EHEC kaynaklı fizyolojik ve patolojik değişiklikler.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Dikkat: EHEC O157: H7 Biyogüvenlik seviye 2 (BSL-2) olan patojen merkezleri hastalık kontrol ve Önleme (CDC) Biyogüvenlik talimat (https://www.cdc.gov/) göre. Bu nedenle, tüm deneysel prosedürler EHEC içeren BSL-2 tesisinde gerçekleştirilmelidir. Laboratuvar mont ve eldiven giymek deney yaparken. Bir Sertifikalı Biyogüvenlik içinde dolap (BSC) çalışır. Deneysel kürsüye önce ve deneysel bir işlem ile % 70 etanol sonra dezenfekte. Bütün aletleri veya ekipman kişi (veya potansiyel kişi) EHEC % 70 etanol veya çamaşır suyu ile dezenfekte. Kirlenmiş (veya potansiyel olarak kontamine) atıkların dikkatle mühürlü ve autoclaved olmalıdır. Bir maske, göz koruması, çift eldiven veya tulum, gerekirse giymek. 6-hafta-yaşlı C57BL/6 dişi fareler satın ve laboratuvar hayvan Merkezi, ulusal Cheng Kung Üniversitesi (NCKU) yapılmaktadır. Hayvan deneyleri kurumsal hayvan bakım ve kullanım NCKU Komitesi (onay numarası 104-039) tarafından kabul edildi.

1. Bioluciferase etiketli EHEC bakteri üretimi

  1. Mix 50 ng deoksiribonükleik asit (DNA), 1 μL her 10 mikron ileriye ve geriye doğru astar, 2 μL 2.5 mM deoxynucleotides (dNTPs), 2 μL 10 x arabellek, 0.2 μL DNA polimeraz ve steril çift distile su (GKD2O) yükseltmek için 20 μL son hacmiyle Anti-sefaloridin kaset, nptII gen24. PBSL18024Ulusal BioResource Projesi (NBRP) üzerinden satın alınan, DNA şablonudur. PCR koşulları Tablo 1 ' de listelenen ve astar sıra Tablo 2' de kullanılabilir.
  2. PCR ürünleri ticari bir klonlama vektör seti takip için ligate ( Tablo malzemelerigörmek) protokol.
  3. NptII gen parçası NsiI ve SmaI klonlama vektöründen tüketim ve sefaloridin dayanıklı plazmid oluşturmak için pAKlux29 NsiI ve ScaI tarafından sindirilmiş pBBR1MCS4 içine clone, pWF27813.
  4. Plazmid9, pAKlux2, SpeI-HF ve ScaI ve klon tarafından ifade luciferase üzerinden luxCDABE operon tüketim SpeI-HF ve SmaI sefaloridin oluşturmak için pWF278 sindirmek dayanıklı ve plazmid, pWF27913ifade luciferase.
    Not: plazmid çekimi ve eksize parçası purifications, ticari plazmid çıkarma ve jel ekstraksiyon kiti, sırasıyla kullanın. Enzim sindirim için 100 ng DNA, 1 μL 10 x tampon, her seçili restriksiyon enzimi ve steril GKD2O 10 μL, toplam hacmiyle 1 μL mix ve 2.5-3 h 37 ° C'de kuluçkaya.
  5. PWF279 plazmid elektroporasyon ile 2500 V 4 ms için tarafından E. coli O157: H7 EDL933 yetkili hücrelere dönüşümü.
  6. 1 mL Luria-Bertani (LB) orta 1 h için 37 ° C'de dönüştürülmüş bakteri hücrelerinde kuluçkaya.
  7. 16-18 h için 37 ° C'de sefaloridin 50 µg/mL ile desteklenmiş bir LB agar plaka üzerinde bakteri plaka.
  8. Plaka kollarındaki sinyal makine ertesi gün Imaging bir vivo içinde tarafından kontrol edin. Bir koloni plaka almak ve 3 ml 50 µg/mL sefaloridin 16-18 h için 37 ° C'de ile takıma LB kültür.
  9. Bakteriyel hisse senedi orta sulandrarak hazırlamak % 100 gliserol % 30 gliserol çözüm yapmak için steril GKD2O.
  10. Sefaloridin dayanıklı Don E. coli O157: H7 EDL933 bakteri olarak bakteri kültürü ve % 30 gliserol çözüm-80 ° C'de 1:1 oranında bir vidalı kapak cryovial bakteriyel bir hisse senedi olarak luciferase plazmid yataklık Gliserol son konsantrasyonu % 15 olduğunu.

2. kollarındaki EHEC bakteri hazırlık Oral aşılama için

Not: Zaman çizelgesi akış çizelgesi EHEC hazırlık ve fare oral gavaj deneysel prosedürleri deneysel hazırlanmasında yardımcı olmak için şekil 1 ' deki sunulur.

  1. Çizgi E. coli O157: H7 EDL933 bakteri luciferase plazmid 50 µg/mL sefaloridin-80 ° C stoktan bir LB agar plaka üzerine yataklık. 16-18 h 37 ° C'de için bakteri büyümesi
  2. Bir koloni gecede plaka ve kültür 3 mL LB orta 50 µg/mL sefaloridin 16-18 h 37 ° C kuluçka 220 RPM ile seç.
  3. Alt kültür için 2,5-3 h 37 ° C kuluçka 200 devirde LB suyu içeren bakteri (1: 100 seyreltme) sefaloridin (50 µg/mL). (Örneğin, 2 mL gecede takıma 200 mL LB orta sefaloridin (50 µg/mL) ile bakteri kültürlü ekleyin).
  4. Bakteri 2.5-3 h için kuluçkaya ve 600 optik yoğunluk değerini ölçmek nm (OD600) değeri olduğunu 0,9-1 arasında. Yaklaşık 108 koloni oluşturan birim (CFU) yoğunluğudur: bakteri hücre numarası / mL.
  5. 8000 x g 30 dk, 4 ° c'de yeniden kültürlü bakteri santrifüj kapasitesi
  6. Süpernatant bakteri Pelet Tantanacı olmadan atmak ve 100 mL % 0,9 steril normal salin ile pelet tarafından nazik ajitasyon yıkayın.
  7. 2.5 ve 2.6 bir kez adımları yineleyin.
  8. Wash sonra santrifüj kapasitesi 8000 x g 30 dk, 4 ° C de bakteri kültürü ve süpernatant yavaşça atın.
  9. Yoğuşma Pelet, 100-fold %0,9 steril normal salin ile. 200 mL bakteri centrifuged, örneğin, pelet askıya almak için 2 mL normal tuz ekleyin.
  10. (Yaklaşık 109 CFU/100 μL yoğunlaşma sonra normal salin olması gereken) CFU bakteri ile 10 kat seri seyreltme25konsantre bakteri kaplama tarafından onaylayın.

3. fare sözlü sonda ile besleme, EHEC

  1. 6-hafta-yaşlı kadın C57BL/6 fareler streptomisin su (5 g/L) için 24 h ile tedavi.
  2. 24 saat sonra normal içme suyu başka bir 24 saat daha önce sonda ile besleme için geçiş yapın. 24 h için düzenli su ile tedavi sonra fareler EHEC oral gavaj için hazırsınız demektir.
  3. Şırınga ile 100 μL EHEC bakteri üzerinde pistonu geri çekerek doldurun. Şırıngada hava hava kabarcığı yok olduğundan emin olun. Baloncuklar şırınga ile parmaklarını şaklatarak kaldırın.
  4. Hayvan yavaşça kaldırın ve bakım ile kafes üstüne yerleştirin.
  5. Fareyi kuyruğundan dikkatle tutun ve hayvan kafes üst kavrama ve uzaklaşmaya girişimi.
  6. Yavaşça fare derisi boyun ve arka başparmak ve işaret parmağı fare başkanı taşınmasını engelleme hayvanla açgözlü tarafından dizginlemek.
  7. Fare sonda ile besleme iğne yerleştirin ve fare immobilize ve dikey başıdır emin olmak için bir dikey konumda tutun.
  8. Sonda ile besleme iğneyi ağız çatı takip fare ağzına yerleştirin ve yemek borusu ve mide doğru aşağı taşı.
  9. Eklenen iğne yarısı veya üçte iki uzunluğu fare olduğunda yaklaşık 109 CFU hücreleri içeren 100 μL EHEC bakteri enjekte et.

4. görsel öğe

  1. Oral gavaj sonra 1-2 gün kollarındaki sinyalleri algılayabilir.
  2. Hayvanların kollarındaki sinyalleri inceleyerek önce onları % 2.5 isoflurane 1, 5 L/dk oksijen ile TMMOB içine koyarak onları anestezi.
  3. Olana kadar tüm fareler bilinçsiz ve hareket durdurmak için 2-5 dk bekle. Hayvanlar bioluminescence vivo içinde tespiti için hazırsınız demektir.
  4. Algılamak ve hayvanların kollarındaki sinyalleri görüntüleme sistemi bir vivo içinde tarafından görüntü. Bölüm 5 "Veri toplama" yazılım işlem için bakınız. Görüntüleme işlemi sırasında tüm % 2.5 isoflurane 1, 5 L/dk oksijen ile sürekli bir tedarik altında hayvanlardır.
    1. Tıkırtı eğe > canlı ve el ile fare üzerinde odaklanmak.
    2. Pozlama zaman ve lazer yoğunluğunu seçin.
    3. Tıklama elde etmek > yakalamak.
  5. Ex vivo görüntüleme için fareler tarafından servikal çıkığı ötenazi ve virüslü fareleri tüm bağırsak kaldırın. Bağırsak bir 9-cm Petri kabına ve resim görüntüleme sistemi içinde vivo tarafından yerleştirin. Aynı görüş alanı A/b olarak ayarlanır dışında vivo içinde görüntüleme ayardır Lütfen ayrıntılar için Bölüm 5 "Veri toplama" bakın.
    Not: Yöntem servikal yerinden çıkması için: kafes üstünde fare böylece hayvanları kafes kavrama tek elle kuyruk açgözlü dizginlemek. Pen marker veya başparmak ve ilk parmak boyun arkası karşı diğer el kafatası tabanında yer. Hızlı bir şekilde el veya nesne ile baş frenleyici push ileri ve kuyruğunu tutan el ile geri çekin.
    Yakından solunum durması ve kalp atışı yoktu onaylamak için kontrol edin.

5. veri toplama

Not: yazılım veri toplama için kullanılan Malzemeler tablolistelenir.

  1. Resim alma için satın alma kontrol panelinin yazılımı (Şekil 2) açın.
  2. Seç "ışıklı," "Fotoğraf" ve "Overlay"
  3. Pozlama süresi "Otomatik" olarak ayarlayın "Orta" Binning ayarla
  4. Işıksaçan ve 8 için ƒ/1 durağı ayarlamak fotoğraf için. Ƒ/durdur denetimleri ışık miktarını CCD algılayıcısı tarafından aldı.
  5. Görüntüleri elde etmek için ilgi alanına göre görüş alanı ayarlayın. Seçenek "D" beş 6-hafta-yaşlı fareler uygun ve onları teker teker görüntü. "C" üç 6-hafta-yaşlı fare bir alandaki görüntü.
  6. Fare/örnekleri görüntüleme için hazır olduğunuzda, resim alma için "Al" düğmesini tıklatın.
  7. Satın alınan görüntü verilerini açın.
  8. Araç paleti paneli (şekil 3) açın.
  9. ROI araçlarını seçin. Daire (en soldaki bir) (şekil 4) görüntülerde kollarındaki alan aralığı için tavsiye ediyoruz.
  10. "Ölçü yüzey kollarındaki yoğunluğu (şekil 3) ölçmek için ROIs" (kalem simgesi) tıklatın. Yatırım Getirisi ölçümleri panelinde ve miktar değerleri (şekil 5) görünür.
  11. Yapılandırmak ölçü ROI ölçüm panelinin sol köşesinde değerleri/gerekli bilgileri (şekil 6) seçin, aksi takdirde "Bu veri tablosunu verin ve .csv dosyası (şekil 5) olarak kaydetmek için Dışa Aktar" düğmesini tıklatın için kullanın.
  12. Kollarındaki yoğunluğu miktar .csv dosyasındaki değerleri sütun "Toplam akı (p/s)" kullanın.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Bioluminescence etiketli EHEC yönetilen (~ 109 bakteri hücreleri) 6 - hafta eski kadın C57BL/6 farelere oral gavaj tarafından. EHEC farelere 1s içinde sözlü aşı sonra hayvanlar kollarındaki sinyali VIVO içinde görüntüleme sistemi Şekil 7gösterildiği gibi tarafından incelenmiş. Sonuçlar sonda ile besleme farelerde bioluminescence etiketli EHEC ile güçlü bir kollarındaki sinyal gösterdi. Biz 2 gün sonrası enfeksiyon sinyalleri inceledi. Şekil 8Aiçinde gösterildiği gibi ile EDL933 sonra bile 2 gün EHEC konaklarda 2 gün kolonize önerilen enfeksiyon sonrası yoğun kollarındaki sinyalleri gösterdi vahşi tipi EHEC bioluminescence etiketli fareler aşılandı. Biz de intragastrically bioluminescence etiketli EDL933ΔrfaD (ΔrfaD) farelere (şekil 8A) hasta. Bu mutant iltica lipopolysaccharide (LPS), kolonizasyon konak önceki çalışma azaltmak için gösterilmiştir. Şekil 8Aiçinde gösterildiği gibi ΔrfaDiçinde tespit kollarındaki sinyal var-yok veya daha az bakteri olduğunu göstermektedir virüslü fareleri hücreleri kolonize fareler. Miktar floresan sinyal resim 8Biçinde gösterilir. Daha sonra bu bioluminescence etiketli bakteri konumunu tespit edilmiştir. Virüslü fareleri insanca kurban edildi ve onların tüm ince bağırsak kaldırıldı. Fareler 2 gün sonrası enfeksiyon bağırsağından 9 cm Petri yemekler üzerinde konumlandırılmış ve ex vivo (Þekil 9A) görüntüsü. Bioluminescence etiketli enfekte EDL933 fareler bağırsak dokuların kollarındaki sinyaller çekum ve iki nokta üst üste, kollarındaki bu EHEC 2 gün için çekum ve virüslü farelerin kolon kolonize olduğunu öneren de önemli bir artış ortaya En azından. Buna ek olarak, ortaya bioluminescence etiketli ΔrfaD ile (Þekil 9A), enfekte fareler kollarındaki sinyali VIVO içinde görüntü (şekil 8A ile tutarlıdır onların bağırsak dokusunda azalma ). Miktar floresan sinyal şekil 9Biçinde gösterilir.

Figure 1
Resim 1 : Zaman çizelgesi deneysel hazırlık akış şeması,.
Zamanlama bakış kollarındaki EHEC bakteri hazırlamak ve streptomisin ile fareler pretreat gerekiyordu. (A) EHEC hazırlık. (B) fareler hazırlık. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 2
Resim 2 : Vivo sistemi edinme Denetim Masası Imaging.
Örnekleri Imaging önce IVIS edinme kontrol panelini açın. Seç "ışıklı," "Fotoğraf" ve "Overlay" Pozlama süresi "Otomatik" olarak ayarlayın "Orta" Binning ayarla Işıksaçan ve 8 için ƒ/1 durağı ayarlamak fotoğraf için. Ƒ/durdur denetimleri ışık miktarını CCD algılayıcısı tarafından aldı. Örnekleri görüntüleme için hazır olduğunuzda, görüntüleri elde etmek için "al" düğmesini tıklatın. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 3
Şekil 3 : Araç paleti paneli.
Elde görüntüsü sonra kollarındaki yoğunluğu miktarının için araç paleti panelini kullanın. Araç paleti panelini açın ve veri görüntü. Görüntülerde kollarındaki sinyal aralığı için yatırım Getirisi araçlarından birini seçin. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 4
Şekil 4 : Örnek kollarındaki sinyalini miktar için.
Kollarındaki sinyal alanı görüntülerde ROI araçları tarafından çevrili. Burada gösterilen tüm kollarındaki sinyaller kırmızı daire içinde var. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 5
Şekil 5 : Yatırım Getirisi ölçümleri.
Kollarındaki sinyalleri çember ve "Ölçü ROIs" üzerinde araç paleti Masası'nı tıklatın sonra değerleri gösterildiği gibi sunulmaktadır. Toplam akı (p/s) sütunun değerlerine kollarındaki yoğunluğu miktar için kullanılır. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 6
Şekil 6 : Farklı miktar bilgi eklemek.
Yapılandırmak ölçüm üzerinde yatırım Getirisi ölçüm panelinin sol köşesinde tıklatarak, diğer istenen miktar değerleri/bilgi seçebilirsiniz. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 7
Şekil 7 : Kollarındaki EHEC ile aşılanmış sonra farelerin temsilcisi imaj.
Farelerin temsilcisi görüntü ile kollarındaki EHEC 1s içinde sözlü sonda ile besleme tarafından aşılandı. Renk ölçeği parlaklığı (p/s/cm2/sr) temsil eder. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 8
Şekil 8 : Fare görüntülerini aşısını bioluminescence etiketli EHEC ile 2 gün sonra.
(A)temsil görüntü farelerin aşısını kollarındaki vahşi türüyle EHEC EDL933 ve EDL933:ΔrfaD sonra 2 gün enfeksiyon sonrası oral gavaj tarafından. (B) miktar bioluminescence yoğunluk farelerin EHEC ile enfekte. Hata çubukları standart sapmalar gösterir. Temsili resim gösterilir. Tüm deneyler bağımsız olarak üç kez 2-3 hayvanlar ile her zaman yapılmıştır ve hata çubukları standart sapmalar gösterir. P-değerleri t-testi ile istatistiksel analiz sonuçlarını gösterir. Renk ölçeği parlaklığı (p/s/cm2/sr) temsil eder. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 9
Şekil 9 : Virüs bulaşmış fareler bağırsak dokuların görüntülerle bioluminescence etiketli EHEC.
(A) 2 gün sonra aşılama ile bioluminescence etiketli EHEC, fareler euthanized ve tüm intestinal doku çıkarıldı ve ex vivogörüntüsü. Temsili resim gösterilir. (B) miktar bioluminescence yoğunluk EHEC ile enfekte fareler gelen bağırsak dokuların. Tüm deneyler bağımsız olarak üç kez 2-3 hayvanlar ile her zaman yapılmıştır ve hata çubukları standart sapmalar gösterir. P-değerleri t-testi ile istatistiksel analiz sonuçlarını gösterir. Renk ölçeği parlaklığı (p/s/cm2/sr) temsil eder. Ölçek çubuğu temsil eder 1 cm. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Adımları Sıcaklık Zaman Döngü sayısı
İlk denatürasyon 95 ° C 10 dk 1
Denatürasyon 95 ° C 30 sn 35
Tavlama 58,4 ° C 30 sn
Uzantısı 72 ° C 1,5 dk
Son uzantısı 72 ° C 10 dk 1
Basılı tutun 4 ° C 1

Tablo 1: Polimeraz zincir reaksiyonu (PCR) koşulları

Astar adı Sıra
nptII F 5' CCTATGCATAATAATTCCGCTAGCTTCACG3'
nptII R 5' GCTCCACCGATAATATTCCTGAGTCATACT3'

Tablo 2: yükseltmek için kullanılan astar dizileri nptII

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Bu luciferase plazmid ile dönüştürülmüş EHEC onun Yerelleştirme Ana bilgisayarlar veya gen ifade vivo içinde8,11,12incelemek için kullanılan bildirilmiştir. Aşağıda gösterildiği fare modeli ayrıca fare ana bilgisayar8' bulmak belgili tanımlık kolonize EHEC zamanlama ve yerelleştirme bildirilmiştir. Yine de, biz, farelere EHEC aşılama intragastrically yönetmek ve kollarındaki bakteri oral gavaj için dikkatlice hazırlanmanız ayrıntı iletişim kuralı sağlar. Özellikle, sonda ile besleme iğne takıldığında EHEC (Adım 3.7) fare oral gavaj için fare baş konumu önemlidir. Dikey konumu yoksa, iğne geçmek zor olacak ve muhtemelen fare zarar. Sonda ile besleme iğne fareyi, ağız içinde olduğunda 3.8 adımda dilini ağız dışında biraz yatıyordu olacaktır. Direnç sonda ile besleme iğne yemek borusu geçerken oluşursa, iğne ileri hareket etmeyi bırak ve hemen geri. İğne özofagus giriyor emin olmak için iğne pozisyon değiştirin. Direnç, hangi bakteri mide yerine akciğerlerde enjekte için yol açacak oluştuğunda iğne Trakea girerek.

Bir Biyoalgılayıcı olarak yeşil flüoresan protein (GFP) uygulama biyolojik deneylerde yaygındır. Ancak, GFP patojen bulaşma/kolonizasyon yanında vivo içinde düşsel Canlı hayvanlarda tavsiye edilmez, çünkü Absorbans hemoglobin, proteinler ve su tarafından hangi ile çakışıyor 200-650 nm26arasında yüksek gözlemlemek için muhabir olarak kullanma GFP (uyarma 480 nm, emisyon 510 nm)27. Bu nedenle, GFP kullanarak vivo içinde görüntüleme için bir muhabir olarak sinyal hemoglobin, proteinler ve hayvanlar26su tarafından durdurulabilir. Yakın kızılötesi (Nur) floresan çevresinde onun Absorbans pencere olduğu için vivo içinde görüntüleme için ideal olan en düşük emme katsayısı hemoglobin bölgede 650-900 nm28, (< 650 nm) ve su (> 900 nm)26 ,28 . Ayrıca, doku ışık emer olduğunda autofluorescence ikna etmek için bir şans. GFP penceresinde uyarma ve emisyon dalga boyu aralığı zaman NIR29daha çok daha fazla autofluorescence neden olmaktadır. NIR kullanımı sinyal GFP autofluorescence arka plan29ortadan kaldırarak kıyasla arka plan oranı artırabilir. Bioluminescence görünür ışık üretmek için enerji uyarma gerektirmez. Substrat biyoluminesans onun enzim luciferase tarafından katalize ve ışık oluşturmak için tepki olarak bağlıdır. Bioluminescence ışık doğrudan bir örnek gerektirmez, arka plan sinyal bir örnekten çok düşüktür. Bu nedenle, daha genel ve vivo içinde görüntüleme için daha kolay bir muhabir olan biyolüminesans kullanın. Buna ek olarak, Floresan ışık uyarma sinyal ışık ikna etmek için gerektirir. Doku ışık absorbe olduğunda bir şans Floresan ışık yayılan ve böylece onların sinyal gürültü daha bu bioluminescence göre autofluorescence ikna etmek.

EHEC doğal olarak daha az oral enfeksiyon2,22tarafından fareler kolonize olduğunu düşünürsek, Sitrobacter rodentium, adı verilen farelerin doğal Mukozal patojen fare ana bilgisayara kolonizasyon mekanizması çalışmaya kullanılmıştır bir bakteri22,30vekil. EHEC ve C. rodentium her ikisi de bağırsak mukoza kolonize ve ana bilgisayar22,30A/E lezyonlarının oluşumu teşvik. Ayrıca bir T3SS ve A/E lezyon22,30indüklenen çeşitli efektör Protein kodlayan LEE patojenitesi adanın içerirler. Bu nedenle,14, luciferase C. rodentium kolonizasyon patoloji tespit ve kolonizasyon mekanizması içinde vivo görüntüleme sistemi ile çalışma bir muhabiri de olduğu gibi plazmid ifade kullanımı bildirdi 15. C. rodentium enfeksiyon farelerin T3SS fonksiyonu ve A/E lezyon mekanizmasının araştırmak için uzun bir faydalı model olsa da, yine de, C. rodentium Shiga toksin (Stx)30, bir baskın olduğu içermiyor EHEC, özellikle serotip O157: H73böbrek yetmezliği nedenleri virülans faktörü. Stx ifade C. rodentium zorlanma inşa edilmiştir, ancak son zamanlarda EHEC enfeksiyona daha gerçekçi olan31, bu kolonizasyon ve/veya enfeksiyon için çok önemli potansiyel diğer EHEC virülans faktörleri içermez. Ayrıca, C. rodentium , genlerin % 67 EHEC32EHEC virülans C. rodentium farklı kolonizasyon ve/veya enfeksiyon sırasında kullanabilir öneriyor, paylaşır.

Burada, pWF27913, kullanılan plazmid ifade luciferase olan omurga pBBR1MCS433pAKlux29 güncellenmiştir. PBBR1MCS4 test edilmiş ve çeşitli bakteri33olarak çoğaltılan, çoğaltma (ORI) bu plazmid kökenli olup bakteriyel ana bilgisayar için uygun bu luciferase plazmid tabanlı sistem denemenin kullanmadan önce emin olmak çok önemli olsa da ve Böylece teyit plazmid ifade bu luciferase bakteriyel konak çoğaltabilirsiniz. Antibiyotik stres plazmid Candidatus kararlılığını korumak için kullanıyoruz. Bakterilerin antibiyotik yokluğunda hayvanlar girdiğinizde, vahşi tipi EHEC kollarındaki sinyal en az 2 gün için algılandı. Ancak, biz zaten Işıksaçan yoğunluğu önemli bir fark (Bu bir gen sağlam LPS sentezleme EHEC için gerekli kodlar) EHEC rfaD arasındaki EHEC WT gördüğüm için enfeksiyon 2 gün daha uzun süre takip değil 2 gün, mutant. Plazmid stabil bakterilerde antibiyotik yokluğu altında korumak için plazmid pCM1710,34 bu amaç için kullanılabilir. pCM17 bir iki-plazmid bölümleme sistemi ve bakterilerde antibiyotik10,34yokluğunda plazmid bakım sağlamak için bir post-segregational öldürme mekanizması kodlar. Plazmid pCM17 OmpC düzenleyici tarafından tahrik luxCDABE operon tarafından en az 7 gün8için kollarındaki sinyal tespit edilebilir içeren. Sürekli kollarındaki ifade bakteriler antibiyotikler yokluğunda elde etmek için alternatif bir yöntem bakteriyel kromozom35 luxABCDE gen eklemektir. Francis kullanılan vd. transposon rastgele bioluminescence stabil zorlanma35elde etmek için Streptococcus pneumoniae kromozom eklenen luxABCDE operon ve antibiyotik kaset eklenmiş.

Bizim önceki çalışma13' te, EHEC kolonizasyon bir ev sahibi incelemek ve kolonizasyon yetenek EHEC vahşi türü (WT) ve mutant13arasında fark karşılaştırmak için bu modeli sistemi kullanılmaktadır. Ne zaman fare yönetilen kollarındaki EHEC rfaD mutant önemli ölçüde azalmış kollarındaki sinyalleri için WT EHEC 2 gün sonra enfeksiyon sonrası karşılaştırıldığında. Bu fare modeli EHEC kolonizasyon ev sahibi mutasyon etkisini çözümleyebilirsiniz kanıt sağlar. Ayrıca, EHEC kolonizasyon azaltmak için tedavi tedaviler bir çözümdür düşünülmüş, potansiyel EHEC enfeksiyon için antibiyotik kullanımı kontrendikedir5,36olduğundan. Bu nedenle, bu test değer bu modeli sistem ev sahibi enterobacteria kolonizasyon karşı anti-kolonizasyon uyuşturucu/tedavi etkinliği incelemek için kullanılıp kullanılamayacağını. Bu model sistem kullanarak, bu zamanlama ve EHEC değil sadece, aynı zamanda diğer enterobacteria kolonizasyon içinde vivokonumunu incelemek mümkün olduğuna inanıyoruz. Bu hayvan modeli kullanarak, farelerde EHEC kolonizasyon sürecinin izlenebilir ve kolonizasyon yükü ana EHEC kayma ve temporal kolonizasyon Canlı hayvanlarda belirlemek için sayılabilir. Görselleştirme ve miktar bu modeli kullanarak enterobacteria kolonizasyon araştırmak ve enterobacterial kolonizasyon iyi mekanizmalarını analiz ve böylece kolonizasyon araştırma eksikliği telafi etmek için harika bir araç yapar ve Geçerli bilgi geliştirmek.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarlar ifşa gerek yok.

Acknowledgments

Chi-Chung Chen üzerinden Bakanlığı tıbbi araştırma, Chi Mei Tıp Merkezi (Tainan, Tayvan) fare yardım için enfeksiyon ve ulusal Cheng Kung Üniversitesi laboratuvar hayvan merkezinden destek anıyoruz. Bu eser bilim Bakanı tarafından desteklenir ve Teknoloji (en) CC için (en 104-2321-B-006-019, 105-2321-B-006-011, and106-2321-B-006-005) verir.

Materials

Name Company Catalog Number Comments
Shaker incubator YIH DER LM-570R bacteria incubation 
Orbital shaking incubator FIRSTEK S300 bacteria incubation 
pBSL180 source of nptII gene
pAKlux2 source of luxCDABE operon
T&A Cloning Kit Yeastern Biotech FYC001-20P use for TA cloning 
Nsi I NEB R0127S use for plasmid cloning 
Sca I NEB R0122S use for plasmid cloning 
Spe I-HF NEB R0133S use for plasmid cloning 
Sma NEB R0141S use for plasmid cloning 
T4 ligase NEB M0202S use for plasmid cloning 
Ex Taq TaKaRa RR001A use for PCR amplification
10X Ex Taq Buffer TaKaRa RR001A use for PCR amplification
dNTP Mixture  TaKaRa RR001A use for PCR amplification
PCR machine applied Biosystem  2720 thermal cycler   for PCR amplification
Glycerol SIGMA G5516-1L use for bacteria stocking solution
NaCl Sigma 31434-5KG-R chemical for making LB medium, 10 g/L
Tryptone CONDA pronadisa Cat 1612.00 chemical for making LB medium, 10 g/L
Yeast Extract powder Affymetrix 23547-1 KG chemical for making LB medium, 5 g/L
Agar CONDA pronadisa Cat 1802.00 chemical for making LB agar
kanamycin  Sigma K4000-5G antibiotics, use for seleciton
streptomycin  Sigma S6501-100G antibiotics, eliminate the microbiota in mice
EDL933 competent cell Homemade method is on supplemental document 
Electroporator MicroPulser for electroporation
Electroporation Cuvettes Gene Pulser/MicroPulser 1652086 for electroporation
High-speed centrifuge Beckman Coulter Avanti, J-26S XP use for centrifuging bacteria 
Fixed-Angle Rotor Beckman Coulter JA25.5 use for centrifuging bacteria 
Fixed-Angle Rotor Beckman Coulter JLA10.5 use for centrifuging bacteria 
centrifuge bottles Beckman Coulter REF357003 use for centrifuging bacteria 
centrifuge bottles Thermo Fisher scientific 3141-0500 use for centrifuging bacteria 
eppendorf biophotometer plus  eppendorf AG 22331 hamburg for measuring the OD600 value of bacteria
C57BL/6 mice  Laboratory Animal Center of NCKU
lab coat, gloves for personnel protection 
isoflurane  Panion & BF Biotech Inc. G-8669 for mice anesthesia, pharmaceutical grade
1ml syringe  use for oral gavage of mice
Reusable 22 G ball-tipped feeding needle φ0.9 mm X L 50 mm use for oral gavage of mice
surgical  scissors  use for mice experiment
Xenogen IVIS 200 imaging system Perkin Elmer IVIS spectrum use for bioluminescent image capture 
Living Image Software Perkin Elmer version 4.1 use for quantifying the image data

DOWNLOAD MATERIALS LIST

References

  1. Pennington, H. Escherichia coli O157. Lancet. 376, (9750), 1428-1435 (2010).
  2. Mayer, C. L., Leibowitz, C. S., Kurosawa, S., Stearns-Kurosawa, D. J. Shiga toxins and the pathophysiology of hemolytic uremic syndrome in humans and animals. Toxins (Basel). 4, (11), 1261-1287 (2012).
  3. Tarr, P. I., Gordon, C. A., Chandler, W. L. Shiga-toxin-producing Escherichia coli and haemolytic uraemic syndrome. Lancet. 365, (9464), 1073-1086 (2005).
  4. Obrig, T. G. Escherichia coli Shiga Toxin Mechanisms of Action in Renal Disease. Toxins (Basel). 2, (12), 2769-2794 (2010).
  5. Nguyen, Y., Sperandio, V. Enterohemorrhagic E. coli (EHEC) pathogenesis. Front Cell Infect Microbiol. 2, 90 (2012).
  6. Wiles, S., Robertson, B. D., Frankel, G., Kerton, A. Bioluminescent monitoring of in vivo colonization and clearance dynamics by light-emitting bacteria. Methods Mol Biol. 574, 137-153 (2009).
  7. Hutchens, M., Luker, G. D. Applications of bioluminescence imaging to the study of infectious diseases. Cell Microbiol. 9, (10), 2315-2322 (2007).
  8. Rhee, K. J., et al. Determination of spatial and temporal colonization of enteropathogenic E. coli and enterohemorrhagic E. coli in mice using bioluminescent in vivo imaging. Gut Microbes. 2, (1), 34-41 (2011).
  9. Karsi, A., Lawrence, M. L. Broad host range fluorescence and bioluminescence expression vectors for Gram-negative bacteria. Plasmid. 57, (3), 286-295 (2007).
  10. Lane, M. C., Alteri, C. J. S., Smith, S. N., Mobley, L. H. Expression of flagella is coincident with uropathogenic Escherichia coli ascension to the upper urinary tract. Proc Natl Acad Sci U S A. 104, (42), 16669-16674 (2007).
  11. Roxas, J. L., et al. Enterohemorrhagic E. coli alters murine intestinal epithelial tight junction protein expression and barrier function in a Shiga toxin independent manner. Lab Invest. 90, (8), 1152-1168 (2010).
  12. Siragusa, G. R., Nawotka, K., Spilman, S. D., Contag, P. R., Contag, C. H. Real-Time Monitoring of Escherichia coli O157:H7 Adherence to Beef Carcass Surface Tissues with a Bioluminescent Reporter. (1999).
  13. Kuo, C. J., et al. Mutation of the Enterohemorrhagic Escherichia coli Core LPS Biosynthesis Enzyme RfaD Confers Hypersusceptibility to Host Intestinal Innate Immunity In vivo. Front Cell Infect Microbiol. 6, 82 (2016).
  14. Wiles, S., et al. Organ specificity, colonization and clearance dynamics in vivo following oral challenges with the murine pathogen Citrobacter rodentium. Cell Microbiol. 6, (10), 963-972 (2004).
  15. Wiles, S., Pickard, K. M., Peng, K., MacDonald, T. T., Frankel, G. In vivo bioluminescence imaging of the murine pathogen Citrobacter rodentium. Infect Immun. 74, (9), 5391-5396 (2006).
  16. Contag, C. H., Contag, P. R., Mullins, J. I., Spillman, S. D., Stevenson, D. K., Benaron, D. A. Photonic detection of bacterial pathogens in living hosts. Mol Microbiol. 18, (4), 593-603 (1995).
  17. Hardy, J., Francis, K. P., DeBoer, M., Chu, P., Gibbs, K., Contag, C. H. Extracellular replication of Listeria monocytogenes in the murine gall bladder. Science. 303, (5659), 851-853 (2004).
  18. Kaniga, K., Sory, M. P., Delor, I., Saegerman, C., Limet, J. N., Cornelis, G. R. Monitoring of Yersinia enterocolitica in Murine and Bovine Feces on the Basis of the Chromosomally Integrated luxAB Marker Gene. Appl Environ Microbiol. 58, (3), 1024-1026 (1992).
  19. Trcek, J., Fuchs, T. M., Trulzsch, K. Analysis of Yersinia enterocolitica invasin expression in vitro and in vivo using a novel luxCDABE reporter system. Microbiology. 156, (Pt 9), 2734-2745 (2010).
  20. Morin, C. E., Kaper, J. B. Use of stabilized luciferase-expressing plasmids to examine in vivo-induced promoters in the Vibrio cholerae vaccine strain CVD 103-HgR. FEMS Immunol Med Microbiol. 57, (1), 69-79 (2009).
  21. Law, R. J., Gur-Arie, L., Rosenshine, I., Finlay, B. B. In vitro and in vivo model systems for studying enteropathogenic Escherichia coli infections. Cold Spring Harb Perspect Med. 3, (3), a009977 (2013).
  22. Ritchie, J. M. Animal Models of Enterohemorrhagic Escherichia coli Infection. Microbiol Spectr. 2, (4), EHEC-0022-2013 (2014).
  23. Chou, T. C., et al. Enterohaemorrhagic Escherichia coli O157:H7 Shiga-like toxin 1 is required for full pathogenicity and activation of the p38 mitogen-activated protein kinase pathway in Caenorhabditis elegans. Cell Microbiol. 15, (1), 82-97 (2013).
  24. Alexeyev, M. F., Shokolenko, I. N. Mini-Tnl 0 transposon derivatives for insertion mutagenesis and gene delivery into the chromosome of Gram-negative bacteria. Gene. 160, (1), 59-62 (1995).
  25. Wiegand, I., Hilpert, K., Hancock, R. E. Agar and broth dilution methods to determine the minimal inhibitory concentration (MIC) of antimicrobial substances. Nat Protoc. 3, (2), 163-175 (2008).
  26. Pansare, V., Hejazi, S., Faenza, W., Prud'homme, R. K. Review of Long-Wavelength Optical and NIR Imaging Materials: Contrast Agents, Fluorophores and Multifunctional Nano Carriers. Chem Mater. 24, (5), 812-827 (2012).
  27. Heim, R., Cubitt, A. B., Tsien, R. Y. Improved green fluorescence. Nature. 373, (6516), 663-664 (1995).
  28. Weissleder, R. A clearer vision for in vivo imaging. Nat Biotechnol. 19, (4), 316-317 (2001).
  29. Frangioni, J. In vivo near-infrared fluorescence imaging. Current Opinion in Chemical Biology. 7, (5), 626-634 (2003).
  30. Collins, J. W., et al. Citrobacter rodentium: infection, inflammation and the microbiota. Nat Rev Microbiol. 12, (9), 612-623 (2014).
  31. Mallick, E. M., et al. A novel murine infection model for Shiga toxin-producing Escherichia coli. J Clin Invest. 122, (11), 4012-4024 (2012).
  32. Petty, N. K., et al. The Citrobacter rodentium genome sequence reveals convergent evolution with human pathogenic Escherichia coli. J Bacteriol. 192, (2), 525-538 (2010).
  33. Kovach, M. E., Elzer, P. H., Hill, D. S., Robertson , G. T., Farris, M. A., Roop, R. M. II, Peterson, K. M. Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene. 166, (1), 175-176 (1995).
  34. Galen, J. E., Nair, J., Wang , J. Y., Wasserman, S. S., Tanner, M. K., Sztein , M. B., Levine, M. M. Optimization of Plasmid Maintenance in the Attenuated Live Vector Vaccine Strain Salmonella typhiCVD 908-htrA. Infect Immun. 67, (12), 6424-6433 (1999).
  35. Francis, K. P., et al. Visualizing pneumococcal infections in the lungs of live mice using bioluminescent Streptococcus pneumoniae transformed with a novel gram-positive lux transposon. Infect Immun. 69, (5), 3350-3358 (2001).
  36. Goldwater, P. N., Bettelheim, K. A. Treatment of enterohemorrhagic Escherichia coli (EHEC) infection and hemolytic uremic syndrome (HUS). BMC Med. 10, (2012).
Non-invaziv <em>Vivo içinde</em> Bioluminescence sistemi tarafından fare konak Enterohemorrhagic <em>Escherichia Coli</em> kolonizasyon algılama
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Kuo, C. J., Wang, S. T., Chen, C. S. Detection of Enterohemorrhagic Escherichia Coli Colonization in Murine Host by Non-invasive In Vivo Bioluminescence System. J. Vis. Exp. (134), e56169, doi:10.3791/56169 (2018).More

Kuo, C. J., Wang, S. T., Chen, C. S. Detection of Enterohemorrhagic Escherichia Coli Colonization in Murine Host by Non-invasive In Vivo Bioluminescence System. J. Vis. Exp. (134), e56169, doi:10.3791/56169 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter