Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Een universeel Protocol voor grootschalige gRNA bibliotheek productie uit elke bron van DNA

doi: 10.3791/56264 Published: December 6, 2017

Summary

Methoden voor het opwekken van grootschalige gRNA bibliotheken moet eenvoudig, efficiënt en kosteneffectief zijn. Beschrijven we een protocol voor de productie van gRNA bibliotheken gebaseerd op enzymatische spijsvertering van DNA van het doel. Deze methode, CORALINA (uitgebreide gRNA bibliotheek generatie via gecontroleerde nuclease activiteit) presenteert een alternatief voor dure aangepaste oligonucleotide synthese.

Abstract

De populariteit van het systeem van de CRISPR/Cas9 voor zowel de genoom en de epigenome techniek komt voort uit haar eenvoud en aanpassingsvermogen. Een effector (de nuclease Cas9 of een fusieproteïne nuclease-dode dCas9) is gericht op een specifieke site in het genoom door een kleine synthetische RNA Absorbtion gids RNA, gRNA. De bipartiete aard van het CRISPR-systeem kan het gebruik ervan bij bevolkingsonderzoek benaderingen sinds plasmide bibliotheken met expressie cassettes van duizenden afzonderlijke gRNAs kunnen worden gebruikt om vele verschillende plaatsen in een enkele experiment ondervragen.

Tot op heden zijn gRNA sequenties voor de bouw van bibliotheken bijna uitsluitend gegenereerd door oligonucleotide synthese, die de grenzen van het haalbare complexiteit van sequenties in de bibliotheek en is relatief kostenintensieve. Hier zijn een gedetailleerd protocol voor CORALINA (uitgebreide gRNA bibliotheek generatie via gecontroleerde nuclease activiteit), een eenvoudige en kosteneffectieve methode voor het genereren van zeer complexe gRNA bibliotheken gebaseerd op enzymatische spijsvertering van DNA input, is beschreven. Aangezien CORALINA bibliotheken kunnen worden gegenereerd vanaf een willekeurige bron van DNA, bestaat overvloed van opties voor aanpassingen, waardoor een grote verscheidenheid aan CRISPR gebaseerde schermen.

Introduction

De aanpassing van het bacteriële CRISPR/Cas9-systeem als een moleculaire targeting instrument veroorzaakt de meest recente revolutie in moleculaire biologie. Nooit eerder is het zo gemakkelijk te manipuleren van de chromatine op gedefinieerde genomic locaties geweest. Gemeenschappelijke toepassingen van CRISPR omvatten gerichte gen mutaties1, genoom engineering2, epigenome3, transcriptionele activering en gene silencing4bewerken. Een bijzonder voordeel van het CRISPR-systeem is dat de toepassingen niet beperkt tot goed bestudeerde kandidaat-sites zijn, zoals gRNA bibliotheken een minder vooringenomen schermen mogelijk maken. Dit vergemakkelijkt de ontdekking van functionele loci in het genoom zonder enige voorkennis van de experimentele. Echter gRNA bibliotheek bouw is momenteel grotendeels gebaseerd op oligo-nucleotide synthese, en er zijn beperkte opties voor de aankoop van gRNA Bibliotheken, die niet van de mens of muis oorsprong of doel gebieden buiten open lezen van frames. Dus, hoewel CRISPR schermen hebben bewezen ongelooflijk krachtig5,6,7,8, hun volledige potentieel heeft nog niet is geëxploiteerd.

Om te overwinnen de beperking van de klassieke gRNA generatie methoden twee strategieën zijn onlangs ontwikkeld. Beide zijn gebaseerd op de gecontroleerde enzymatische spijsvertering van DNA van het doel in plaats van te vertrouwen op aangepaste oligonucleotide synthese. Terwijl CORALINA9 werkzaam micrococcal nuclease, de enige momenteel beschikbare alternatieve methode, CRISPR-eten10, maakt gebruik van beperkingsenzymen (HpaII, ScrFI, Bfaik en Mmeik). Nog belangrijker is, kunnen beide technieken worden toegepast op elke input DNA, die als de bron van de opeenvolgingen van de protospacer van de gRNA fungeert. Terwijl de CRISPR-EATING methode maakt gebruik van een strategie om het aantal gekloonde gRNAs waarvan de targeting sites niet worden gevolgd door de vereiste S.pyogenes-PAM (protospacer aangrenzende motief) te verlagen, het slechts een klein deel van alle mogelijke functionele gRNAs voor genereert een bepaald gebied. CORALINA, aan de andere kant, kan voor het genereren van alle potentiële gRNAs voor de reeks van de bron, maar bevat ook een hogere Fractie van niet-functionele gidsen. gRNA bibliotheek generatie via gecontroleerde nuclease activiteit mogelijk maakt de productie van uitgebreide gRNA bibliotheken voor elke soort, elk Cas9-eiwit of -effector systeem op een eenvoudige en kosteneffectieve manier. CORALINA is bovendien aangepast aan aanpassen, zoals de juiste keuzes voor invoer- en vector definiëren de soort bibliotheek, de grootte en de inhoud. Hier, een gedetailleerd protocol wordt gepresenteerd dat kan worden gebruikt voor de generatie van uitgebreide gRNA bibliotheken uit verschillende bronnen van DNA (Figuur 1), met inbegrip van bacteriële kunstmatige chromosomen (BACs) of genomic DNA9. De representatieve resultaten bij dit protocol zijn afgeleid door de toepassing van het protocol van CORALINA tot DNA dat BAC.

Protocol

1. de spijsvertering van DNA met Micrococcal Nuclease

  1. Het uitvoeren van een optimalisatie-reactie voor elke nieuwe partij micrococcal nuclease enzym (MNase).
    Opmerking: Het aantal eenheden van MNase gebruikt moet worden getest (met behulp van een seriële verdunning, figuur 2A). Meestal 5-10 U van MNase verteren 1 µg gezuiverd genomic of BAC DNA tot een bereik van 5-100 bp met de voorwaarden die hieronder worden beschreven.
  2. Per reactie, opgericht 1 µL van 10 x MNase Buffer, 1 x bovien serumalbumine (BSA), 1 microgram van doelDNA, 1 µL van MNase (0.1-50 eenheden) in een 10 µL reactie volume.
  3. Incubeer bij 37 ° C gedurende 15 minuten.
  4. Onmiddellijk de inactivering van het enzym door toevoeging van 1 µL van 500 mM ethyleen glycol-bis(β-aminoethyl ether)-N, N, N', N'-Dinatriumethyleendiaminetetra-azijnzuuroplossing (EGTA).

2. scheiding van DNA fragmenten met behulp van Polyacrylamide gelelektroforese (pagina)

  1. Voeg monster buffer/gel laden kleurstof aan DNA-monsters en laden op een 20% pagina gel. Laden van een geschikte DNA-ladder voor de dimensionering (5 bp DNA-Ladder). Niet te veel de gel (1 µg DNA per putje).
  2. Gels in passende 1 x TRIS-boraat-EDTA (FSME) lopende buffer bij 150 V (constante) uitgevoerd voor rond 1,5 h of tot de lagere kleurstof voorkant (bromophenol blauw, donker blauwe kleur) die worden uitgewisseld op ongeveer 15 bp, bereikt het onderste uiteinde van de gel.
  3. De gel met een uiterst gevoelige nucleïnezuur vlek vlek en visualiseer onder UV-licht.
  4. Bepaal de optimale concentratie van MNase voor verteren DNA tot 20-30 bp in grootte van het beeld van de gel.
  5. Gebruik de geoptimaliseerde concentratie van MNase om te verteren doelDNA herhaalt u stappen 1.2-2.2. Meestal, verteerd opzetten van 10-12 Reacties (d.w.z. 10-12 µg voor totaal grondstof) genoeg levert DNA na pagina gel extractie om naar de volgende stappen te gaan.
  6. Met een steriel scalpel, snijd de gel naast de marker lane en alleen het gedeelte van de gel met de ladder met vers 1 x TBE lopende buffer met 1 X van een ultra gevoelige nucleïnezuur vlek vlek. Visualiseren van de DNA-ladder en accijnzen MNase-verteerd DNA-fragmenten in de groottewaaier tussen ongeveer 18-30 bp met behulp van een scheermesje.
    Opmerking: Vermijd blootstelling van de MNase verteerd fragmenten aan UV-licht. Het is mogelijk te gebruiken van een blauwe lichtbron (in plaats van UV) of neem een foto van de ladder onder UV-licht, afdrukken te schalen en gebruik dit als leidraad excisie van MNase-verteerd DNA-fragmenten). Deze stap vermijdt kleuring en blootstelling van DNA-fragmenten aan UV-licht. Gebruik altijd een ongebruikte, steriele wegwerp scalpel of scheermesje voor deze stap om verontreiniging te voorkomen.
  7. Het gel-segment overbrengen in een microcentrifuge buis.
  8. Vlekken van de rest van de gel met nucleïnezuur vlek als boven, blootstellen aan UV-licht en het opnemen van een afbeelding om een register bijhouden van de gel excisie stap.

3. isolatie van DNA-fragmenten van pagina-gelen Crush en Soak methode gebruiken

Opmerking: Deze stap is overgenomen van Sambrook et al. 11

  1. Bereiden pagina gel solubilisatie buffer (1,88 mL 4 M ammoniumacetaat, 150 µL van 1 M magnesium acetaat en 30 µL 0.5 M ethyleendiamminetetra azijnzuuroplossing (NA2EDTA) (pH 8) in ultrazuiver H2O tot een totaal volume van 15 mL).
  2. Plet het segment van de verwijderde gel tegen de muur van de micro-centrifuge buis met behulp van een steriele pipette uiteinde.
  3. Voeg 2 solubilisatie paginabuffer hoeveelheid gel en Incubeer bij 37 ° C gedurende 16 uur op een draaiend platform.
  4. Centrifugeer de monsters voor 1 min op maximale snelheid in een microcentrifuge. Het supernatant overbrengen in een nieuwe microcentrifuge-buis, zorg om niet over te brengen van alle stukken gebroken gel.
  5. Voeg toe 0,5 volumes van de buffer van de solubilisatie van de pagina aan de gel pellet, vortex, en herhaal het centrifugeren (stap 3.4). Combineer het supernatant.
  6. Pak de DNA-fragmenten met behulp van standaard fenol-chloroform extractie.
    Let op: Fenol is giftig als het komt in contact met de huid of inslikken. Voorzorgsmaatregelen betreffende veiligheid zoals handschoenen, beschermende brillen, een laboratoriumjas, en het werken in een zuurkast staan kritisch tegenover. Verwijdering van alle fenol-bevattende afval volgens de reglementen van het Instituut.
    1. Voeg één volume van fenol: chloroform: Isoamylalcohol (25:24:1) aan het monster en de vortex grondig.
    2. Centrifugeer gedurende 10 minuten op maximale snelheid (16.000 x g) in een tafelblad centrifuge bij kamertemperatuur. Zorgvuldig overbrengen in de bovenste waterfase een verse microcentrifuge buis. Wees voorzichtig niet te voeren over fenol tijdens pipetteren.
    3. Herhaal stap 3.6.1 en 3.6.2 eens.
    4. Voeg een kleine hoeveelheid (0.2 µL) glycogeen, 0.1 volumes van 3 M Natriumacetaat (pH 5.2) en 2 volumes van 100% ethanol (EtOH).
    5. Vortex en Incubeer bij-20 ° C gedurende enkele uren of 's nachts.
    6. Centrifugeer gedurende 30 minuten op maximale snelheid bij 4 ° C met behulp van een tafelblad centrifuge.
    7. Verwijder voorzichtig het supernatant en het wassen van de DNA-pellet met 70% EtOH.
    8. Centrifugeer gedurende 30 minuten op maximale snelheid bij 4 ° C met behulp van een tafelblad centrifuge.
    9. Verwijder het supernatant en drogen van de DNA-pellet. Zorg ervoor dat alle de EtOH is verdampt, maar wees voorzichtig niet te overdreven drogen de pellet.
    10. Ontbinden van DNA pellet in 12 µL van H2O.
      Opmerking: Pagina gel extractie is zeer inefficiënt. Voor elke 10 µg DNA verteerd met MNase beginnen, verwachten om te herstellen van de ng 1-20 van gezuiverde fragmenten na extractie van de gel. Bedrag en de integriteit van fragmenten besturen door het laden van 1/6th (2 µL) op een pagina gel (figuur 2C).

4. einde reparatie van MNase-verteerd, Gel-gezuiverd fragmenten

  1. De volgende reactie gebruikend een DNA afstomping kit instellen: 10 µL van gezuiverde DNA uit stap 3.6.10, 1.5 µL van 10 X afstomping buffer 1.5 µL van 1 mM dNTP mix, 0.6 µL van stompen enzym, 1.4 µL van H2O.
  2. Incubeer bij 22 ° C gedurende 30 minuten en vervolgens hitte-inactivering van het enzym door incubatie bij 70 ° C gedurende 10 minuten.
  3. Voeg 85 µL van H2O en uitvoeren van een reactie-opschonen met behulp van standaard fenol/chloroform-extractie en EtOH-neerslag (zoals beschreven in punt 3.6). Ga direct naar linker afbinding.

5. de linker generatie

Opmerking: Linkers moeten worden versterkt, parallel met sectie 3 te kunnen onmiddellijk over te gaan met linker afbinding. Primer sequenties gebruikt onder moet geschikt zijn voor de gekozen gRNA expressie vector. Die hier worden beschreven zijn ontworpen voor de vector pgRNA-pLKO.1. 9 voor versterking van de linker 5' van pgRNA-pLKO.1, gebruik de primer sequenties 5'-linker-F (TTGGAATCACACGACCTGGA) en 5'-linker-R (CGGTGTTTCGTCCTTTCCAC), een 689 bp amplicon oplevert. Voor versterking van de linker 3' van pgRNA-pLKO.1, gebruik de inleidingen 3'-linker-F: (GTTTTAGAGCTAGAAATAGCAAGTTAAAATA) en de 3'-linker-R: (ACTCGGTCATGGTAAGCTCC), die een 848 bp amplicon opleveren.

  1. PCR-versterken de adapter sequenties van de gRNA expressie vector (met behulp van reagentia van keuze en aangepaste primer sequenties, indien nodig). Voor pgRNA-pLKO.1 instellen op de volgende 50 µL PCR reactie: 25 µL van het PCR master mix, 2.5 µL primer F (10 µM), 2,5 µL primer R (10 µM), 0.1 ng van gRNA expressie vector (pgRNA-pLKO.1) in H2O.
  2. Incubeer reacties op een thermocycler met behulp van de volgende voorwaarden: 1 cyclus 98 ° C gedurende 30 s, 32 cycli 98 ° C voor 10 s, 59 ° C gedurende 10 s, 72 ° C gedurende 30 s, 1 cyclus 72 ° C gedurende 10 minuten.
  3. Zuiveren van PCR reacties met behulp van de vaste fase omkeerbare immobilisatie kralen volgens de instructies van de fabrikant. Elueer in 30 µL van H2O.
  4. Om af te dwingen directionele Afbinding van de linker naar de einde-gerepareerd, MNase-verteerd DNA-fragmenten, digest linkers met geschikte restrictie-enzymen (hier HindIII en SacII). Instellen van de volgende reacties:
    1. Gebruik voor de vertering van 5' linker met HindIII, 30 µL van gezuiverde 5' linker amplicon uit stap 5.3., 5 µL van Buffer, 3 µL van HindIII (20U/µL) en 12 µL van H2O.
    2. Gebruik voor de vertering van 3' linker met SacII, 30 µL van gezuiverde 3' linker amplicon uit stap 5.3., 5 µL van Buffer, 3 µL van SacII (20 U/µL), en 12 µL van H2O.
  5. Incubeer bij 37 ° C gedurende 3 uur geklaard.
  6. Toevoegen van DNA-gel laden kleurstof en uitvoeren van het beperkingsenzym verteert op een 1% agarose gel. Accijnzen van de bands op 637 bp (linker digest 5') en 295 bp (linker digest 3').
  7. Het zuiveren van het DNA van de stukken van de verwijderde gel met behulp van een gel extractie kit.

6. de linker afbinding en versterking van Inserts

  1. Instellen van een 14 µL afbinding reactie mengsel hoeveelheden van MNase-verteerd, einde herstelde fragmenten en linker sequenties gebruikt.
    Opmerking: Linker fragment verhouding kan worden geoptimaliseerd. Het is aanbevolen om een neen-fragment controle (NFC) reactie omvatten.
    1. Gebruik 5 ng van MNase-verteerd fragmenten (einde-gerepareerd en gezuiverd), 120 ng voor 5' linker (HindIII digest, gezuiverd), 55 ng 3' linker (SacII digest, gezuiverd), 1.4 µL van T4 ligase Buffer en 1.4 µL van geconcentreerde T4 DNA ligase in H2O.
  2. Incubeer de afbinding reacties bij 16 ° C voor 16 h. Doen niet warmte-inactivering van het enzym. Onmiddellijk gaan nick-vertaling.
    Opmerking: De einde-gerepareerd MNase-verteerd fragmenten bieden de fosfaten 5' noodzakelijk voor afbinding van linkers, als de linker zelf zijn VN-gefosforyleerd.
  3. Aan de afbinding reactie (en de reactie van NFC) Voeg het volgende toe: 25 µL van Taq 2 X master mix (capable van nick vertaling), 2,5 µL primer Linker-Minus450-F (10 µM, GGGCAAGTTTGTGGAATTGG), 2,5 µL primer Linker-Plus275-R (10 µM, AAGTGGATCTCTGCTGTCCC) en 6 µL van H2O.
  4. Een besturingselement voor het neen-template (NTC) bevatten. Incubeer reacties op een thermocycler met behulp van de volgende voorwaarden: 1 cyclus (nick vertaling): 72 ° C gedurende 20 minuten, 1 cyclus: 95 ° C gedurende 5 minuten, 3-4 cycli: 95 ° C gedurende 15 s, 58 ° C gedurende 15 s, 72 ° C gedurende 30 s, 1 cyclus: 72 ° C gedurende 5 minuten.
  5. Voer een reactie-opschonen vaste fase omkeerbare immobilisatie kralen met een monster te kraal verhouding van 1:1. Elueer in 40 µL van H2O.
  6. Verder versterken van het gewenste fragment (5' linker + MNase + 3 fragment' linker) met behulp van passende PCR Reagentia en de volgende inleidingen:
    1. Gebruik van 12,5 µL van het PCR master mix, 1,25 µL primer Linker-Minus450-F (10 µM, GGGCAAGTTTGTGGAATTGG), 1,25 µL primer Linker-Plus275-R (10 µM, AAGTGGATCTCTGCTGTCCC), 2,5 µL van gezuiverde nick vertaling product uit stap 6.4. en 7,5 µL van H2O. gebruiken de volgende voorwaarden: 1 cyclus: 98 ° C gedurende 30 s, 10-16 cycli: 98 ° C gedurende 10 s, 63 ° C gedurende 10 s, 72 ° C gedurende 15 s, 1 cyclus: 72 ° C gedurende 10 minuten.
      Opmerking: Indien nodig, meerdere reacties kunnen worden instellen in parallel om ervoor te zorgen dat er genoeg PCR product voor opeenvolgende stappen. Om te visualiseren van kleine hoeveelheden van het PCR-product op een agarose gel, instellen van extra reacties zoals in stap 6.5 en verhoog de waarde van de cyclus van 15 tot en met 32. Deze reactie kan worden gebruikt als kwaliteitscontrole, als waarbij na 15 cycli niet zichtbaar zijn. Zijn ook een geen sjabloon controle (NTC).

7. maat keuze

Opmerking: Deze stap scheidt MNase-fragmenten met het correct aangesloten 5' en 3' linker fragmenten met twee 5' of twee 3' linkers op basis van grootte.

  1. Combineren van alle 15-cyclus PCR reacties uit stap 6.5. DNA laden kleurstof toevoegen en op een 0,8% agarose gel in werking. De prominente band op 869 accijnzen bp en te zuiveren van DNA met behulp van een gel extractie kit.
  2. De hoeveelheid DNA (bijvoorbeeld gebruik van een spectrofotometer) te kwantificeren.

8. klonen van PCR-versterkte fragmenten in de gRNA expressie Vector door Gibson vergadering

  1. Voorbereiding van de vergadering meester mix als volgt:
    Opmerking: De volgende stappen zijn aangepast van Gibson et al. 12.
    1. 6 mL isothermische reactie buffer te maken door het combineren van 3 mL 1 M Tris (hydroxymethyl) aminomethane (Tris)-HCl pH 7.5, 300 µL van 1 M MgCl 60 µL van 100 mM deoxyguanosine trifosfaat (dGTP), 60 µL van 100 mM deoxyadenosine trifosfaat (dATP), 60 µL van 100 mM deoxythymidine adenosinetrifosfaat (dTTP), 60 µL van 100 mM deoxycytidine trifosfaat (dCTP), 300 µL van 1 M dithiothreitol (DTT), 1.5 g van polyethyleenglycol (PEG)-8000, 300 µL van 100 mM nicotinamide adenine dinucleotide (NAD) in ultrazuiver H2O.
      Opmerking: Deze buffer kan worden aliquoted en opgeslagen bij-20 ° C.
    2. 1.2 mL vergadering master mix maken door het combineren van 320 µL van 5 X isothermische reactie buffer, 3 µL van 10 U/µL T5 exonuclease, 20 µL van 2 U/µL van DNA Taq, 160 µL van 40 U/µL DNA ligase in ultrazuiver H2O. gebruik 15 µL van vergadering master mix met 5 µL van invoegen.
      Opmerking: De vergadering master mix kan worden aliquoted en opgeslagen bij-20 ° C, waar het is stabiel voor meer dan een jaar en meerdere bevriezen-ontdooien cycli kan tolereren. Het gekozen bedrag van T5 exonuclease is ideaal voor gebruik met lange overhangen.
  2. Vector ruggengraat spijsvertering
    Opmerking: Zorg ervoor dat een voldoende hoeveelheid van de vector als input voor het gewenste aantal vergadering reacties in stap 8.3 verteren.
    1. Per reactie, voeg het volgende toe: 1,5 µg gRNA expressie vector (pgRNA-pLKO.1), 5 µL van buffer, 1.5 µL van leeftijdik (5U/µL) en 38.5 µL van H2O. Incubate verteren bij 37 ° C gedurende 2 uur.
  3. Defosforylerings van de gelineariseerde vector.
    Opmerking: Deze stap is geadviseerd, maar niet strikt noodzakelijk. T5 exonuclease in de master mix wordt meestal verwijderd de leeftijdik overhangt voordat de polymerase van DNA-ligase heeft een kans om op te treden. Buitensporige opnieuw Afbinding van de vector is daarom niet te verwachten.
    1. Voeg 2.5 µL van garnalen alkalische fosfatase-enzym (rSAP, 1 U/µL).
    2. Incubeer bij 37 ° C gedurende 30 minuten, en vervolgens de inactivering van het enzym door broeden bij 65 ° C gedurende 5 min.
  4. Uitvoeren van DNA zuivering
    Opmerking: Het wordt aanbevolen een agarose gel extractie stap moet uitvoeren. Kolom- of kraal zuivering kan als alternatief worden gebruikt. Het is belangrijk om te controleren dat de vector vertering voltooid, bijvoorbeeld door agarose gelelektroforese is. Ter vergelijking, moet onverteerd vector parallel worden uitgevoerd.
  5. Kwantificeren van het bedrag van de gezuiverde verteerd vector in de steekproef.
  6. De vergadering met 2-fold molaire overmaat van tussenvoegsels instellen op vector. Per 20 µL reactie gebruik 100 ng van vector (leeftijdik uit stap 8.5 verteren), 12.2 ng van invoegen (uit stap 7.1.), 15 µL van vergadering master mix uit stap 8.1.2. in H2O.
  7. Incubeer bij 50 ° C gedurende 1 uur.
  8. Zuiveren van de reacties met behulp van kolom zuivering. Resuspendeer de DNA in 75 µL van H2O (of volume afhankelijk van omvang van electroporation nodig).
    Opmerking: De efficiëntie van de transformatie is sterk afhankelijk van de zuiverheid van het DNA. Extra zuivering stappen (bijv . fenol/chloroform extractie) kunnen de efficiëntie verbeteren.

9. voorbereiding van Electro-bevoegde TG1 E. coli cellen

  1. Ervoor zorgen dat alle Centrifugeer flessen en flacons vrij van detergentia door spoelen en latere vullen met gedestilleerd water voordat autoclaaf zijn.
    Opmerking: Deze stap helpt te verwijderen alle onzuiverheden die invloed kunnen hebben op de efficiëntie van de transformatie. Water moet direct vóór gebruik worden weggegooid. Als alternatief misschien gebruik van wegwerp centrifugeren flessen wel aan te raden.
  2. Zorg ervoor dat de centrifuge flessen, buizen en oplossingen gebruikt voor de bereiding van electrocompetent cellen zijn gekoeld op ijs vóór gebruik. Het is het beste om te voeren de volgende stappen uit in een koude kamer om te minimaliseren van temperatuurschommelingen die invloed kunnen hebben op de efficiëntie van de transformatie.
  3. 2TY medium voor te bereiden. Met 16 g bacto trypton toevoegen 10 g gistextract en 5 g NaCl, aan 1 L, mix en autoclaaf gedestilleerd water. Opslag medium bij kamertemperatuur.
  4. 2TY-agar gecoat bioassay gerechten en 10 cm petrischalen met het juiste antibioticum voorbereiden. Winkel platen bij 4 ° C.
    Opmerking: De keuze van het antibioticum is afhankelijk van de aard van de gRNA expressie vector, gebruik 100 µg/mL ampicilline voor pgRNA-pLKO.1.
  5. Schraap uit een voorraad van glycerol TG1 cellen om te enten 10 mL 2TY medium (zonder antibiotica).
  6. Incubeer cultuur bij 37 ° C's nachts (~ 16 h) met schudden bij 225 t/min.
  7. 1 L 2TY medium (zonder antibiotica) met de nachtelijke cultuur (in de verdunning 1/100) 10 mL beënten en verdeel het even tussen twee 2 L kolven (met baffles).
  8. Incubeer bij 37 ° C, 225 rpm tot een OD600 nm 0,55 is bereikt (ongeveer na 1,5-2 h) cultuur. Het gebruik van een spectrofotometer OD600 nm om regelmatig te controleren.
  9. Chill culturen op het ijs gedurende 30 minuten.
  10. Splitsen de cultuur even tussen vier 500 mL centrifuge flessen (vooraf gekoeld op ijs).
  11. Centrifugeer gedurende 15 minuten bij 4000 x g bij 4 ° C in een vooraf gekoeld centrifuge.
  12. Decanteren supernatant en 1 deel (d.w.z. 250 mL) vooraf gekoeld ijskoude steriel gedistilleerd H2O toevoegen aan elk van de centrifuge flessen. Resuspendeer de pellet van bacteriële door zwenken of omkeren van de fles (of door het zachte pipetteren, indien nodig).
    Opmerking: Het is gemakkelijker om resuspendeer de pellet door eerst een kleine hoeveelheid water toe te voegen. De pellet is volledig geresuspendeerde uiteindelijk zorgen.
  13. Centrifugeer gedurende 15 minuten bij 4000 x g bij 4 ° C.
  14. Herhaal de wash twee keer (stappen 9.12. en 9.13). Verwijder het supernatant. Wees voorzichtig met het decanteren naarmate de bacteriële pellet steeds los na het wassen.
  15. Resuspendeer de pellet in 50 mL steriele, ijskoude 10% glycerol en overbrengen naar een centrifugebuis pre gekoeld 50 mL.
  16. Centrifuge cellen gedurende 15 minuten staan bij ~ 4000 x g bij 4 ° C. Verwijder voorzichtig het supernatant.
  17. Zachtjes resuspendeer de bacteriën in 2 mL ijskoud steriele 10% glycerol.
  18. Houd op ijs als de cellen moeten onmiddellijk worden gebruikt voor electroporation.
    Opmerking: De cellen kunnen worden bevroren in porties van 50 µL in 0,5 mL buizen in een bad van droogijs ethanol en opgeslagen bij-80 ° C, maar dit wordt niet aanbevolen.

10. Electroporation TG1 Electrocompetent E. coli cellen

Opmerking: Electroporation is een van de knelpunten in de generatie van de uitgebreide bibliotheek. Voor het behoud van de vertegenwoordiging van de bibliotheek, is het raadzaam te voeren zoveel individuele electroporation reacties zo nodig/mogelijk is en de kwaliteitscontrole stappen hieronder beschreven (10.6. en 10.8.).

  1. Aliquot de gezuiverde Reacties (uit stap 8.8) in vooraf gekoeld en steriele PCR buizen en houd ze op het ijs (1 µL per buis). Chill 1 mm gat electroporation cuvettes op ijs.
  2. 25 µL van vers bereide TG1 cellen rechtstreeks toevoegen aan een aliquoot gedeelte van het DNA en onmiddellijk overdracht het mengsel in een cuvet electroporation. Flick of tik op de meetcel zodat de cellen/DNA mix wordt verspreid langs de lengte van de kamer van de Cuvet (zonder ingesloten lucht of bellen).
  3. Plaats de cuvette in de zaal van de dia en start het juiste electroporation programma (bv. 1 impuls voor 1.8 kV (EG1)).
    Opmerking: De tijdconstante moet liggen tussen 5.7 en 6.0 ms. Ingeval de electroporator bogen, flick de cuvette, te verzekeren dat er geen luchtbellen in de zaal en probeer het opnieuw.
  4. Onmiddellijk 975 µL van kamertemperatuur 2TY medium aan de cuvette toevoegen.
  5. Met behulp van een pipet overdracht, verplaats de electroporated bacteriën naar een tube van 50 mL. Herhaal vanaf stap 10.2. en het verzamelen van alle cellen getransformeerd met een bibliotheek in een tube van 50 mL.
  6. Het document van het totale volume.
  7. Kwaliteitscontrole stap
    1. Uitvoeren om te kwantificeren van de bevoegdheid van de vers gegenereerde electro-bevoegde cellen, een aparte electroporation reactie met behulp van een bepaalde hoeveelheid Onbesneden plasmide DNA (bijvoorbeeld 10 pg pUC19 controle plasmide). Dit overbrengen in een 1,5 mL microfuge buis.
      Opmerking: De bevoegdheid moet ten minste 1010 kolonie-vormende eenheden (kve per µg DNA). Vers bereide cellen presteren meestal beter dan dit.
  8. Incubeer getransformeerde bacteriën bij 37 ° C gedurende 60 minuten schudden bij 225 t/min.
  9. Kwaliteitscontrole stap:
    1. Plaat een gedefinieerde kleine hoeveelheid bacteriën omgezet met de bibliotheek (bijvoorbeeld 10 µL van een 10-100 vouw verdunning) op een 10 cm agarplaat met de juiste antibiotica keuze.
      Opmerking: Weten het totale cultuur volume (uit stap 10.6.), kan het aantal verkregen kolonie te schatten van het totale aantal kolonies voor de gehele bibliotheek worden gebruikt. 20-30 vouw vertegenwoordiging van de bibliotheek moet idealiter worden gehandhaafd.
  10. De rest van de bacteriën op 2TY agar gecoat bioassay gerechten met de juiste antibiotica selectie verspreiden.
    Opmerking: Het volume van de cultuur kan worden verminderd door middel van centrifugeren op ~ 4000 x g gedurende 10 minuten (of totdat een zichtbaar pellet heeft gevormd en het supernatant wordt duidelijk weergegeven). Dit vermindert de tijd platen droog moeten na verspreiding van de cultuur. Gebruik van platen in plaats van vloeibare cultuur minimaliseert buitensporige groei van afzonderlijke kolonies. 13
  11. Het verspreiden van een passende omvang van de pUC19 controle electroporation reactie op een extra 10 cm agar schotel met de juiste antibiotica keuze.
  12. Incubeer agar platen 's nachts (16 h) bij 37 ° C.
  13. Tellen verkregen kolonies op de platen van de controle (pUC19 en controle bibliotheek plaat) te schatten CFU/µg DNA voor de bacteriën en de complexiteit van de bibliotheek.

11. extractie van DNA plasmide

  1. Voeg 10 mL van 2-TY media aan de nachtelijke platen, schraap de bacteriële laag uit de plaat met behulp van een wegwerp strooier en verzamelen in een tube van 50 mL. Herhaal een paar keer totdat alle van de plaat wordt weergegeven schoon.
  2. Uittreksel DNA met behulp van een plasmide Maxi kit (2-3 kolommen nodig per biotoetsen plaat).

Representative Results

Met behulp van het protocol bij de hand, zijn CORALINA gRNA bibliotheken gegenereerd van mens en muis genomic DNA9 en BAC DNA (Figuur 1). Voor de productie van fragmenten van input DNA geschikt voor klonen in gRNA expressievectoren, moeten optimale omstandigheden voor gecontroleerde nuclease spijsvertering worden bepaald. Een typisch resultaat voor de optimalisatie van de micrococcal nuclease spijsvertering is afgebeeld in figuur 2A. Onvoldoende hoeveelheid nuclease (0,1, 2, 3, 4, 4,5 of 5 eenheden) produceert geen merkbare producten in het assortiment van de vereiste grootte (10-100 bp) en 5,5-7,5 eenheden nog steeds geproduceerd fragmenten die gemiddeld te lang zijn. Grotere hoeveelheden enzym (50 eenheden) leiden tot excessieve afbraak van input DNA na 10 min. Bijgevolg werd een tussenliggende bedrag (10 eenheden) gekozen. De digest werd opgeschaald te produceren genoeg verteerd fragmenten voor verdere reiniging en klonen (figuur 2B). Terwijl het is aanbevolen om blindelings DNA-fragmenten selecteren door grootte en alleen vertrouwen op de DNA-ladder voor oriëntatie te minimaliseren Gasbedwelming met behulp van DNA-fragmenten UV-licht, kunnen de gels daarna voor kwaliteitscontrole van de spijsvertering en snijden worden gekleurd. Figuur 2B toont een representatief voorbeeld van een pagina-gel uit waarin DNA fragmenten tussen 20 en 30 bp hebben is weggesneden. Gel gezuiverd MNase fragmenten werden geladen op een 20% pagina gel om succesvolle maat keuze en zuivering van MNase-verteerd fragmenten (figuur 2C) te controleren. Het protocol bij de hand is compatibel met het gebruik van aangepaste linker sequenties, toe te staan om een kloon van de MNase-verteerd fragmenten in gRNA expressievectoren van keuze. GRNA-PLKO-9 werd hier gebruikt als ruggengraat. De linkers worden versterkt uit de gRNA expressie vector gebruikt Standaardpcr. Figuur 2D beeldt een representatief voorbeeld van versterkte linker sequenties verstoken van extra, onjuiste of geen sjabloon waarbij. Vervolgens zijn linker waarbij verteerd met enzymen van de beperking om linkers op de MNase-verteerd fragmenten in de juiste richting als ligatuur zijn verbonden. Figuur 2D toont agarose gel van 5' en 3' linkers vóór en na de spijsvertering met HindIII en SacII respectievelijk, met vermelding van volledige spijsvertering van de linkers de voorspelde 637 en 295 bp. Het rechter gedeelte van de afbeelding van de gel documenteert de excisie van de verteerd linker fragmenten. Volgende gel extractie van verteerd linkers, de volgende stap in het protocol is de afbinding van linkers op de einde-gerepareerd MNase-verteerd fragmenten. Omdat het linker sequenties worden gegenereerd door PCR gebruikend unphosphorylated inleidingen, moet zelf Afbinding van linkers niet plaatsvinden. Alleen het einde herstelde MNase-verteerd DNA-fragmenten de fosfaat groepen nodig zijn voor de afbinding leveren. Na nick de vertaling, het product van de Afbinding wordt versterkt door PCR. Ter vermijding van buitensporige PCR versterking vooroordeel dat de vertegenwoordiging van de opeenvolgingen van het gRNA in de bibliotheek kan scheeftrekken, is versterking beperkt tot minder dan 20 cycli in totaal. Na PCR zijn de versterking producten moeilijk te visualiseren op agarose gel. Afzonderlijke schakelaar PCRs met 32 cycli worden daarom uitgevoerd om de producten te detecteren (maar niet worden gebruikt voor de voorbereiding van de bibliotheek). Resultaten van deze controle PCR worden weergegeven in figuur 2E. Hierdoor te optimaliseren de afbinding reacties en reacties zijn verstoken van PCR artefacten, die soms in "geen fragmenten controls voorkomen" (NFC). 2E figuur ziet u de gewenste amplicon (5' linker + fragment van DNA van 3' linker, lengte: 869 bp) volgende versterking van afbinding reacties met mengsel (1:1) verhoudingen tussen fragmenten en linker sequenties.

Figure 1
Figuur 1 : Voorgesteld tijdlijn voor het voorbereiden van een bibliotheek gRNA. CORALINA biedt een eenvoudige en kosten-efficiënte strategie voor de generatie van uitgebreide gRNA bibliotheken van een overvloed aan verschillende DNA-bronnen van elk organisme. Het protocol bij de hand kan worden gebracht tot voltooiing tijdens een werkweek. Linker generatie kan worden uitgevoerd in parallel met DNA einde-reparatie. Voorbereiding van electrocompetent bacteriën duurt twee dagen en omvat een overnachting groei stap en moet daarom worden gestart voordat de vergadering reacties zijn ingesteld. Klik hier voor een grotere versie van dit cijfer.

Figure 2
Figuur 2 : Kritische stappen tijdens het protocol. (A) gecontroleerde spijsvertering van DNA van BAC kunt generatie van fragmenten van verschillende grootte. Hier afgebeeld is de optimalisatie van de MNase spijsvertering. Gezuiverde BAC DNA werd behandeld met verschillende hoeveelheden MNase voor 10 min. 10 U van MNase DNA-fragmenten van de gewenste lengte (20-30 bp) genereren. (B) het formaat van de selectie van fragmenten tussen 20 en 30 bp met behulp van excisie van polyacrylamide gels. Gezuiverde BAC DNA werd behandeld met 10 U van MNase gedurende 10 minuten. Het beeld werd opgenomen na excisie. (C) de controle van de kwaliteit van de gel-gezuiverd fragmenten. Na gel-zuivering, 1/6e van het gezuiverde MNase fragmenten pagina gel om succesvolle maat keuze en zuivering te controleren op een 20% werd geladen. (D) versterking van linker sequenties voor vergadering en restrictie-enzym vertering van linkers om directionele klonen. 5' en 3' linkers werden versterkt en snijd met HindIII en SacII, respectievelijk. No-template besturingselementen (NTC) werden opgenomen naar besturingselement voor PCR artefacten en verontreiniging van het DNA. Links: analytische voorbeeldtoepassing; rechts: preparatieve voorbeeldtoepassing. Beeld werd opgenomen na excisie van de gel. (E) succesvol Afbinding van linkers om DNA-fragmenten kan worden geanalyseerd met behulp van PCR met een toenemend aantal cycli van PCR (32) en gecontroleerd door controles, geen sjabloon met H2O (NTC) of met behulp van de NTC uit de voorgaande nick vertaling stap als input (NTC NT)). Het is belangrijk om op te nemen van een fragment oncontroleerbaar (NFC), wat een versterking van een afbinding en nick vertaling reactie waaruit de MNase fragmenten werden weggelaten. Alleen monsters in welke MNase fragmenten worden gecombineerd met linker DNA de verwachte amplicon produceren (869 bp). Klik hier voor een grotere versie van dit cijfer.

Discussion

CORALINA kan worden gebruikt voor het genereren van grootschalige gRNA bibliotheken door gecontroleerde nuclease spijsvertering van DNA van het doel en bulk klonen van resulterende dubbele gestrande fragmenten. Statistische inferentie geeft aan dat veel meer dan 107 individuele gRNA sequenties hebben al met succes gekloond met behulp van het protocol op9van de hand. CORALINA kan op meerdere manieren worden aangepast. De keuze van de sjabloon DNA definieert de doel-regio en de maximale complexiteit van de gegenereerde bibliotheek. Met behulp van dit protocol, CORALINA bibliotheken zijn eerder gegenereerd van mens en muis genomic DNA9. Representatieve resultaten die hier gepresenteerd verbeelden de generatie van de bibliotheek van een CORALINA uit gezuiverde BAC DNA. Verdere aanpassingen kan worden bereikt door de keuze van vector- en linker opeenvolgingen van gRNA expressie. Wij hebben drie verschillende paren van linker lengtes voor Gibson montage met kleine variaties in efficiëntie9eerder beproefd.

Als gevolg van hun oorsprong uit bulk verteerd DNA, protospacer van CORALINA gRNAs zijn meestal niet precies 20 bp in lengte, maar de show een lengte-verdeling met een gemiddelde dat beide hangt af van de parameters van de MNase spijsvertering en de grootte van de besnijdenis gemaakt van de pagina gel s. de representatief voorbeeld weergegeven in figuur 2B en C, toont fragmenten met een gemiddelde lengte tussen 19 en 27 bp. In onze ervaring, is de lengte van de fragmenten getrouw bewaard door de gegenereerde gRNA protospacer9. Terwijl fragmenten korter dan 20 bp dient vermeden te worden als gevolg van hogere af-streefpercentage van resulterende gRNAs, langere fragmenten zijn waarschijnlijk veel minder een probleem voor downstream toepassingen, sinds het aangetoond dat gRNAs met protospacers, zolang 45 bp zijn nog steeds functionele9.

De twee belangrijkste stappen in het CORALINA-protocol zijn de selectie van de grootte van fragmenten MNase-verteerd en klonen stappen. Generatie van fragmenten die te kort zijn (bijvoorbeeld de gemiddelde onder 18 bp) of opneming van teveel lege gRNA expressievectoren zal de bibliotheek maken nutteloos. Het is dus belangrijk om te optimaliseren de MNase spijsvertering stap (figuur 2A), volgen van excisie (figuur 2B, C), controleren voor volledige spijsvertering van de ruggengraat van de vector gRNA en inclusief geen fragment besturingselementen in het gehele protocol. Speciale zorg moet ook worden gehouden voor het behoud van de vertegenwoordiging van de gRNA-bibliotheek. Één gemeenschappelijke knelpunt van bibliotheek generatie is in het algemeen de efficiënte omzetting van plasmiden in bacteriën voor versterking. Dus zijn grote hoeveelheden bacteriën met uitstekende bekwaamheid en een groot aantal individuele electroporation gebeurtenissen noodzakelijk voor het bereiken van een groot aantal gRNA klonen.

Nieuwe strategieën voor de productie van de bibliotheek van de gRNA zal men moeten oogsten van het volledige potentieel van screening CRISPR gebaseerde benaderingen in de komende decennia. Er is een significante vraag naar aanpasbare, kosteneffectieve en eenvoudige methoden voor het genereren van grote bibliotheken, een eerste vereiste om screening vatbaar voor een groter aantal modelsystemen en verschillende CRISPR gebaseerde engineering benaderingen. CORALINA is het verstrekken van een eerste stap naar dit. De mogelijke toepassingen zijn divers, met name voor de productie van uitgebreide bibliotheken van genomen, cDNA bibliotheken van minder voorkomende modelsystemen, zeer gerichte bibliotheken en experimentele opstellingen in welke verschillende eiwitten van de CRISPR (met verschillende PAM afgeleid Requirements) worden gebruikt in combinatie.

In tegenstelling tot andere methoden, CORALINA genereert alle mogelijke gRNAs van de ingang DNA. Een nadeel van de methode is echter dat gRNAs ontbreekt de vereiste volgorde van de PAM zijn ook opgenomen in de bibliotheek, een functie die hij met een tweede enzymatische methode voor gRNA bibliotheek generatie, CRISPR-eten (tabel 1 deelt). De keuze van de ideale methode voor gRNA bibliotheek generatie is afhankelijk van de specificaties van de geplande screening experimenteren, met name de aard (genenreservoir, regelgevende, intergenic) en de grootte van de doel-regio (single locus, meerdere regio's, genoom-brede). We zien een speciale kop in met behulp van CORALINA wanneer een groot aantal niet-coderende of regelgevende regio's moeten worden geanalyseerd, als er onvolledig of onbetrouwbaar opeenvolgingsinformatie is (exotische modelsystemen, zaadmengsels van soorten (bijvoorbeeld microbiomes) of experimenteel verkregen input), verschillende CRISPR enzym worden gecombineerd of verzadigen van de analyse wordt uitgevoerd op een korte en gedefinieerde locus (bijvoorbeeld vertegenwoordigd door BACs).

Disclosures

De auteurs hebben niets te onthullen.

Acknowledgments

De auteurs zou willen van Prof. Dr. Stephan Beck en Prof. Dr. Magdalena Goetz bedanken voor hun inbreng, te helpen en te ondersteunen bij de ontwikkeling van de CORALINA-methode, Maximilian Wiessbeck en Valentin Baumann voor nuttige opmerkingen. Het werk werd ondersteund door DFG (STR 1385/1-1).

Materials

Name Company Catalog Number Comments
500 mM EGTA Sigma Aldrich 03777-10G 1.4., Inactivation of Mnase
Novex Hi-Density TBE Sample Buffer Thermo Fisher Scientific LC6678 2.1.
Novex® TBE Gels, 20%, 10 well Thermo Fisher Scientific EC6315BOX 2.1., pre-made 20 % PAGE gel
O'RangeRuler 5 bp DNA Ladder, Thermo Fisher Scientific SM1303 2.1.
Novex® TBE Running Buffer Thermo Fisher Scientific LC6675 2.1., PAGE gel running buffer
Disposable scalpel, sterile VWR  233-5363  2.3., other equivalent reagents may be used
SYBR Green I nucleic acid stain (1000x concentrate in DMSO) Sigma Aldrich
S9430
2.3. +2.5., also available from Thermo Fisher Scientific (S7563)
UltraPure Phenol:Chloroform:Isoamyl Alcohol (25:24:1) Thermo Fisher Scientific 15593-031 3.6.1. + 4.3., other equivalent reagents may be used
Glycogen Sigma 10901393001 3.6.4., other equivalent reagents may be used
3M Sodium acetate , pH5.2 Thermo Fisher Scientific   R1181 3.6.4., other equivalent reagents may be used
Ethanol  3.6.4. + 9.1.8., molecular biology grade
Quick blunting kit  New England Biolabs E1201 4.1.
ammomium acetate Sigma
A1542
3.1., other equivalent reagents may be used
magnesium acetate Sigma
M5661
3.1., other equivalent reagents may be used
0.5 M EDTA (pH 8.0) VWR   MOLEM37465520 (or Promega V4231) 2.2. + 3.1., other equivalent reagents may be used
Agencourt AMPure XP beads Beckman coulter A63881 5.3. + 6.5.
Gel extraction kit QIAGEN 28704 5.7.+ 7.1. +8.4., other equivalent reagents may be used
concentrated T4 DNA ligase New England Biolabs  M0202T 6.1.+ 8.1.2.
Long Amp Taq 2X Master Mix  New England Biolabs M0287S 6.3.
Phusion High-Fidelity PCR Master Mix with HF Buffer New England Biolabs M0531S 5.1. + 6.6., other equivalent reagents may be used
HindIII New England Biolabs R0104S 5.4.1. 
SacII New England Biolabs R0157S 5.4.2.
AgeI New England Biolabs R0552S 8.2.1.
Tris base Sigma 93362 8.1.1.
2M MgCl Sigma 93362 8.1.1.
dGTP,dATP, dCTP, dTTP New England Biolabs N0446S 8.1.1.
DTT Sigam
DTT-RO
8.1.1.
PEG-8000  Sigma
P5413
8.1.1.
NAD Sigma
N6522
8.1.1.
T5 exonuclease New England Biolabs M0363S 8.1.2.
Phusion DNA polymerase  New England Biolabs M0530S 8.1.2.
Taq DNA ligase New England Biolabs M0208L 8.1.2.
rSAP New England Biolabs M0371S 8.3.1.
TG1 competent cells Lucigen 60502-1 9.1.
1mm gap electroporation cuvettes  VWR 732-2267  10.2.
Bio-Assay Dish (Polystyrene, 245 mm x 245 mm x 25 mm) Fisher Scientific DIS-988-010M  9.4.
NaCl Sigma S7653  9.3.
Bacto-tryptone BD 211705 9.3.
Yeast extract BD 212750 9.3.
Agar Sigma
A1296
9.4.
Glycerol Sigma
G5516
9.17.
MNAse New England Biolabs M0247S 1.1.
Nanodrop Thermo Fisher Scientific ND-2000 throughout
Micropulser Biorad 165-2100 10.2.
Electroporation cuvettes Biorad 732-2267  10.2.
250 ml centrifuge tubes Corning 430776 9.1-9.9.

DOWNLOAD MATERIALS LIST

References

  1. Mali, P., Esvelt, K. M., Church, G. M. Cas9 as a versatile tool for engineering biology. Nat Methods. 10, (10), 957-963 (2013).
  2. Yang, H., et al. One-step generation of mice carrying reporter and conditional alleles by CRISPR/Cas-mediated genome engineering. Cell. 154, (6), 1370-1379 (2013).
  3. Stricker, S. H., Koferle, A., Beck, S. From profiles to function in epigenomics. Nat Rev Genet. 18, (1), 51-66 (2017).
  4. Dominguez, A. A., Lim, W. A., Qi, L. S. Beyond editing: repurposing CRISPR-Cas9 for precision genome regulation and interrogation. Nat Rev Mol Cell Biol. 17, (1), 5-15 (2016).
  5. Shalem, O., et al. Genome-scale CRISPR-Cas9 knockout screening in human cells. Science. 343, (6166), 84-87 (2014).
  6. Wang, T., Wei, J. J., Sabatini, D. M., Lander, E. S. Genetic screens in human cells using the CRISPR-Cas9 system. Science. 343, (6166), 80-84 (2014).
  7. Koike-Yusa, H., Li, Y., Tan, E. P., Velasco-Herrera Mdel, C., Yusa, K. Genome-wide recessive genetic screening in mammalian cells with a lentiviral CRISPR-guide RNA library. Nat Biotechnol. 32, (3), 267-273 (2014).
  8. Hart, T., et al. High-Resolution CRISPR Screens Reveal Fitness Genes and Genotype-Specific Cancer Liabilities. Cell. 163, (6), 1515-1526 (2015).
  9. Koferle, A., et al. CORALINA: a universal method for the generation of gRNA libraries for CRISPR-based screening. BMC Genomics. 17, (1), 917-940 (2016).
  10. Lane, A. B., et al. Enzymatically Generated CRISPR Libraries for Genome Labeling and Screening. Dev Cell. 34, (3), 373-378 (2015).
  11. Sambrook, J., Russell, D. W. Isolation of DNA fragments from polyacrylamide gels by the crush and soak method. CSH Protoc. (1), (2006).
  12. Gibson, D. G. Enzymatic assembly of overlapping DNA fragments. Methods Enzymol. 498, 349-361 (2011).
  13. Elsaesser, R., Paysan, J. Liquid gel amplification of complex plasmid libraries. Biotechniques. 37, (2), 200-202 (2004).
Een universeel Protocol voor grootschalige gRNA bibliotheek productie uit elke bron van DNA
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Köferle, A., Stricker, S. H. A Universal Protocol for Large-scale gRNA Library Production from any DNA Source. J. Vis. Exp. (130), e56264, doi:10.3791/56264 (2017).More

Köferle, A., Stricker, S. H. A Universal Protocol for Large-scale gRNA Library Production from any DNA Source. J. Vis. Exp. (130), e56264, doi:10.3791/56264 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter