Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

En universel protokol for storstilet gRNA bibliotek produktion fra enhver kilde, DNA

doi: 10.3791/56264 Published: December 6, 2017

Summary

Metoder til at generere store gRNA biblioteker skal være enkel, effektiv og omkostningseffektiv. Vi beskriver en protokol til produktion af gRNA biblioteker baseret på Enzymatisk nedbrydning af target-DNA. Denne metode, CORALINA (omfattende gRNA bibliotek generation gennem kontrolleret nukleasen aktivitet) præsenterer et alternativ til dyre brugerdefinerede oligonukleotid syntese.

Abstract

Populariteten af CRISPR/Cas9-system for både genom og epigenome engineering skyldes dets enkelthed og tilpasningsevne. En effektor (Cas9 nukleasen eller en nukleasen-døde dCas9 fusion protein) er målrettet mod et bestemt websted i genomet ved en lille syntetisk RNA kendt som guide RNA eller gRNA. Den todelte karakter af CRISPR systemet muliggør dets brug i screening tilgange siden plasmid biblioteker indeholder udtryk kassetter af tusindvis af individuelle gRNAs kan bruges til at afhøre mange forskellige websteder i et enkelt eksperiment.

Til dato, har gRNA sekvenser for opførelsen af biblioteker været næsten udelukkende genereret af oligonukleotid syntese, som begrænser den opnåelige kompleksiteten af sekvenser i biblioteket og er relativt omkostningskrævende. Her, en detaljeret protokol for CORALINA (omfattende gRNA bibliotek generation gennem kontrolleret nukleasen aktivitet), en enkel og omkostningseffektiv metode til generation af meget komplekse gRNA biblioteker baseret på Enzymatisk nedbrydning af input DNA, er beskrevet. Da CORALINA biblioteker kan oprettes fra enhver kilde til DNA, findes masser af muligheder for tilpasning, gør det muligt for en lang række CRISPR-baserede skærme.

Introduction

Tilpasning af bakterielle CRISPR/Cas9-systemet som en Molekylær målretning værktøj forårsagede den seneste revolution i Molekylærbiologi. Aldrig før har det været så nemt at manipulere kromatin definerede genomisk steder. Fælles anvendelser af CRISPR omfatter målrettede gen mutationer1, genom engineering2, epigenome redigering3, transcriptional aktivering og genhæmning4. En særlig fordel ved CRISPR systemet er, at dens anvendelser ikke er begrænset til velundersøgte kandidat websteder, som gRNA biblioteker gøre mindre forudindtaget skærme muligt. Disse lette opdagelsen af funktionelle loci i genom uden nogen forudgående eksperimentelle viden. Dog gRNA bibliotek byggeri er i øjeblikket for det meste baseret på oligo-nukleotid syntesen, og der er begrænsede muligheder for at købe gRNA biblioteker, som ikke er af menneskelige eller mus oprindelse eller target regioner uden for åbne læsning rammer. Således, selv om CRISPR skærme har allerede vist sig utrolig potent5,6,7,8, deres fulde potentiale endnu ikke blevet udnyttet.

For at overvinde begrænsning af klassisk gRNA generation metoder to strategier er for nylig blevet udviklet. Begge er baseret på kontrollerede Enzymatisk nedbrydning af target DNA i stedet stole på brugerdefinerede oligonukleotid syntese. Mens CORALINA9 beskæftiger micrococcal nukleasen, metoden kun aktuelt tilgængelige alternative CRISPR-SPISE10, gør brug af restriktionsenzymer (HpaII, ScrFjeg, Bfajeg og Mmejeg). Vigtigere, kan begge teknikker anvendes på ethvert input DNA, som fungerer som kilde til gRNA protospacer sekvenser. Mens metoden CRISPR-spiser beskæftiger en strategi til at mindske antallet af klonede gRNAs hvis målretning websteder ikke er efterfulgt af den krævede S.pyogenes PAM (protospacer tilstødende motiv), det skaber kun en lille brøkdel af alle mulige funktionelle gRNAs for en given region. CORALINA, på den anden side er i stand til at generere alle mulige gRNAs for kilde sekvens, men indeholder også en højere brøkdel af ikke-funktionelle guider. gRNA bibliotek generation gennem kontrolleret nukleasen aktivitet giver mulighed for fremstilling af omfattende gRNA biblioteker for alle arter, eventuelle Cas9-protein eller -effektor system i en enkel og omkostningseffektiv måde. CORALINA er desuden tilpasses for tilpasning, som passende input og vektor valg definerer den type dokumentbibliotek, størrelse og indhold. En detaljeret protokol præsenteres her, kan bruges til den generation af omfattende gRNA biblioteker fra forskellige kilder af DNA (figur 1), herunder bakteriel kunstige kromosomer (BACs) eller genomisk DNA9. De repræsentative resultater ledsager denne protokol blev afledt ved at anvende CORALINA protokol til BAC DNA.

Protocol

1. fordøjelse af DNA med Micrococcal nukleasen

  1. Udføre en optimering reaktion for hver ny batch af micrococcal nukleasen enzym (MNase).
    Bemærk: Antallet af enheder af MNase bruges skal være testet (ved hjælp af en seriel fortynding, figur 2A). Normalt 5-10 U af MNase fordøje 1 µg renset genomisk eller BAC DNA ned til et udvalg af 5-100 bp med betingelserne beskrevet nedenfor.
  2. Per reaktion, oprettet 1 µL af 10 x MNase Buffer, 1 x bovint serumalbumin (BSA), 1 µg af target-DNA, 1 µL af MNase (0,1-50 enheder) i en 10 µL reaktion volumen.
  3. Der inkuberes ved 37 ° C i 15 min.
  4. Straks inaktiverer enzymet ved at tilføje 1 µL af 500 mM ethylenglycol-bis(β-aminoethyl ether)-N, N, N', N'-tetraacetic syre (EGTA).

2. adskillelse af DNA fragmenter ved hjælp af polyacrylamid gelelektroforese (side)

  1. Tilføj prøve buffer/gel ladning farvestof til DNA-prøver og indlæse på en 20% siden gel. Indlæse en passende DNA ladder for dimensionering (5 bp DNA Ladder). Ikke overbelaste gel (1 µg DNA pr. brønd).
  2. Køre geler i passende 1 x TRIS-Borat-EDTA (TBE) kører buffer på 150 V (konstant) for omkring 1,5 h eller indtil den lavere farvestof front (bromophenol blå, mørk blå farve), der rejser på omkring 15 bp, når den nederste ende af gelen.
  3. Pletten gel ved hjælp af en ultra-følsomme nukleinsyre pletten og visualisere under UV-lys.
  4. Bestemme den optimale koncentration af MNase for digesting DNA ned til 20-30 bp i størrelse fra billedet gel.
  5. Bruge optimerede koncentrationen af MNase for at fordøje target-DNA ved at gentage trin 1.2-2.2. Normalt, fordøjet opsætning af 10-12 reaktioner (dvs. 10-12 µg total starter materiale) vil give nok DNA efter side gel udvinding for at fortsætte til efterfølgende trin.
  6. Ved hjælp af en steril skalpel skæres gel ved siden af markør lane og pletten kun del af gelen indeholder stigen med frisk 1 x TBE kører buffer indeholdende 1 X af en ultra-følsomme nukleinsyre pletten. Visualisere DNA ladder og punktafgifter MNase-fordøjet DNA fragmenter i størrelsesområde mellem ca 18-30 bp ved hjælp af et barberblad.
    Bemærk: Undgå at udsætte MNase fordøjet fragmenter for UV-lys. Det er muligt at bruge en blå lyskilde (i stedet for UV) eller tage et billede af stigen under UV, udskrive den for at skalere og bruge denne til at guide excision af MNase-fordøjet DNA fragmenter). Dette trin forhindrer farvning og DNA fragmenter eksponering for UV-lys. Brug altid en ubrugt, sterile engangs skalpel eller barberblad til dette skridt til at undgå forurening.
  7. Overføre gel skive til et microcentrifuge rør.
  8. Pletten resten af gel med nukleinsyre pletten som ovenfor, udsættes for UV-lys og registrere et billede for at holde et referat af gel excision trin.

3. isolering af DNA fragmenter fra side-geler ved hjælp af Crush og sættetid metode

Bemærk: Dette trin er blevet vedtaget fra Sambrook et al. 11

  1. Forberede side gel oploesning buffer (1.88 mL 4 M ammoniumacetat, 150 µL 1 M magnesium acetat, 30 µL af 0,5 M ethylendiamintetra syre (EDTA) (pH 8) i ultrarent H2O til en samlet maengde paa 15 mL).
  2. Knuse skåret gel skive mod væggen micro-centrifugerør ved hjælp af en steril pipette tip.
  3. Tilføj 2 gel mængder af side oploesning buffer og inkuberes ved 37 ° C i 16 timer på en roterende platform.
  4. Der centrifugeres prøver i 1 minut ved maksimal hastighed i en microcentrifuge. Overføre supernatanten til en ny microcentrifuge tube, pas på ikke for at overføre nogen knust gel stykker.
  5. Tilføje 0,5 side oploesning buffer til gelen pellet, vortex, og Gentag centrifugering (trin 3,4). Kombinere supernatanter.
  6. Uddrag af DNA-fragmenter ved hjælp af standard phenol-chloroform udvinding.
    Forsigtig: Phenol er giftigt, hvis det kommer i kontakt med huden eller ved indtagelse. Sikkerhedsforanstaltninger som handsker, beskyttelsesbriller, en lab coat og arbejder i et stinkskab er kritisk. Bortskaf alle phenol-holdige affald ifølge institute's regler.
    1. Tilføje et volumen af phenol: chloroform: isoamyl alkohol (25:24:1) til prøven og vortex grundigt.
    2. Der centrifugeres i 10 min. ved maksimal hastighed (16.000 x g) i en bordplade centrifugeres ved stuetemperatur. Omhyggeligt overføre den øverste vandige fase til en frisk microcentrifuge tube. Passe på ikke for at bære over enhver phenol under pipettering.
    3. Gentag trin 3.6.1 og 3.6.2 én gang.
    4. Tilføje en lille mængde (0.2 µL) af glykogen, 0,1 bind 3 M natriumacetat (pH 5,2) og 2 bind af 100% ethanol (EtOH).
    5. Vortexes og inkuberes ved-20 ° C i flere timer eller natten over.
    6. Der centrifugeres i 30 min. ved maksimal hastighed ved 4 ° C ved hjælp af en bordplade centrifuge.
    7. Forsigtigt fjerne supernatanten og vaske DNA pellet med 70% EtOH.
    8. Der centrifugeres i 30 min. ved maksimal hastighed ved 4 ° C ved hjælp af en bordplade centrifuge.
    9. Fjern supernatanten og lufttørre DNA pellet. Sørg for, at alle EtOH er fordampet, men vær omhyggelig med ikke at over tørre pellet.
    10. Opløse DNA pellet i 12 µL af H2O.
      Bemærk: Siden gel udvinding er meget ineffektiv. For hver 10 µg for at starte DNA fordøjes med MNase, Forvent at inddrive 1-20 ng af renset fragmenter efter gel ekstraktion. Kontrollere mængden og integritet af fragmenter af lastning 1/6th (2 µL) på en side gel (figur 2 c).

4. slut reparation af MNase-fordøjet, Gel-renset fragmenter

  1. Oprettet følgende reaktion ved hjælp af en DNA forfladige kit: 10 µL af oprenset DNA fra trin 3.6.10, 1,5 µL af 10 X forfladige buffer, 1,5 µL af 1 mM dNTP mix, 0,6 µL af sløvhed enzym, 1.4 µL af H2O.
  2. Der inkuberes ved 22 ° C i 30 min, og derefter varme-inaktiverer enzymet ved inkubering ved 70 ° C i 10 min.
  3. Tilføje 85 µL af H2O og udføre en reaktion oprydning ved hjælp af standard fenol/chloroform-ekstraktion og EtOH-nedbør (som beskrevet i afsnit 3.6). Gå straks til linker ligatur.

5. linker Generation

Bemærk: Linkers skal forstærkes parallelt med afsnit 3 at fortsætte straks med linker ligatur. Primer sekvenser bruges nedenfor skal være passende for den valgte gRNA udtryk vektor. Dem, der præsenteres her er konstrueret til vektor pgRNA-pLKO.1. 9 for forstærkning af 5' linker fra pgRNA-pLKO.1, anvende primer sekvenser 5'-linker-F (TTGGAATCACACGACCTGGA) og 5'-linker-R (CGGTGTTTCGTCCTTTCCAC), hvilket giver en 689 bp amplikon. Til forstærkning af 3' linker fra pgRNA-pLKO.1, bruge primere 3'-linker-F: (GTTTTAGAGCTAGAAATAGCAAGTTAAAATA) og 3'-linker-R: (ACTCGGTCATGGTAAGCTCC), som giver en 848 bp amplikon.

  1. PCR-Forstærk adapteren sekvenser fra gRNA udtryk vektor (ved hjælp af reagenser af valg og brugerdefinerede primer sekvenser, hvis nødvendigt). For pgRNA-pLKO.1 oprettet følgende 50 µL PCR reaktionen: 25 µL PCR master mix, 2,5 µL af primer F (10 µM), 2,5 µL af primer Rasmussen (10 µM), 0,1 ng af gRNA udtryk vektor (pgRNA-pLKO.1) i H2O.
  2. Inkuber reaktioner på en thermocycler ved hjælp af følgende betingelser: 1 cyklus 98 ° C til 30 s, 32 cyklusser 98 ° C til 10 s, 59 ° C i 10 s, 72 ° C i 30 s, 1 cyklus 72 ° C i 10 min.
  3. Rense PCR reaktioner ved hjælp af faste fase reversible immobilisering perler ifølge producentens anvisninger. Elueres i 30 µL af H2O.
  4. At håndhæve retningsbestemt ligatur af den linker til slutningen-repareret, MNase-fordøjet DNA fragmenter, digest linkers med passende restriktionsenzymer (her HindIII og SacII). Konfigurer følgende reaktioner:
    1. For fordøjelsen af 5' linker med HindIII, bruge 30 µL af renset 5' linker amplikon fra trin 5.3., 5 µL af Buffer, 3 µL af HindIII (20U/µL) og 12 µL af H2O.
    2. For fordøjelsen af 3' linker med SacII, bruge 30 µL af renset 3' linker amplikon fra trin 5.3., 5 µL af Buffer, 3 µL af SacII (20 U/µL), og 12 µL af H2O.
  5. Inkuber fordøjer ved 37 ° C til 3 h.
  6. Tilføje DNA gel ladning farvestof og køre begrænsning enzym fordøjer på en 1%-agarosegel. Punktafgifter bands på 637 bp (5' linker fordøje) og 295 bp (3' linker digest).
  7. Rense DNA fra skåret gel stykker ved hjælp af en gel udvinding kit.

6. linker ligatur og forstærkning af skær

  1. Oprette en 14 µL ligatur reaktion ved hjælp af equimolar mængder af MNase-fordøjet, ende-repareret fragmenter og linker sekvenser.
    Bemærk: Linker til fragment nøgletal kan optimeres. Det anbefales at medtage en no-fragment kontrol (NFC) reaktion.
    1. Brug 5 ng af MNase-fordøjet fragmenter (slutningen-repareret og renset), 120 ng af 5' linker (HindIII digest, renset), 55 ng af 3' linker (SacII digest, renset), 1,4 µL af T4 ligase Buffer og 1,4 µL af koncentreret T4 DNA ligase i H2O.
  2. Inkuber ligatur reaktioner på 16 ° C i 16 h. Gør ikke varme-inaktiverer enzymet. Fortsætte umiddelbart nick-oversættelse.
    Bemærk: Slut-repareret MNase-fordøjet fragmenter giver de 5' fosfater nødvendige for ligatur af linkers, som linker selv er un-fosforyleres.
  3. Ligation reaktion (og NFC reaktion) føjer følgende: 25 µL af Taq 2 X master mix (i stand til at nick oversættelse), 2,5 µL af primer Linker-Minus450-F (10 µM, GGGCAAGTTTGTGGAATTGG), 2,5 µL af primer Linker-Plus275-R (10 µM, AAGTGGATCTCTGCTGTCCC) og 6 µL af H2O.
  4. Omfatte en no-template control (NTC). Inkuber reaktioner på en thermocycler ved hjælp af følgende betingelser: 1 cyklus (nick oversættelse): 72 ° C i 20 min., 1 cyklus: 95 ° C i 5 min, 3-4 cyklusser: 95 ° C i 15 s, 58 ° C i 15 s, 72 ° C i 30 s, 1 cyklus: 72 ° C i 5 min.
  5. Udføre en reaktion oprydning ved hjælp af faste fase reversible immobilisering perler med en prøve til perle forholdet 1:1. Elueres i 40 µL af H2O.
  6. Yderligere forstærke den ønskede fragment (5' linker + MNase fragment + 3 ' linker) ved hjælp af passende PCR-reagenser og de følgende primere:
    1. Bruge 12,5 µL PCR master mix, 1,25 µL af primer Linker-Minus450-F (10 µM, GGGCAAGTTTGTGGAATTGG), 1,25 µL af primer Linker-Plus275-R (10 µM, AAGTGGATCTCTGCTGTCCC), 2,5 µL af renset nick oversættelse produkt fra trin 6.4. og 7,5 µL af H2O. bruger følgende betingelser: 1 cyklus: 98 ° C i 30 s, 10-16 cyklusser: 98 ° C i 10 s, 63 ° C i 10 s, 72 ° C i 15 s, 1 cyklus: 72 ° C i 10 min.
      Bemærk: Hvis det er nødvendigt, flere reaktioner kan sættes op samtidig at sikre, at der er nok PCR produkt til de senere trin. For at visualisere små mængder af PCR-produktet på en agarosegel, konfigurere yderligere reaktioner som i skridt 6,5 og øge cyklus antallet fra 15 til 32. Denne reaktion kan bruges som kvalitetskontrol, hvis amplikoner ikke er synlige efter 15 cykler. Omfatte også en ingen template control (NTC).

7. størrelse udvælgelse

Bemærk: Dette trin adskiller MNase-fragmenter med den korrekt vedlagte 5' og 3' linker fra fragmenter med to 5' eller to 3' linkers baseret på størrelse.

  1. Kombinere alle 15-cyklus PCR reaktioner fra trin 6.5., tilføje DNA lastning farvestof og køre på en 0,8%-agarosegel. Punktafgifter fremtrædende bandet på 869 bp og rense DNA ved hjælp af en gel udvinding kit.
  2. Kvantificere mængden af DNA (f.eks. ved hjælp af et spektrofotometer).

8. kloning af PCR forstærket fragmenter i gRNA udtryk vektor af Gibson forsamling

  1. Forberede forsamling master mix som følger:
    Bemærk: Følgende trin er tilpasset fra Gibson et al. 12.
    1. Oprette 6 mL isotermisk reaktion buffer ved at kombinere 3 mL 1 M Tris (hydroxymethyl) aminomethane (Tris)-HCl pH 7,5, 300 µL 1 M MgCl, 60 µL af 100 mM deoxyguanosine trifosfat (dGTP), 60 µL af 100 mM deoxyadenosine trifosfat (dATP), 60 µL af 100 mM deoxythymidine trifosfat (dTTP), 60 µL af 100 mM deoxycytidine trifosfat (dCTP), 300 µL 1 M dithiothreitol (DTT), 1,5 g af polyethylenglycol (PEG)-8000, 300 µL af 100 mM nicotinamid-adenin-dinucleotid (NAD) i ultrarent H2O.
      Bemærk: Denne buffer kan være aliquoted og opbevares ved-20 ° C.
    2. Oprette 1,2 mL forsamling master mix ved at kombinere 320 µL af 5 X isotermisk reaktion buffer, 3 µL af 10 U/µL T5 exonuclease, 20 µL af 2 U/µL DNA polymerase, 160 µL af 40 U/µL DNA ligase i ultrarent H2O. Brug 15 µL af forsamling master mix med 5 µL af Indsæt.
      Bemærk: Forsamling master mix kan være aliquoted og opbevares ved-20 ° C, hvor det er stabilt i mere end et år og kan tåle flere fryse-tø cykler. Det valgte antal T5 exonuclease er ideel til brug med lange udhæng.
  2. Vektor rygraden fordøjelsen
    Bemærk: Sørg for at fordøje en tilstrækkelig mængde af vektor som input til det ønskede antal forsamling reaktioner i trin 8.3.
    1. Per reaktion, skal du tilføje følgende: 1,5 µg gRNA udtryk vektor (pgRNA-pLKO.1), 5 µL af buffer, 1,5 µL af alderjeg (5U/µL), og 38,5 µL af H2O. Incubate fordøje ved 37 ° C i 2 timer.
  3. Dephosphorylation af den lineariseret vektor.
    Bemærk: Dette trin er rådgivet men ikke strengt nødvendigt. T5 exonuclease i master mix vil for det meste fjerne alderjeg hænger ud før Taq DNA ligase har haft en chance for at handle. Overdreven re ligatur af vektoren forventes derfor ikke.
    1. Tilføje 2,5 µL af rejer alkalisk fosfatase enzym (rSAP, 1 U/µL).
    2. Der inkuberes ved 37 ° C i 30 min, og derefter inaktiverer enzymet ved at inkubere ved 65 ° C i 5 min.
  4. Udføre DNA oprensning
    Bemærk: Det anbefales at udføre en Agarosen gel ekstraktionstrinet. Alternativt, kolonne- eller perle rensning kan bruges. Det er vigtigt at kontrollere, at vektor fordøjelsen er komplet, fx ved agarosegelelektroforese gelelektroforese. Til sammenligning, ufordøjet vektor bør køre parallelt.
  5. Kvantificere mængden af renset fordøjet vektor i prøven.
  6. Oprettet forsamlingen med 2-fold kindtand overskud af skær til vektor. Per 20 µL reaktion brug 100 ng af vektor (alderjeg fordøje fra skridt 8,5), 12.2 ng af Indsæt (fra trin 7.1.), 15 µL af forsamling master mix fra trin 8.1.2. i H2O.
  7. Inkuber ved 50 ° C i 1 time.
  8. Rense reaktioner ved hjælp af kolonnen rensning. Resuspend DNA i 75 µL af H2O (eller fald lydstyrken afhængigt af omfanget af elektroporation).
    Bemærk: Transformation effektivitet er stærkt afhængige af DNA renhed. Yderligere rensning trin (fx fenol/chloroform udvinding) kan forbedre effektiviteten.

9. forberedelse af Electro-kompetente TG1 E. coli celler

  1. Sikre, at alle centrifugeres flasker og flakoner er gratis fra vaske-og rengøringsmidler ved skylning og efterfølgende påfyldning med destilleret vand før autoklavering.
    Bemærk: Dette trin hjælper til at fjerne alle urenheder, som kan påvirke transformation effektivitet. Vand skal kasseres umiddelbart før brug. Alternativt, brug af disponible centrifugering flasker kan være tilrådeligt.
  2. Sikre at centrifuge flasker, rør og løsninger, der anvendes til fremstilling af electrocompetent celler er kølet på is før brug. Det er bedst at udføre følgende trin i et koldt rum til at minimere temperatursvingninger, som kan påvirke transformation effektivitet.
  3. Forberede 2TY medium. 16 g af bacto trypton tilføje 10 g af gærekstrakt og 5 g NaCl, destilleret vand til 1 L, mix og autoklave. Butik medium ved stuetemperatur.
  4. Forberede 2TY-agar belagt bioassay retter og 10 cm petriskåle, der indeholder de relevante antibiotika. Store plader ved 4 ° C.
    Bemærk: Valget af antibiotikum afhænger af arten af gRNA udtryk vektor, brug 100 µg/mL ampicillin for pgRNA-pLKO.1.
  5. Skrab fra en glycerol bestand af TG1 celler til podes 10 mL af 2TY medium (uden antibiotika).
  6. Inkuber kultur ved 37 ° C natten over (~ 16 h) med rysten på 225 rpm.
  7. Podes 1 L 2TY medie (uden antibiotika) med 10 mL af overnight kultur (1/100 fortynding) og dividere det ligeligt mellem to 2 L flasker (indeholdende bafler).
  8. Inkuber kultur ved 37 ° C, 225 rpm indtil en OD600 nm af 0,55 er nået (ca efter 1,5-2 h). Brug et spektrofotometer regelmæssigt kontrollere OD600 nm.
  9. Chill kulturer på is i 30 min.
  10. Split kultur ligeligt mellem fire 500 mL centrifugeres flasker (pre kølet på is).
  11. Der centrifugeres i 15 min på 4.000 x g ved 4 ° C i en pre kølet centrifuge.
  12. Dekanteres analysere og tilføje 1 volumen (dvs. 250 mL) af pre kølet iskold sterilt destilleret H2O til hver af centrifuge flasker. Resuspenderes bakteriel, ved hvirvlende eller vende flasken (eller blid pipettering, hvis nødvendigt).
    Bemærk: Det er lettere at resuspenderes ved første tilføje en lille mængde vand. Sikre pelleten er helt genopslemmes til sidst.
  13. Der centrifugeres i 15 min på 4.000 x g ved 4 ° C.
  14. Gentag vask to gange (trin 9.12. og 9.13). Fjern supernatanten. Vær forsigtig, når klaring som den bakterielle pellet bliver stadig mere løs efter vask.
  15. Resuspenderes i 50 mL sterilt, iskold 10% glycerol og overføre det til en pre kølet 50 mL-centrifugerør.
  16. Centrifuge celler i 15 min. ved ~ 4.000 x g ved 4 ° C. Fjern forsigtigt supernatanten.
  17. Forsigtigt resuspend bakterier i 2 mL iskold sterile 10% glycerol.
  18. Holde på is, hvis cellerne skal anvendes straks for elektroporation.
    Bemærk: Cellerne kan være frosset i delprøver af 50 µL i 0,5 mL rør i et bad med tøris ethanol og opbevares ved-80 ° C, men dette kan ikke anbefales.

10. elektroporation TG1 Electrocompetent E. coli celler

Bemærk: Elektroporation er en af flaskehalsene i omfattende bibliotek generation. For at bevare bibliotek repræsentationen, det anbefales at foretage så mange individuelle elektroporation reaktioner som nødvendigt/praktisk og udføre kvalitetskontrol trinene beskrevet nedenfor (10.6. og 10,8.).

  1. Alikvot renset reaktioner (fra skridt 8,8) i sterilt og pre kølet PCR rør og holde dem på is (1 µL pr. tube). Chill 1 mm hul elektroporation kuvetter på is.
  2. Tilsæt 25 µL af frisklavede TG1 celler direkte til en alikvot af DNA og straks overføre blandingen til en elektroporation kuvette. Svirp eller tap kuvette at sikre celler/DNA mix er fordelt langs længden af kuvette kammer (uden fanget luft eller bobler).
  3. Placer kuvette i salen, dias og starte programmet passende elektroporation (f.eks. 1 pulsen på 1,8 kV (EC1)).
    NOTE: Konstanten tid bør ligge mellem 5,7 og 6,0 ms. i tilfælde af electroporator buer, svirp kuvette, sikre, at der er ingen luftbobler i salen og prøv igen.
  4. Straks tilføje 975 µL af stuetemperatur 2TY medium til kuvette.
  5. Brug overførsel pipette, flytte electroporated bakterier til en 50 mL tube. Gentag fra trin 10.2. og indsamle alle celler omdannet med et bibliotek i en 50 mL tube.
  6. Dokumentere den samlede volumen.
  7. Kvalitetskontrol trin
    1. For at kvantificere de frisk genererede electro-kompetente celler kompetence, udføre en separat elektroporation reaktion ved hjælp af et defineret antal uncut plasmid DNA (f.eks. 10 pg pUC19 kontrol plasmid). Overføre dette til en 1,5 mL mikrofuge tube.
      Bemærk: Kompetence skal være mindst 1010 kolonidannende enheder (cfu) pr. µg DNA. Frisklavet celler klarer normalt sig bedre end dette.
  8. Inkuber transformerede bakterier ved 37 ° C i 60 min ryster på 225 rpm.
  9. Kvalitetskontrol trin:
    1. Plade en defineret lille mængde bakterier omdannet med bibliotek (f.eks. 10 µL af en 10-100 fold fortynding) på en 10 cm agar plade med passende antibiotika valg.
      Bemærk: At kende den samlede kultur volumen (fra trin 10.6.), kan opnåede koloni tal bruges til at anslå det samlede antal kolonier for hele biblioteket. 20-30 fold repræsentation af biblioteket bør ideelt opretholdes.
  10. Sprede resten af bakterier på 2TY agar belagt bioassay skåle, som indeholder de relevante antibiotika valg.
    Bemærk: Mængden af kulturen kan reduceres ved centrifugering ved ~ 4.000 x g i 10 min. (eller indtil en synlig pellet har dannet og supernatanten vises tydeligt). Dette reducerer den tid plader skal tørre efter spredning af kulturen. Anvendelse af plader i stedet for flydende kultur minimerer uforholdsmæssig vækst af enkelte kolonier. 13
  11. Spredes et passende volumen af pUC19 kontrol elektroporation reaktion på en ekstra 10 cm agar parabol med passende antibiotika valg.
  12. Inkuber agar plader natten (16 h) ved 37 ° C.
  13. Tælle opnåede kolonier på kontrol plader (pUC19 og kontrol bibliotek plade) at vurdere CFU/µg DNA for bakterier samt bibliotek kompleksitet.

11. udvinding af Plasmid DNA

  1. Der tilsættes 10 mL 2-TY medier de overnattende plader, skrabe den bakterielle lag off plade ved hjælp af en engangs sprederen og samle det i en 50 mL tube. Gentag et par gange, indtil alle pladens vises ren.
  2. Uddrag DNA ved hjælp af en Plasmid Maxi kit (2-3 kolonner nødvendige per bioassay plade).

Representative Results

Ved hjælp af protokollen ved hånden, er CORALINA gRNA biblioteker blevet genereret fra mennesker og mus genomisk DNA9 og BAC DNA (figur 1). For at producere fragmenter af input DNA egnet til kloning i gRNA udtryk vektorer, har optimale betingelser for kontrolleret nukleasen fordøjelsen skal fastlægges. En typisk resultat for optimering af micrococcal nukleasen fordøjelsen er afbildet i figur 2A. Utilstrækkelig mængde af nukleasen (0,1, 2, 3, 4, 4.5 eller 5 enheder) producerer ingen mærkbar produkter i den krævede størrelsesområde (10-100 bp) og 5.5-7,5 enheder stadig produceres fragmenter, der er i gennemsnit for længe. Større mængder af enzymet (50 enheder) fører til overdreven nedbrydning af input DNA efter 10 min. En mellemliggende beløb blev derfor valgt (10 enheder). Digest'en blev skaleret til at producere nok fordøjet fragmenter for efterfølgende rensning og kloning (figur 2B). Mens det anbefales at blindt vælge DNA fragmenter efter størrelse og kun stole på DNA stigen til orientering at minimere eksponering af DNA-fragmenter for UV-lys, kan geler farves bagefter for kvalitetskontrol af fordøjelsen og skæring. Figur 2B viser et repræsentativt eksempel på en side gel fra hvilke DNA fragmenter mellem 20 og 30 bp har været skåret ud. Gel renset MNase fragmenter blev læsset på en 20% siden gel for at kontrollere succes størrelse udvælgelse og rensning af MNase-fordøjet fragmenter (fig. 2 c). Protokol ved hånden er kompatibel med brug af tilpassede linker sekvenser, gør det muligt for at klone de MNase-fordøjet fragmenter i gRNA udtryk vektorer af valg. Her, blev gRNA-PLKO9 brugt som rygrad. Linkers forstærkes fra gRNA udtryk vektor ved hjælp af standard PCR. Figur 2D skildrer et repræsentativt eksempel på forstærkede linker sekvenser blottet for yderligere, forkert eller ingen skabelon amplikoner. Næste, linker amplikoner fordøjes med restriktionsenzymer at sikre linkers er forbundet til MNase-fordøjet fragmenter i den rigtige retning. Figur 2D viser agarosegelitris af 5' og 3' linkers før og efter fordøjelse med HindIII og SacII henholdsvis, der angiver komplet foraskning af linkers til de forudsagte 637 og 295 bp. Den højre del af billedet, gel dokumenter excision af fordøjet linker fragmenter. Følgende gel udvinding af fordøjet linkers, det næste skridt i protokollen er ligatur af linkers til slutningen-reparerede MNase-fordøjet fragmenter. Fordi linker sekvenser er genereret af PCR med unphosphorylated primere, bør selvstændig ligatur af linkers ikke forekomme. Kun de ende-reparerede MNase-fordøjet DNA fragmenter giver grupperne fosfat nødvendige for ligatur. Efter nick oversættelse, ligatur produkt der forstærkes ved PCR. For at undgå overdreven PCR forstærkning bias, som kan give en skævhed repræsentation af gRNA sekvenser i biblioteket, er forstærkning begrænset til mindre end 20 cyklusser i alt. Efter PCR er forstærkning produkter svært at visualisere på agarosegelitris. Separat kontrol PCR'er med 32 cyklusser er derfor udføres for at påvise produkterne (men anvendes ikke til biblioteket forberedelse). Resultaterne fra denne kontrol PCR er vist i figur 2E. Dette giver mulighed for at optimere ligatur reaktioner og sikre reaktioner er blottet for PCR artefakter, der undertiden opstår i "ingen fragmenter kontrol" (NFC). Figur 2E viser den ønskede amplikon (5' linker + DNA fragment + 3' linker, længde: 869 bp) efter forstærkning af ligatur reaktioner ved hjælp af equimolar (1:1) forholdet mellem fragmenter og linker sekvenser.

Figure 1
Figur 1 : Foreslog tidslinjen for at forberede en gRNA bibliotek. CORALINA tilbyder en enkel og omkostningseffektiv strategi for generation af omfattende gRNA biblioteker fra et væld af forskellige DNA kilder fra enhver organisme. Protokol ved hånden kan bringes til afslutning under én arbejdsuge. Linker generation kan udføres parallelt med DNA ende-reparation. Forberedelse af electrocompetent bakterier tager to dage og omfatter en overnight vækst trin og skal derfor startes før montering reaktioner er oprettet. Venligst klik her for at se en større version af dette tal.

Figure 2
Figur 2 : Kritisk trin under protokollen. (A) kontrollerede fordøjelsen af BAC DNA giver generation af fragmenter af forskellige størrelser. Vist her er optimering af MNase fordøjelse. Renset BAC DNA blev behandlet med forskellige mængder af MNase for 10 min. 10 U af MNase generere DNA fragmenter af den ønskede længde (20-30 bp). (B) størrelse udvalg af fragmenter mellem 20 og 30 bp bruger excision fra polyacrylamidgeler. Renset BAC DNA blev behandlet med 10 U i MNase i 10 min. Billedet blev optaget efter excision. (C) kvalitetskontrol af gel-renset fragmenter. Efter gel-rensning, 1/6th af den renset MNase fragmenter blev læsset på en 20% siden gel til at kontrollere succes størrelse udvælgelse og rensning. (D) forstærkning af linker sekvenser for forsamlingen og begrænsning enzym fordøjelsen af linkers at sikre retningsbestemt kloning. 5' og 3' linkers blev forstærket og skære med HindIII og SacII, henholdsvis. No-skabelon kontrolelementer (NTC) blev inkluderet til kontrol for PCR artefakter og DNA forurening. Venstre: analytiske eksempelprogrammet; højre: forberedende eksempelprogrammet. Billedet blev optaget efter gel excision. (E) vellykket ligatur af linkers til DNA-fragmenter kan analyseres ved hjælp af PCR med et øget antal PCR cyklusser (32) og kontrolleret af foretager ingen skabelon kontrol med H2O (NTC) eller ved hjælp af NTC fra det forrige nick oversættelsestrin som input (NTC NT)). Det er vigtigt at medtage en ingen fragment kontrol (NFC), hvilket er en forstærkning fra en ligatur og nick oversættelse reaktion fra som MNase fragmenter blev udeladt. Kun prøver i hvilke MNase fragmenter er blevet kombineret med linker DNA producere det forventede amplikon (869 bp). Venligst klik her for at se en større version af dette tal.

Discussion

CORALINA kan bruges til at generere store skala gRNA biblioteker af kontrollerede nukleasen fordøjelsen af target-DNA og bulk kloning af resulterende dobbelt strandede fragmenter. Statistisk inferens indikerer, at mange flere end 107 individuelle gRNA sekvenser har allerede blevet med held klonede ved hjælp af protokollen på side9. CORALINA kan tilpasses på flere måder. Valget af DNA-template definerer målområde og maksimal kompleksiteten af den genererede bibliotek. Ved hjælp af denne protokol, CORALINA biblioteker tidligere er blevet genereret fra mennesker og mus genomisk DNA9. Repræsentative resultater præsenteret her skildre generation af en CORALINA bibliotek fra renset BAC DNA. Yderligere tilpasning kan opnås ved valg af gRNA udtryk vektor og linker sekvenser. Vi har tidligere prøvet tre forskellige par linker længder til Gibson forsamling med små variationer i effektivitet9.

På grund af deres oprindelse fra bulk fordøjet DNA, er protospacer i CORALINA gRNAs normalt ikke præcis 20 bp i længden, men Vis en længde distribution med et middel, der afhænger både parametrene for MNase fordøjelsen samt størrelsen af excision fremstillet af side gel s. den repræsentative eksempel vist i figur 2B og C, skildrer fragmenter med en median længde mellem 19 og 27 bp. Vores erfaring, er længden af fragmenter trofast bevaret af genererede gRNA protospacer9. Mens fragmenter kortere end 20 bp bør undgås på grund af højere ud målbeløbet af resulterende gRNAs, længere fragmenter er sandsynligvis langt mindre af et problem for downstream applikationer, da det er blevet påvist, at gRNAs med protospacers så længe 45 bp er stadig funktionelle9.

De to mest kritiske trin i CORALINA protokol er størrelse udvælgelse af MNase-fordøjet fragmenter og kloning trin. Generation af fragmenter, der er for kort (f.eks. gennemsnit under 18 bp) eller indarbejdelse af for mange tomme gRNA udtryk vektorer vil gøre biblioteket ubrugelig. Det er således vigtigt at optimere MNase fordøjelse trin (figur 2A), til at overvåge excision (figur 2B, C), check for komplet foraskning af gRNA vektor rygraden og herunder ingen fragment kontrol i hele protokollen. Særlig omhu har også at bevare repræsentation af gRNA bibliotek. Én fælles flaskehals i biblioteket generation er generelt effektiv overførsel af plasmider til bakterier til forstærkning. Således er store mængder af bakterier med fremragende kompetence og et stort antal individuelle elektroporation begivenheder nødvendige for at opnå et højt antal gRNA kloner.

Nye strategier for gRNA bibliotek produktion vil være nødvendigt at høste det fulde potentiale af CRISPR-baseret screening tilgang i de næste årtier. Der er en betydelig efterspørgsel efter omkostningseffektive, simple og tilpasselig metoder til at generere store biblioteker, en forudsætning at gøre screening imødekommenhed over for et større antal modelsystemer og forskellige CRISPR-baserede engineering tilgange. CORALINA giver et første skridt mod dette. De potentielle anvendelser er mangfoldige, især til at producere omfattende biblioteker af genomer, cDNA afledt biblioteker af mindre almindelige modelsystemer, stærkt koncentreret biblioteker og eksperimenterende set-ups i hvilke forskellige CRISPR proteiner (med forskellige PAM krav) anvendes i kombination.

I modsætning til andre metoder genererer CORALINA alle mulige gRNAs fra input DNA. En ulempe ved metoden er imidlertid at gRNAs mangler de krævede PAM sekvens indgår også i biblioteket, en funktion, som den deler med en anden enzymatisk metode for gRNA bibliotek generation, CRISPR-spiser (tabel 1). Valg af den ideelle metode for gRNA bibliotek generation afhænger specifikationerne af den planlagte screening eksperimentere, især arten (genic, lovgivningsmæssige, intergenic) og størrelse af målområde (enkelt locus, flere regioner, genome-wide). Vi ser en særlig opadrettede i hjælp CORALINA når et stort antal ikke-kodende eller lovgivningsmæssige områder er der skal analyseres, hvis der er ufuldstændige eller upålidelige sekvens oplysninger (eksotiske modelsystemer, blandinger af arter (f.eks. microbiomes) eller eksperimentelt indhentet input), hvis forskellige CRISPR endonucleases er kombineret eller hvis mætte analyse er udført på en kort og afgrænset locus (f.eks. repræsenteret ved BACs).

Disclosures

Forfatterne har ikke noget at oplyse.

Acknowledgments

Forfatterne vil gerne takke Prof. Dr. Stephan Beck og Prof. Dr. Magdalena Goetz for deres input, hjælp og støtte i udviklingen af CORALINA metoden, Maximilian Wiessbeck og Valentin Baumann til nyttige kommentarer. Arbejdet er blevet støttet af DFG (STR 1385/1-1).

Materials

Name Company Catalog Number Comments
500 mM EGTA Sigma Aldrich 03777-10G 1.4., Inactivation of Mnase
Novex Hi-Density TBE Sample Buffer Thermo Fisher Scientific LC6678 2.1.
Novex® TBE Gels, 20%, 10 well Thermo Fisher Scientific EC6315BOX 2.1., pre-made 20 % PAGE gel
O'RangeRuler 5 bp DNA Ladder, Thermo Fisher Scientific SM1303 2.1.
Novex® TBE Running Buffer Thermo Fisher Scientific LC6675 2.1., PAGE gel running buffer
Disposable scalpel, sterile VWR  233-5363  2.3., other equivalent reagents may be used
SYBR Green I nucleic acid stain (1000x concentrate in DMSO) Sigma Aldrich
S9430
2.3. +2.5., also available from Thermo Fisher Scientific (S7563)
UltraPure Phenol:Chloroform:Isoamyl Alcohol (25:24:1) Thermo Fisher Scientific 15593-031 3.6.1. + 4.3., other equivalent reagents may be used
Glycogen Sigma 10901393001 3.6.4., other equivalent reagents may be used
3M Sodium acetate , pH5.2 Thermo Fisher Scientific   R1181 3.6.4., other equivalent reagents may be used
Ethanol  3.6.4. + 9.1.8., molecular biology grade
Quick blunting kit  New England Biolabs E1201 4.1.
ammomium acetate Sigma
A1542
3.1., other equivalent reagents may be used
magnesium acetate Sigma
M5661
3.1., other equivalent reagents may be used
0.5 M EDTA (pH 8.0) VWR   MOLEM37465520 (or Promega V4231) 2.2. + 3.1., other equivalent reagents may be used
Agencourt AMPure XP beads Beckman coulter A63881 5.3. + 6.5.
Gel extraction kit QIAGEN 28704 5.7.+ 7.1. +8.4., other equivalent reagents may be used
concentrated T4 DNA ligase New England Biolabs  M0202T 6.1.+ 8.1.2.
Long Amp Taq 2X Master Mix  New England Biolabs M0287S 6.3.
Phusion High-Fidelity PCR Master Mix with HF Buffer New England Biolabs M0531S 5.1. + 6.6., other equivalent reagents may be used
HindIII New England Biolabs R0104S 5.4.1. 
SacII New England Biolabs R0157S 5.4.2.
AgeI New England Biolabs R0552S 8.2.1.
Tris base Sigma 93362 8.1.1.
2M MgCl Sigma 93362 8.1.1.
dGTP,dATP, dCTP, dTTP New England Biolabs N0446S 8.1.1.
DTT Sigam
DTT-RO
8.1.1.
PEG-8000  Sigma
P5413
8.1.1.
NAD Sigma
N6522
8.1.1.
T5 exonuclease New England Biolabs M0363S 8.1.2.
Phusion DNA polymerase  New England Biolabs M0530S 8.1.2.
Taq DNA ligase New England Biolabs M0208L 8.1.2.
rSAP New England Biolabs M0371S 8.3.1.
TG1 competent cells Lucigen 60502-1 9.1.
1mm gap electroporation cuvettes  VWR 732-2267  10.2.
Bio-Assay Dish (Polystyrene, 245 mm x 245 mm x 25 mm) Fisher Scientific DIS-988-010M  9.4.
NaCl Sigma S7653  9.3.
Bacto-tryptone BD 211705 9.3.
Yeast extract BD 212750 9.3.
Agar Sigma
A1296
9.4.
Glycerol Sigma
G5516
9.17.
MNAse New England Biolabs M0247S 1.1.
Nanodrop Thermo Fisher Scientific ND-2000 throughout
Micropulser Biorad 165-2100 10.2.
Electroporation cuvettes Biorad 732-2267  10.2.
250 ml centrifuge tubes Corning 430776 9.1-9.9.

DOWNLOAD MATERIALS LIST

References

  1. Mali, P., Esvelt, K. M., Church, G. M. Cas9 as a versatile tool for engineering biology. Nat Methods. 10, (10), 957-963 (2013).
  2. Yang, H., et al. One-step generation of mice carrying reporter and conditional alleles by CRISPR/Cas-mediated genome engineering. Cell. 154, (6), 1370-1379 (2013).
  3. Stricker, S. H., Koferle, A., Beck, S. From profiles to function in epigenomics. Nat Rev Genet. 18, (1), 51-66 (2017).
  4. Dominguez, A. A., Lim, W. A., Qi, L. S. Beyond editing: repurposing CRISPR-Cas9 for precision genome regulation and interrogation. Nat Rev Mol Cell Biol. 17, (1), 5-15 (2016).
  5. Shalem, O., et al. Genome-scale CRISPR-Cas9 knockout screening in human cells. Science. 343, (6166), 84-87 (2014).
  6. Wang, T., Wei, J. J., Sabatini, D. M., Lander, E. S. Genetic screens in human cells using the CRISPR-Cas9 system. Science. 343, (6166), 80-84 (2014).
  7. Koike-Yusa, H., Li, Y., Tan, E. P., Velasco-Herrera Mdel, C., Yusa, K. Genome-wide recessive genetic screening in mammalian cells with a lentiviral CRISPR-guide RNA library. Nat Biotechnol. 32, (3), 267-273 (2014).
  8. Hart, T., et al. High-Resolution CRISPR Screens Reveal Fitness Genes and Genotype-Specific Cancer Liabilities. Cell. 163, (6), 1515-1526 (2015).
  9. Koferle, A., et al. CORALINA: a universal method for the generation of gRNA libraries for CRISPR-based screening. BMC Genomics. 17, (1), 917-940 (2016).
  10. Lane, A. B., et al. Enzymatically Generated CRISPR Libraries for Genome Labeling and Screening. Dev Cell. 34, (3), 373-378 (2015).
  11. Sambrook, J., Russell, D. W. Isolation of DNA fragments from polyacrylamide gels by the crush and soak method. CSH Protoc. (1), (2006).
  12. Gibson, D. G. Enzymatic assembly of overlapping DNA fragments. Methods Enzymol. 498, 349-361 (2011).
  13. Elsaesser, R., Paysan, J. Liquid gel amplification of complex plasmid libraries. Biotechniques. 37, (2), 200-202 (2004).
En universel protokol for storstilet gRNA bibliotek produktion fra enhver kilde, DNA
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Köferle, A., Stricker, S. H. A Universal Protocol for Large-scale gRNA Library Production from any DNA Source. J. Vis. Exp. (130), e56264, doi:10.3791/56264 (2017).More

Köferle, A., Stricker, S. H. A Universal Protocol for Large-scale gRNA Library Production from any DNA Source. J. Vis. Exp. (130), e56264, doi:10.3791/56264 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter