Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

대규모 gRNA DNA 소스에서 라이브러리 제작에 대 한 범용 프로토콜

doi: 10.3791/56264 Published: December 6, 2017

Summary

간단 하 고 효율적인 비용 효율적인 대규모 gRNA 라이브러리를 생성 하기 위한 방법 이어야 한다. 우리는 표적 DNA의 효소 소화에 따라 gRNA 라이브러리의 생산에 대 한 프로토콜을 설명 합니다. 이 메서드를 CORALINA (제어 nuclease 활동을 통해 포괄적인 gRNA 라이브러리 세대) 비용이 많이 드는 사용자 지정 oligonucleotide 종합에 대안을 선물 한다.

Abstract

게놈과 epigenome 엔지니어링에 대 한 CRISPR/Cas9 시스템의 인기는 그것의 간명 및 적응성에서 유래한 다. (Cas9 nuclease 또는 nuclease 죽은 dCas9 융합 단백질)는 이펙터 가이드 RNA, 또는 gRNA로 알려진 작은 합성 RNA 게놈에 있는 특정 사이트에 대상 이다. CRISPR 시스템의이 분 자연 플라스 미드 라이브러리 포함 식 카세트 개별 gRNAs의 수천의 단일 실험에서 많은 다른 사이트가 사용할 수 있습니다 이후 접근 차단에 그것의 사용을 수 있습니다.

날짜 하려면, 라이브러리의 건설에 대 한 gRNA 시퀀스는 oligonucleotide 종합 라이브러리에서 시퀀스의 달성 복잡성을 제한 하 고 상대적으로 비용 많이 사용에 의해 거의 독점적으로 생성 된 것. 여기, CORALINA (제어 nuclease 활동을 통해 포괄적인 gRNA 라이브러리 세대)에 대 한 상세한 프로토콜 간단 하 고 매우 복잡 한 gRNA 라이브러리의 생성에 대 한 비용 효율적인 방법을 입력 DNA의 효소 소화에 기반, 설명. DNA의 모든 소스에서 CORALINA 라이브러리를 생성할 수 있습니다, 이후 사용자 지정에 대 한 옵션을 많이 존재, CRISPR 기반 스크린의 큰 다양성을 사용 한다.

Introduction

분자 타겟팅 도구 세균 CRISPR/Cas9 시스템의 적응 분자 생물학에 있는 가장 최근의 혁명을 발생합니다. 그것은 결코 전에 너무 쉽게 정의 된 genomic 위치에서 chromatin 조작 되었습니다. CRISPR의 일반적인 응용 프로그램에는 타겟된 유전자 돌연변이1, 게놈 엔지니어링2,3, transcriptional 활성화 및 유전자 침묵4편집 epigenome 포함 됩니다. 하나의 특정 CRISPR 시스템의 장점은 응용 프로그램 잘 공부 후보 사이트에 국한 되지 않습니다 gRNA 라이브러리 덜 편향된 스크린을 가능 하 게로. 이러한 사전 실험 지식 없이도 게놈에서 기능 loci의 발견을 촉진 한다. 그러나, gRNA 도서관 건설 현재 주로 기반으로 올리고 뉴클레오티드 종합과 인간의 하지 않은 gRNA 라이브러리를 구매 제한 옵션은 열거나 외부 원본 또는 대상 영역을 마우스 프레임을 읽고. 따라서, 비록 CRISPR 화면이 이미 엄청나게 강력한5,6,7,8, 입증 된 그들의 풍부한 잠재력은 하지 아직 되었습니다 악용.

극복 하기 위해 클래식 gRNA 세대 방법 두 가지 전략의 한계 최근에 개발 되었습니다. 둘 다 사용자 지정 oligonucleotide 합성에 의존 하는 것 보다는 표적 DNA의 효소 소화를 제어 기반으로 합니다. 제한 효소의 사용 CORALINA9 micrococcal nuclease만 현재 사용할 수 있는 다른 방법을 CRISPR 먹고10, 사용 하는 동안 (Hpa2 세, ScrFI, Bfa Mme와 나 나). 중요 한 것은, 두 기술은 어떤 입력된 DNA gRNA protospacer 시퀀스의 소스 역할에 적용할 수 있습니다. CRISPR 먹는 방법 누구의 대상 사이트는 필요한 S.pyogenes 팸 (protospacer 인접 한 동기)에 의해 준수 하지 복제 gRNAs의 수를 줄일 수 있도록 전략 고용, 하는 동안 그것에 대 한 모든 가능한 기능 gRNAs의 극히 일부에 생성 한 지정 된 지역입니다. CORALINA, 다른 한편으로, 소스 시퀀스에 대 한 모든 잠재적인 gRNAs를 생성할 수 하 그러나 또한 비 기능 가이드의 더 높은 부분을 통합 한다. gRNA 라이브러리 생성 제어 nuclease 활동을 통해 어떤 종족에 대 한 포괄적인 gRNA 라이브러리의 생산 수 있습니다 간단 하 고 비용 효율적인 방식으로 어떤 Cas9 단백질 또는-이펙터 시스템. 또한, CORALINA은 라이브러리 유형, 크기 및 콘텐츠를 정의 하는 적절 한 입력 및 벡터 선택 사용자 지정에. 여기, 상세한 프로토콜을 제시 세균 인공 염색체 (BACs) 또는 genomic DNA9를 포함 하 여 DNA (그림 1)의 다양 한 소스 로부터 포괄적인 gRNA 라이브러리의 생성에 사용할 수 있습니다. 이 프로토콜을 동반 하는 대표적인 결과 BAC dna CORALINA 프로토콜을 적용 하 여 파생 되었다.

Protocol

1입니다. Micrococcal Nuclease와 DNA의 소화

  1. Micrococcal nuclease 효소 (MNase)의 각 새로운 배치에 대 한 반응을 최적화를 수행 합니다.
    참고: 사용 하는 MNase의 단위 수 시험 되어야 한다 (를 사용 하 여 직렬 희석, 그림 2A). 일반적으로, U의 MNase 소화 1 µ g의 5-10 정화 게놈 또는 BAC DNA 조건 5-100 bp의 범위까지 아래에 설명 된.
  2. 반응 당 1 µ L MNase 버퍼 x 10, 소 혈 청 알 부 민 (BSA), 표적 DNA, MNase의 1 µ L의 1 µ g x 1의 설정 (0.1-50 단위) 10 µ L 반응 볼륨에서.
  3. 15 분 동안 37 ° C에서 품 어.
  4. 즉시 500 m m의 에틸렌 글리콜-bis(β-aminoethyl ether)-N, N, N 1 µ L을 추가 하 여 효소를 비활성화 ', N'-tetraacetic 산 (EGTA).

2. DNA의 분리 조각 Polyacrylamide 젤 전기 이동 법 (페이지)를 사용 하 여

  1. 샘플 버퍼/젤 염료 DNA 샘플을 로드를 추가 하 고 페이지 젤 20%에 로드. 크기 조정에 대 한 적절 한 DNA 사다리를 로드 (5 bp DNA 사다리). 젤 (1 µ g의 DNA 잘 당)를 오버 로드 하지 마십시오.
  2. 1.5 h의 주위에 또는 낮은 염료 앞 (bromophenol 파란색, 진한 파란색) 약 15 여행까지 혈압, 젤의 낮은 끝에 도달에 대 한 적절 한 1 x 트리 스-Borate-EDTA (TBE) 실행 버퍼 150 V (상수)에 젤을 실행 합니다.
  3. 젤 울트라 민감한 핵 산 얼룩을 사용 하 여 얼룩 하 고 자외선에서 시각화.
  4. 젤 이미지에서 크기에서 20-30 bp까지 소화 DNA에 대 한 MNase의 최적 농도 결정 합니다.
  5. MNase의 최적화 된 농도 사용 하 여 단계 1.2-2.2를 반복 하 여 대상 DNA를 소화. 일반적으로, 10-12 반응 (즉, 10-12 총 시작 물자의 µ g) 충분히 얻을 것 이다 설정 이후 단계를 진행 하려면 다음 페이지 젤 추출 DNA 소화.
  6. 살 균 메스를 사용 하 여 마커 레인 옆 젤 고 1 X는 매우 민감한 핵 산 얼룩의 신선한 1 x TBE 실행 버퍼와 사다리를 포함 하는 젤의 일부만 얼룩. DNA 사다리를 시각화 하 고 면도날을 사용 하 여 약 18-30 bp 사이 크기 범위에서 MNase 소화 DNA 파편을 삭제할.
    참고: 소화 MNase 조각 자외선에 노출 하지 마십시오. 그것은 (UV) 대신 청색 광원을 사용 하거나 자외선 아래 사다리의 이미지, 확장 하 고 MNase 소화 DNA 파편의 절단 가이드를 이것을 사용 하 여 인쇄 가능). 이 단계는 얼룩이 지 고 자외선에 DNA 파편의 노출 방지합니다. 오염을 방지 하는 사용 하지 않는, 살 균 일회용 메스 또는 면도칼 블레이드가이 단계에 대 한 항상 사용 합니다.
  7. Microcentrifuge 관 젤 슬라이스를 전송 합니다.
  8. 젤의 나머지 이상으로 핵 산 얼룩과 얼룩, 자외선에 노출 하 고 젤 절단 단계의 기록을 유지 하는 이미지를 기록 합니다.

3. 호감 담가 메서드를 사용 하 여 페이지 젤에서 DNA 파편의 격리

참고:이 단계에서 Sambrook 그 외 여러분 채택 되었습니다. 11

  1. 준비 페이지 젤 가용 화 버퍼 (1.88 mL 4 M 염화 아세테이트, 1 M 마그네슘 아세테이트의 150 µ L, 0.5 M ethylenediaminetetraacetic 산 (EDTA) (pH 8) 초순 H2O 15 mL의 전체 볼륨의 30 µ L).
  2. 살 균 피 펫 팁을 사용 하 여 마이크로 원심 튜브의 벽에 삭제 젤 슬라이스를 짝사랑.
  3. 추가 2 페이지 가용 화 버퍼의 볼륨 젤과 회전 하는 플랫폼에 16 h 37 ° C에서 품 어.
  4. microcentrifuge에서 최대 속도에서 1 분 샘플 원심 어떤 짓 눌린된 젤 조각 전송 하지 않도록 주의 복용 새로운 microcentrifuge 튜브는 상쾌한 전송.
  5. 0.5를 추가 볼륨 젤을 페이지 가용 화 버퍼의 작은, 소용돌이, 그리고 원심 분리 (3.4 단계)를 반복. supernatants 결합.
  6. 표준 페 놀-클로 프롬 적 출을 사용 하 여 DNA 파편을 압축을 풉니다.
    주의: 페 놀 오면 피부 접촉 또는 삼 킨 경우 독성이 있다. 장갑, 보호 안경, 연구실 코트 증기 두건에서 작업 등 안전 조치는 중요 합니다. 연구소의 규정에 따라 모든 페 놀 함유 폐기물의 처분.
    1. 샘플 및 소용돌이를 철저 하 게 한 양의 페 놀: 클로 프롬: isoamyl 알콜 (25:24:1)를 추가 합니다.
    2. 실 온에서 탁상 원심 분리기에 최대 속도 (16000 x g)에서 10 분 원심 분리기. 신중 하 게 신선한 microcentrifuge 튜브 위 수성 단계 전송. 알아서 하지 pipetting 동안 어떤 페 놀에이 월.
    3. 3.6.1 및 3.6.2 단계를 한 번 반복 합니다.
    4. 글 리 코겐, 3m 나트륨 아세테이트 (pH 5.2)의 0.1 볼륨의 소량 (0.2 µ L) 추가 및 100% 에탄올 (EtOH)의 2 권.
    5. 소용돌이 몇 시간 동안-20 ° C에서 품 어 나 밤새.
    6. 탁상 원심 분리기를 사용 하 여 4 ° C에서 최대 속도로 30 분 동안 원심 분리기.
    7. 조심 스럽게는 상쾌한을 제거 하 고 70%를 가진 DNA 펠 릿을 세척 EtOH.
    8. 탁상 원심 분리기를 사용 하 여 4 ° C에서 최대 속도로 30 분 동안 원심 분리기.
    9. 상쾌한을 제거 하 고 DNA 펠 릿 건조. 모든 EtOH 증발 했다 다는 것을 확인 하지만-펠 릿 건조 하지 않도록 주의 하십시오.
    10. H2o.의 12 µ L 펠 릿 DNA를 분해
      참고: 페이지 젤 추출 매우 효율적입니다. 시작 하는 MNase로 소화 하는 DNA의 모든 10 µ g, 순화 된 파편의 1-20 ng 젤 추출 후 복구 기대 합니다. 1/6번째 로드 하 여 금액 및 파편의 무결성을 제어 (2 µ L) 페이지 젤 (그림 2C)에.

4. MNase 소화, 젤 정화 조각의 끝 수리

  1. 키트를 blunting DNA를 사용 하 여 다음 반응 설정: 10 µ L 단계 3.6.10, 버퍼, 1mm dNTP 믹스의 1.5 µ L, 효소 blunting의 0.6 µ L, H2o.의 1.4 µ L를 blunting X 10의 1.5 µ L에서에서 순화 된 DNA의
  2. 30 분 동안 22 ° C에서 품 어 그리고 열-비활성화는 효소 10 분 동안 70 ° C에 외피에 의해.
  3. H2O의 85 µ L을 추가 하 고는 반응 정리 표준 페 놀/클로 프롬-추출 및 EtOH-강수량 (섹션 3.6에서에서와 같이)를 사용 하 여 수행 합니다. 즉시 링커 결 찰을 진행 합니다.

5. 링커 생성

참고: 링커 섹션 3 링커 결 찰 즉시 진행 수와 동시에 증폭 될 필요가 있다. 아래 사용 뇌관 순서 선택한 gRNA 식 벡터에 대 한 적절 한 해야 합니다. 여기에 제시 된 그 벡터 pgRNA-pLKO.1에 대 한 설계 되었습니다. 9 pgRNA pLKO.1에서 5' 링커의 확대를 위한 뇌관 순서 5'-링커-F (TTGGAATCACACGACCTGGA) 및 5'-링커-R (CGGTGTTTCGTCCTTTCCAC), 689 bp amplicon 저조한 사용 합니다. PgRNA-pLKO.1에서 3' 링커의 증폭에 대 한 사용 하 여 뇌관 3'-링커-f: (GTTTTAGAGCTAGAAATAGCAAGTTAAAATA) 3'-링커-r: (ACTCGGTCATGGTAAGCTCC), 848 bp amplicon 따르.

  1. PCR 증폭 어댑터 (필요한 경우 선택 및 사용자 지정 뇌관 시퀀스의 시 약을 사용) gRNA 식에서에서 시퀀스. PgRNA-pLKO.1 다음 50 µ L PCR 반응 설정에 대 한: PCR 마스터 믹스의 25 µ L, 뇌관 F의 2.5 µ L (10 µ M), 뇌관 R의 2.5 µ L (10 µ M), 0.1 H2o.에에서 gRNA 식 벡터 (pgRNA-pLKO.1)의 ng
  2. 품 어 thermocycler 다음과 같은 조건에 반응: 1 주기 30 98 ° C s, 32 주기 98 ° C 10에 대 한 s, 59 ° C 10에 대 한 s, 72 ° C 30 s, 1 주기 72 ° C 10 분.
  3. 제조업체의 지침에 따라 단단한 단계의 가역 immobilization 비즈를 사용 하 여 PCR 반응 정화. H2o.의 30 µ L에 elute
  4. 최종 수리, MNase 소화 DNA 파편에 링커, (여기 뒷 다리III 및 SacII) 적절 한 제한 효소로 다이제스트 링커의 방향 결 찰을 시행 합니다. 다음 반응을 설정 합니다.
    1. 5' 뒷 다리III와 링커의 소화, 사용 단계 5.3에서에서 순화 된 5' 링커 amplicon의 30 µ L. 5, 버퍼, 뒷 다리(20U / µ L), III의 3 µ L 및 H2o.의 12 µ L의 µ L
    2. 3' SacII와 링커의 소화, 사용 단계 5.3에서에서 정화 3' 링커 amplicon의 30 µ L. 5, 버퍼, SacII의 3 µ L의 µ L (20 U / µ L), 및 12 µ L H2o.
  5. 3 h 37 ° C에서 다이제스트를 품 어.
  6. DNA 젤 로드 염료를 추가 하 고 1 %agarose 젤에 금지 효소 소화를 실행. 637에서 밴드를 삭제할 bp (5' 링커 다이제스트) 및 295 bp (3' 링커 다이제스트).
  7. 젤 추출 키트를 사용 하 여 삭제 젤 조각에서 DNA를 정화.

6. 링커 결 찰 및 삽입의 증폭

  1. 14 µ L 결 찰 반응 아데닌 양의 MNase 소화, 최종 수리 조각과 링커 시퀀스를 사용 하 여 설정 합니다.
    참고: 링커 조각 비율에 최적화 될 수 있습니다. 없는 조각 제어 (NFC) 반응을 포함 하는 것이 좋습니다.
    1. MNase 소화 조각 (최종 수리 하 고 정화), 120의 사용 5 ng ng 5' 링커 (뒷 다리III 다이제스트, 정화)의 55 ng 3' 링커 (SacII 다이제스트, 정화), T4 리가 버퍼의 1.4 µ L 및 H2o. 집중된 T4 DNA 리가의 1.4 µ L의
  2. 결 찰 반응 16 h 16 ° C에서 품 어. 할 하지 열 비활성화는 효소. 즉시 닉 번역을 진행 합니다.
    참고: 최종 수리 MNase 소화 조각 제공 5' 인산 염 필요한 링커의 결 찰, 링커로 스스로 하지 않습니다 취소 osphorylated.
  3. 결 찰 반응 (와 NFC 반응) 추가 다음: 마스터 믹스 (닉 번역 가능) X Taq 2의 25 µ L, 뇌관 링커-Minus450-F의 2.5 µ L (10 µ M, GGGCAAGTTTGTGGAATTGG), 뇌관 링커-Plus275-R의 2.5 µ L (10 µ M, AAGTGGATCTCTGCTGTCCC)와 6 µ L의 H2o.
  4. No-템플릿 컨트롤 (NTC)를 포함 합니다. Thermocycler 다음과 같은 조건에 반응을 품 어: 1 주기 (닉 번역): 20 분, 1 개 주기를 위한 72 ° C: 95 ° C 5 분, 3-4 사이클에 대 한: 95 ° C 15에 대 한 s, 58 ° C 15에 대 한 s, 72 ° C 30 s, 1 주기: 5 분 동안 72 ° C.
  5. 반응 정리 단단한 단계의 가역 immobilization 구슬 구슬 비율 1: 1의 샘플 사용 하 여 수행 합니다. H2o.의 40 µ L에 elute
  6. 원하는 조각 증폭 (5' 링커 + MNase + 3 조각 ' 링커) 적절 한 PCR 시 약 및 다음 프라이 머를 사용 하 여:
    1. PCR 마스터 믹스의 12.5 µ L, 뇌관 링커-Minus450-F의 1.25 µ L를 사용 하 여 (10 µ M, GGGCAAGTTTGTGGAATTGG), 뇌관 링커-Plus275-R의 1.25 µ L (10 µ M, AAGTGGATCTCTGCTGTCCC), 단계 6.4에서에서 순화 된 닉 번역 제품의 2.5 µ L. 7.5 µ L H2o.의 사용 다음 조건: 1 주기: 98 ° C 30에 대 한 s, 10-16 주기: 98 ° C 10 s, 63 ° C 10 s, 15 72 ° C s, 1 주기: 10 분 동안 72 ° C.
      참고: 필요한 경우, 여러 가지 반응은 설정할 수 있습니다 병렬로 후속 단계에 대 한 충분 한 PCR 제품 확인 하. Agarose 젤에 PCR 제품의 소량을 시각화 하려면 단계 6.5에서 추가 반응 고 32 15에서 주기 수를 증가 합니다. 이 반응은 amplicons 15 주기 후 표시 되지 않는 경우 품질 관리로 사용할 수 있습니다. 또한 아무 템플릿 컨트롤 (NTC)를 포함 합니다.

7. 크기 선택

참고:이 단계 두 조각에서 제대로 연결 된 5'과 3' 링커 MNase 조각 분리 5' 또는 3' 링커 두 크기에 따라.

  1. 모든 15 주기 PCR 반응 단계 6.5에서에서 결합., 염료를 로드 하는 DNA를 추가 하 고 0.8 %agarose 젤에서 실행. 869에서 눈에 띄는 밴드 삭제할 혈압 젤 추출 키트를 사용 하 여 DNA를 정화.
  2. (예: 한 분 광 광도 계를 사용 하 여) DNA의 양을 계량.

8. 복제 식 벡터 깁슨 어셈블리에서 gRNA에 PCR 증폭 조각의

  1. 어셈블리를 준비 같이 믹스 마스터:
    참고: 다음 단계는 깁슨 외. 에서 적응 12.
    1. 1 M Tris (hydroxymethyl) aminomethane (Tris)의 3 mL을 결합 하 여 6 mL 등온 반응 버퍼를 만들-HCl pH 7.5, 1 M MgCl, 100 mM deoxyguanosine 3 인산 염 (dGTP)의 60 µ L, 100 mM deoxyadenosine 3 인산 염 (dATP)의 60 µ L, 100 mM deoxythymidine의 60 µ L의 300 µ L 3 인산 염 (dTTP), 100 mM deoxycytidine 3 인산 염 (dCTP), 1 M dithiothreitol (DTT), 폴 리 에틸렌 글리콜 (PEG)-8000, 100 mM 니코틴아미드 아데닌 디뉴클레오티드 (NAD) 초순 H2o.의 300 µ L의 1.5 g의 300 µ L의 60 µ L
      참고:이 버퍼 aliquoted 및-20 ° c.에 저장 될 수 있습니다.
    2. 등온 반응 버퍼 X 5의 320 µ L, 3 µ L 10 U / µ L T5 exonuclease, 2 U / µ L DNA 중 합 효소, 초순 H2o. 사용 15 µ L 어셈블리 마스터 믹스의 5 µ L로에서 40 U / µ L DNA 리가의 160 µ L의 20 µ L의 결합 하 여 1.2 mL 어셈블리 마스터 믹스 만들기 삽입 합니다.
      참고: 어셈블리 마스터 믹스 어디 그것은 1 년 이상에 대 한 안정적인 aliquoted 및-20 ° C에서 저장 될 수 있으며 여러 freeze-thaw 주기를 용납 수 있습니다. T5 exonuclease의 선택한 금액 긴 오버행 사용 하기 위해 이상적입니다.
  2. 벡터 백본 소화
    참고: 어셈블리 반응 단계 8.3에서에서 원하는 수에 대 한 입력으로 충분 한 양의 벡터를 소화 해야 합니다.
    1. 반응, 당에 다음을 추가: gRNA 식 벡터 (pgRNA-pLKO.1), 버퍼의 5 µ L, 나이의 1.5 µ L의 1.5 µ g 2 h 37 ° C에서 소화 하는 나 (5U / µ L), 및 H2o. 품 38.5 µ L.
  3. 선형화 벡터의 dephosphorylation입니다.
    참고:이 단계는 권고, 하지만 엄격 하 게 필요 하지 않습니다. T5 exonuclease 마스터 믹스에 주로 나이제거할 것 이다 내가 overhangs Taq DNA 리가 행동 전에. 따라서, 벡터의 과도 한 다시 결 찰은 예상 되지 않음.
    1. 새우 알칼리 성 인산 가수분해 효소 효소 (rSAP, 1 U / µ L)의 2.5 µ L를 추가 합니다.
    2. 30 분 동안 37 ° C에서 품 어 하 고 5 분 동안 65 ° C에서 배양 하 여 효소 비활성화.
  4. DNA 정제를 수행
    참고: 그것은 agarose 젤 추출 단계를 수행 하 고 좋습니다. 또는, 열-또는 정화를 사용할 수 있습니다. 그것은 벡터 소화 agarose 젤 전기 이동 법에 의해 예를 들어 완전 한지 확인 해야 합니다. 비교를 위해, 소화 되지 않은 벡터를 병렬로 실행 해야 합니다.
  5. 샘플에서 순화 된 소화 벡터의 양을 계량.
  6. 벡터에 삽입의 2-fold 어 금 니 과잉을 가진 어셈블리를 설정 합니다. 20 µ L 반응 사용 100 ng 벡터 (연령단계 8.5에서에서 소화)의 당 12.2의 ng (에서 단계 7.1.), 15 µ L 단계 8.1.2에서에서 어셈블리 마스터 믹스의 삽입. H2o.
  7. 1 시간에 50 ° C에서 품 어.
  8. 정화 열 정화를 사용 하 여 반응. H2O의 75 µ L에서 DNA를 resuspend (또는 볼륨 electroporation의 규모에 따라 적절 한).
    참고: 변환 효율은 DNA 순도에 크게 의존. 추가 정화 단계 (예: 페 놀/클로 프롬 적 출) 효율성을 향상 시킬 수 있습니다.

9. 전기 유능한 TG1 대장균 세포의 준비

  1. 모든 원심 병 플라스 크에서에서 자유롭다 세제 헹 구 고 압력가 마로 소독 하기 전에 증류수와 후속 작성 하 여 확인 합니다.
    참고:이 단계는 변환 효율에 영향을 미칠 수 있는 모든 불순물을 제거에 도움이 됩니다. 물 사용 하기 전에 즉시 폐기 해야한다. 또는, 일회용 원심 병의 사용은 권장 수 있습니다.
  2. 원심 분리기 병, 튜브 및 electrocompetent 세포의 준비를 위해 사용 되는 솔루션 사용 하기 전에 얼음에 차게 됩니다 확인 하십시오. 이 변환 효율에 영향을 미칠 수 있는 온도 동요를 최소화 하기 위해 차가운 방에 다음 단계를 수행 하는 좋습니다.
  3. 2TY 매체를 준비 합니다. Bacto tryptone의 16 g, 효 모 추출 물의 10 g 및 5 g의 NaCl, 1 L, 믹스, 압력솥을 증류수를 추가합니다. 실 온에서 저장소 매체입니다.
  4. 2TY agar 코팅 생물 요리와 적절 한 항생제를 포함 하는 10 cm 배양 접시를 준비 합니다. 4 ° c.에 접시를 저장
    참고: 항생제의 선택 gRNA 표정 벡터, pgRNA-pLKO.1에 대 한 사용 100 µ g/mL 암 피 실린의 성격에 따라 달라 집니다.
  5. (항생제) 없이 2TY 매체의 10 mL를 접종 하 TG1 셀의 글리세롤 재고에서 다쳤어요.
  6. 225 rpm에서 떨고 37 ° C에서 하룻밤 (~ 16 h) 문화를 품 어.
  7. 야간 문화 (1/100 희석) 10 mL와 함께 (항생제) 없이 2TY 매체의 1 L를 접종 하 고 2 개의 2 L 플라스 크 (배플을 포함 하는) 사이 동등 하 게 분할.
  8. 37 ° C, 0.55의 OD600 nm (약 1.5-2 시간) 후에 도달할 때까지 225 rpm에서 문화를 품 어. 분 광 광도 계를 사용 하 여 OD600 nm을 정기적으로 확인.
  9. 30 분 동안 얼음에 진정 문화입니다.
  10. (미리 얼음에 냉장) 4 개의 500 mL 원심 병 사이 동등 하 게 문화를 분할.
  11. 미리 냉장된 원심 분리기에서 4 ° C에서 4000 x g에서 15 분 동안 원심 분리기.
  12. Supernatants 가만히 따르다와 원심 병의 각 미리 냉장된 차가운 멸 균 증류수 H2O의 1 볼륨 (예: 250 mL)을 추가 합니다. Resuspend 세균 펠 릿 소용돌이 또는 병을 반전 하 여 (또는 부드러운 pipetting, 필요한 경우).
    참고: 그것은 먼저 물 한 작은 볼륨을 추가 하 여 펠 릿 resuspend 쉽습니다. 펠 릿은 결국 resuspended 완전히 확인 합니다.
  13. 4 ° c.에 4000 x g에서 15 분 동안 원심 분리기
  14. 반복 세척 두 번 (단계 9.12. 9.13 및). 제거는 상쾌한. 세척 후 세균 펠 릿 점점 느슨한 되면서 decanting 때 주의 해야 합니다.
  15. 살 균, 얼음 10% 글리세롤의 50 mL에 펠 릿을 resuspend 하 고 사전 냉장된 50 mL 원심 분리기 튜브에 전송.
  16. 4 ° c.에 ~ 4000 x g에서 15 분 동안 원심 분리기 셀 조심 스럽게 제거는 상쾌한.
  17. 부드럽게 차가운 살 균 10% 글리세롤의 2 mL에 박테리아 resuspend.
  18. 셀 electroporation 즉시 사용 하는 경우에 얼음에 계속.
    참고: 셀 드라이 아이스 에탄올 욕조에 0.5 mL 튜브에 50 µ L의 aliquots에서 냉동 고 수-80 ° C에 저장 하지만이 권장 하지 않습니다.

10. Electroporation TG1 Electrocompetent 대장균 세포의

참고: Electroporation 포괄적인 라이브러리 생성에는 병목 현상을 중 하나입니다. 도서관 대표를 유지 하려면 것이 좋습니다 필요한/주문 많은 개별 electroporation 반응을 실시 하 고 아래 설명 하는 품질 관리 단계를 수행 (10.6. 그리고 10.8.).

  1. Aliquot 살 균과 미리 냉장 PCR에 (단계 8.8)에서 정화 반응 튜브 얼음 (관 당 1 µ L)에 그들을 유지. 얼음에 1 mm 간격 electroporation 큐 벳을 진정.
  2. DNA의 한 약 수에 직접 갓된 TG1 셀의 25 µ L을 추가 하 고 즉시 electroporation 베트로 혼합물을 전송. 영화 또는 탭 셀/DNA 조합을 보장 하기 위해 베트 (없이 어떤 덫을 놓은 공기 또는 거품) 베트 챔버의 길이 따라 배포 됩니다.
  3. 슬라이드 챔버에는 베트 하 고 적절 한 electroporation 프로그램을 시작 (예: 1 펄스 1.8의 kV (EC1)).
    참고: 시간 상수 속여야 한다 5.7 6.0 양 사이의 경우 electroporator 호 영화는 베트, 챔버에 있는 아무 공기 거품을 확인 하 고 다시 시도 하십시오.
  4. 즉시는 베트를 실내 온도 2TY 매체의 975 µ L를 추가 합니다.
  5. 전송 피 펫을 사용 하 여, 50 mL 튜브에 electroporated 박테리아를 이동 합니다. 10.2 단계에서를 반복 합니다. 그리고 한 50 mL 튜브에 하나의 라이브러리 변환 하는 모든 셀을 수집 합니다.
  6. 전체 볼륨을 문서화 합니다.
  7. 품질 관리 단계
    1. 갓 생성 된 전기 유능한 세포의 능력을 계량 하려면 정의 된 양의 포경된 플라스 미드 DNA (예: 10 세 pUC19 제어 플라스 미드)를 사용 하 여 별도 electroporation 반응을 수행 합니다. 1.5 mL microfuge 관에이 전송 합니다.
      참고: 역량 1010 콜로 니 형성 단위 (cfu) µ g DNA 당 이어야 한다. 갓된 셀 일반적으로 이것 보다 더 나은 수행합니다.
  8. 225 rpm에서 떨고 60 분 동안 37 ° C에서 변형 된 박테리아를 품 어.
  9. 품질 관리 단계:
    1. 플레이트 정의 된 적은 양의 적절 한 항생제 선택 10 cm 한 천 배지에서 라이브러리 (예: 10 10-100 배 희석의 µ L)으로 변형 하는 박테리아.
      참고: (에서 단계 10.6.) 총 문화 볼륨을 알면, 얻은 식민지 수 추정 전체 라이브러리에 대 한 식민지의 총 수를 사용할 수 있습니다. 라이브러리의 20-30 배 표현은 이상적으로 유지 되어야 합니다.
  10. 분산 2TY agar 코팅 검정 요리 적절 한 항생제 선택에 박테리아의 나머지.
    참고: 문화의 볼륨 ~ 4000 x g 10 분 (또는 보이는 펠 릿을 형성 하 고는 상쾌한 명확한 표시)에서 원심 분리 하 여 줄일 수 있습니다. 이 접시는 문화의 확산 후 건조 하는 시간을 줄일 수 있습니다. 사용 액체 문화 보다는 오히려 번호판의 개별 식민지의 불균형 성장을 최소화 한다. 13
  11. 적절 한 항생제 선택과 추가 10 cm 한 접시에 pUC19 제어 electroporation 반응의 적절 한 볼륨을 확산.
  12. 한 천 배지 하룻밤 (16h) 37 ° c.에 품 어
  13. 라이브러리 복잡성 뿐만 아니라 CFU / µ g DNA는 박테리아에 대 한 추정을 컨트롤 플레이트 (pUC19 및 컨트롤 라이브러리 격판덮개)에 얻은 식민지를 계산 합니다.

11입니다. 플라스 미드 DNA의 추출

  1. 밤새 번호판 2-타이 미디어의 10 mL를 추가 하 고 일회용 분산기를 사용 하 여 접시에서 세균 층을 긁어 50 mL 튜브에 수집. 모든 접시의 깨끗 한 때까지 몇 번을 반복 합니다.
  2. (2-3 열 필요한 바이오 분석 결과 당 접시) 플라스 미드 맥시 키트를 사용 하 여 DNA를 추출 합니다.

Representative Results

가까이는 프로토콜을 사용 하 여, CORALINA gRNA 라이브러리와 마우스 게놈 DNA9 인간과 BAC DNA (그림 1)에서 생성 된 것. GRNA 식 벡터에 클로닝을 위한 적합 한 입력된 DNA의 파편을 생성, 제어 nuclease 소화에 대 한 최적의 조건을 결정 해야 합니다. Micrococcal nuclease 소화의 최적화에 대 한 일반적인 결과 그림 2A에서 묘사 된다. 부족 한 양의 nuclease (0.1, 2, 3, 4, 4.5 또는 5 단위) 생산 필요한 크기 범위 (10-100 bp)에서 눈에 띄는 제품 및 5.5-7.5 단위는 여전히 생산 한다 너무 긴 평균에 있는 조각. 더 많은 양의 효소 (50 단위) 10 분 후 입력 DNA의 과도 한 저하를 발생할. 따라서, 중간 금액 (10 단위)를 선택 했습니다. 다이제스트 충분히 생산 이후 정화 및 (그림 2B) 복제에 대 한 조각 소화 조절 했다. 맹목적으로 크기에 의해 DNA 파편을 선택 하 여 DNA 파편의 자외선에 노출을 최소화 하는 방향에 대 한 DNA 사다리에만 의존 하는 것이 좋습니다, 그러나 젤 소화와 절단의 품질 관리에 대 한 나중 얼룩이 될 수 있다. 그림 2B 는 DNA에서 20, 30 bp 사이 조각 excised 되었습니다 페이지 젤의 대표적인 예를 보여 줍니다. 젤 정화 MNase 조각 성공적인 크기 선택 및 MNase 소화 조각 (그림 2C)의 정화를 페이지 젤 20%에 로드 된. 프로토콜에 선택의 gRNA 식 벡터에 MNase 소화 파편을 수 있도록 사용자 지정 된 링커 시퀀스의 사용와 호환 됩니다. 여기, gRNA-PLKO9 백본으로 사용 되었다. 링커는 표준 PCR를 사용 하 여 gRNA 표정 벡터에서 증폭 된다. 그림 2D 증폭된 링커 순서 없는 추가, 잘못 된 또는 없음 템플릿 amplicons의 대표적인 예를 보여 줍니다. 다음, 링커 amplicons 링커 올바른 방향에서 MNase 소화 조각에 출혈은 되도록 금지 효소로 소화 된다. 예측된 637 및 295 링커의 완전 한 소화를 나타내는 그림 2D 표시 5'과 3' 링커의 agarose 젤 뒷 다리III와 SacII 소화 전후 각각 혈압. 젤 이미지의 오른쪽 부분에는 소화 링커 파편의 절단 문서. 다음 젤 소화 링커의 추출, 프로토콜의 다음 단계는 최종 수리 MNase 소화 파편에 링커의 결 찰. 링커 시퀀스 unphosphorylated 뇌관을 사용 하 여 PCR에 의해 생성 되므로, 링커의 각자 결 찰 발생 하지 합니다. 최종 수리 MNase 소화 DNA 파편만 결 찰에 필요한 인산 염 그룹을 제공합니다. 닉 번역에 따라 결 찰 제품은 PCR에 의해 증폭 된다. 라이브러리에서 gRNA 시퀀스의 표현을 왜곡 수 있는 과도 한 PCR 증폭 바이어스를 방지 하기 위해 증폭 총에서 20 사이클 제한 됩니다. PCR, 다음 증폭 제품은 agarose 젤에 시각화 하기가 어렵습니다. 32 주기와 별도 제어 PCRs는 (하지만) 라이브러리 준비를 위해 사용 되지 않습니다 따라서 제품 검색을 수행. 이 컨트롤에서 결과 PCR 그림 2E에 표시 됩니다. 이로써 결 찰 반응을 최적화 하 고 되도록 반응 "조각 제어"에서 가끔 발생 하는 PCR 유물 없는 (NFC). 그림 2E 보여줍니다 원하는 amplicon (5' 링커 DNA 조각 + 3' 링커, 길이: 869 bp) 조각과 링커 시퀀스 간의 아데닌 (1:1) 비율을 사용 하 여 결 찰 반응의 증폭을 다음과 같은.

Figure 1
그림 1 : GRNA 라이브러리를 준비 하기 위한 일정을 제안 했다. CORALINA는 어떤 유기 체에서 다른 DNA 소스의 과다에서 포괄적인 gRNA 라이브러리의 생성에 대 한 간단 하 고 비용 효율적인 전략을 제공합니다. 프로토콜에 완료 한 작업 주 동안에 주어질 수 있다. 링커 세대 DNA 끝-수리와 병렬로 수행할 수 있습니다. Electrocompetent 박테리아의 준비 2 일 하룻밤 성장 단계를 포함 하 고 따라서 어셈블리 반응 설정 하기 전에 시작 해야 합니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 2
그림 2 : 프로토콜 중 중요 한 단계. BAC DNA의 (A) 제어 소화 수 세대의 다양 한 크기의 조각. 여기에 표시 된 MNase 소화의 최적화가입니다. 순화 된 BAC DNA의 원하는 길이 (20-30 bp) DNA 파편을 생성 하는 MNase의 10 분 10 U에 대 한 MNase의 다른 금액으로 대우 되었다. (B) 20, 30 bp polyacrylamide 젤에서 절단을 사용 하 여 사이 조각의 선택 크기. 순화 된 BAC DNA MNase 10 분의 10 U로 대우 되었다. 이미지는 절단에 다음과 같은 기록 했다. (C)의 젤 정화 조각 품질 제어. 젤-정화, 후 1/6th 순화 MNase의 조각 로드 20%에 성공적인 크기 선택 및 정화 확인 페이지 젤. 방향 복제 되도록 링커의 조립 및 금지 효소 소화에 대 한 링커 시퀀스의의 (D) 증폭 5'과 3' 링커 증폭 되었고 각각 HindIIISacII, 잘라. 아니-템플릿 컨트롤 (NTC) PCR 인공 물 및 DNA 오염에 대 한 제어를 포함 했다. 왼쪽: 분석 샘플 응용 프로그램; 오른쪽: 대리점 샘플 응용 프로그램. 이미지는 젤 절단 후 기록 되었다. 성공적인 결 찰 (E) 링커 DNA 파편을 PCR를 사용 하 여 PCR 주기 (32)의 증가 수 및 H2O (NTC)에 아무 템플릿 컨트롤을 수행 하거나 이전 닉 번역 단계에서 NTC를 사용 하 여 제어 분석 될 수 있다 으로 입력 (NTC NT)). 그것은 아무 조각 컨트롤 (NFC), 결 찰 및 있는 MNase 조각 생략 되었다 닉 번역 반응에서 증폭은을 포함 하는 것이 중요. MNase에서 조각 링커 DNA와 결합 되어 샘플 생산 예상된 amplicon만 (869 bp). 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Discussion

CORALINA는 표적 DNA의 제어 nuclease 소화에 의해 대규모 gRNA 라이브러리를 생성 하 고 결과 이중 좌초 파편의 클로닝을 대량을 사용할 수 있습니다. 통계적 추론을 많은 10 이상7 개별 gRNA 시퀀스는 이미 성공적으로 복제 된 손9에서 프로토콜을 사용 하 여 나타냅니다. CORALINA는 여러 가지 방법으로 사용자 지정할 수 있습니다. 템플릿 DNA의 대상 지역 및 생성 된 라이브러리의 최대한 복잡성을 정의합니다. 이 프로토콜을 사용 하 여, CORALINA 이전 인간에서 생성 된 도서관과 마우스 게놈 DNA9. 여기에 제시 하는 대표적인 결과 순화 된 BAC DNA에서 CORALINA 라이브러리의 묘사. 추가 사용자 지정 gRNA 식 벡터 및 링커 시퀀스의 선택에 의해 얻을 수 있습니다. 이전 작은 변이 가진 깁슨 어셈블리 링커 길이의 3 개의 다른 쌍 효율9에서 테스트 했습니다.

소화는 대량 DNA에서 그들의 근원, 인 CORALINA gRNAs의 protospacer는 일반적으로 하지 정확히 20 길이, 그러나 쇼는 길이 분포에 따라 달라 집니다 의미와 bp는 절단의 크기 뿐만 아니라 MNase 소화의 매개 변수 페이지 젤에서 만든 s. 대표 예제 그림 2BC, 19 및 27 혈압 사이의 평균 길이 가진 조각 묘사. 우리의 경험에서는, 파편의 길이 생성 된 gRNA protospacer9충실 하 게 유지 됩니다. 20 보다 짧은 조각 동안 혈압 결과 gRNAs의 높은 오프 대상 비율 때문에 피해 야 한다, 더 긴 파편은 그것 이후 다운스트림 응용 프로그램에 대 한 문제가 훨씬 적은 증명 그 gRNAs와 protospacers 45 만큼 가능성이 혈압은 여전히 기능9.

CORALINA 프로토콜의 2 개의 가장 중요 한 단계는 MNase 소화 조각과 복제 단계의 크기 선택. 너무 짧은 조각의 세대 (예: 평균 18 아래 혈압) 또는 너무 많은 빈 gRNA 식 벡터의 라이브러리를 쓸모 없는 렌더링 것 이다. 따라서, MNase 소화 단계 (그림 2A)을 최적화, 모니터링 절단 (그림 2B, C), gRNA 벡터 등뼈의 완전 한 소화를 위한 확인 하 고 프로토콜을 통해 아무 조각 컨트롤 포함 하는 것이 중요 하다. 특별 한 주의 또한 보존 gRNA 라이브러리의 표현 주의가 있다. 라이브러리 생성에의 한 일반적인 병목은 일반적 확대를 위한 박테리아에 플라스 미드의 효율적인 전송입니다. 따라서, 우수한 역량을 가진 박테리아의 다량 및 많은 수의 개별 electroporation 이벤트는 gRNA 클론의 높은 숫자를 달성 하는 데 필요한.

GRNA 라이브러리 생산을 위한 새로운 전략 다음 년간 CRISPR 기반 심사 접근의 완전 한 잠재력을 수확 하는 데 필요한 것입니다. 심사 모델 시스템 및 다른 CRISPR 기반 엔지니어링 접근의 더 큰 수를 받을 수 있도록 필수 대규모 라이브러리를 생성 하기 위해 비용 효율적인 간단 하 고 사용자 정의 방법에 대 한 상당한 수요가 있다. CORALINA는이 위한 첫 걸음을 제공 하 고 있다. 잠재적인 사용 하는 매니폴드, 게놈의 종합 라이브러리를 생성 하는 특히, cDNA 파생 덜 일반적인 모델 시스템의 라이브러리, 고도로 집중된 라이브러리와는 다른 CRISPR 단백질 (다른 팸에에서 실험적인 체제 요구 사항) 조합에 사용 됩니다.

다른 메서드와 달리 CORALINA 입력 DNA에서에서 모든 가능한 gRNAs를 생성합니다. 그러나, 하나의 방법의 단점은 gRNAs 필요한 팸 시퀀스 부족도 라이브러리, gRNA 라이브러리 세대, CRISPR 식사 (표 1)에 대 한 두 번째 효소 방법으로 공유 하는 기능에에서 포함 됩니다. 이상적인 방법의 선택 gRNA 라이브러리 생성 계획된 심사의 사양에 따라 실험, 특히 자연 (genic, 규제, intergenic) 및 대상 지역 (단일 로커 스, 여러 지역, 게놈 넓은)의 크기. 우리가 볼 때 비 코딩의 많은 CORALINA를 사용 하 여 특별 한 거꾸로 또는 규제 지역 분석, 불완전 한 또는 신뢰할 수 없는 정보 라면 (이국적인 모델 시스템, 종 (예: microbiomes)의 혼합물 또는 실험적 입력 받음), 다른 CRISPR endonucleases 결합 또는 짧고 정의 된 장소 (예: BACs로 표현)에 수행 분석을 흠뻑 젖 게.

Disclosures

저자는 공개 없다.

Acknowledgments

저자 교수 박사 스테판 벡과 교수 박사 막달레나 Goetz 그들의 입력에 대 한 감사, 도움말 및 지원에서 CORALINA 방법, 막시밀리안 Wiessbeck 도움이 의견에 대 한 발렌틴 바 우만 개발 하 고 싶습니다. 작품은 DFG (STR 1385/1-1)에 의해 지원 되었습니다.

Materials

Name Company Catalog Number Comments
500 mM EGTA Sigma Aldrich 03777-10G 1.4., Inactivation of Mnase
Novex Hi-Density TBE Sample Buffer Thermo Fisher Scientific LC6678 2.1.
Novex® TBE Gels, 20%, 10 well Thermo Fisher Scientific EC6315BOX 2.1., pre-made 20 % PAGE gel
O'RangeRuler 5 bp DNA Ladder, Thermo Fisher Scientific SM1303 2.1.
Novex® TBE Running Buffer Thermo Fisher Scientific LC6675 2.1., PAGE gel running buffer
Disposable scalpel, sterile VWR  233-5363  2.3., other equivalent reagents may be used
SYBR Green I nucleic acid stain (1000x concentrate in DMSO) Sigma Aldrich
S9430
2.3. +2.5., also available from Thermo Fisher Scientific (S7563)
UltraPure Phenol:Chloroform:Isoamyl Alcohol (25:24:1) Thermo Fisher Scientific 15593-031 3.6.1. + 4.3., other equivalent reagents may be used
Glycogen Sigma 10901393001 3.6.4., other equivalent reagents may be used
3M Sodium acetate , pH5.2 Thermo Fisher Scientific   R1181 3.6.4., other equivalent reagents may be used
Ethanol  3.6.4. + 9.1.8., molecular biology grade
Quick blunting kit  New England Biolabs E1201 4.1.
ammomium acetate Sigma
A1542
3.1., other equivalent reagents may be used
magnesium acetate Sigma
M5661
3.1., other equivalent reagents may be used
0.5 M EDTA (pH 8.0) VWR   MOLEM37465520 (or Promega V4231) 2.2. + 3.1., other equivalent reagents may be used
Agencourt AMPure XP beads Beckman coulter A63881 5.3. + 6.5.
Gel extraction kit QIAGEN 28704 5.7.+ 7.1. +8.4., other equivalent reagents may be used
concentrated T4 DNA ligase New England Biolabs  M0202T 6.1.+ 8.1.2.
Long Amp Taq 2X Master Mix  New England Biolabs M0287S 6.3.
Phusion High-Fidelity PCR Master Mix with HF Buffer New England Biolabs M0531S 5.1. + 6.6., other equivalent reagents may be used
HindIII New England Biolabs R0104S 5.4.1. 
SacII New England Biolabs R0157S 5.4.2.
AgeI New England Biolabs R0552S 8.2.1.
Tris base Sigma 93362 8.1.1.
2M MgCl Sigma 93362 8.1.1.
dGTP,dATP, dCTP, dTTP New England Biolabs N0446S 8.1.1.
DTT Sigam
DTT-RO
8.1.1.
PEG-8000  Sigma
P5413
8.1.1.
NAD Sigma
N6522
8.1.1.
T5 exonuclease New England Biolabs M0363S 8.1.2.
Phusion DNA polymerase  New England Biolabs M0530S 8.1.2.
Taq DNA ligase New England Biolabs M0208L 8.1.2.
rSAP New England Biolabs M0371S 8.3.1.
TG1 competent cells Lucigen 60502-1 9.1.
1mm gap electroporation cuvettes  VWR 732-2267  10.2.
Bio-Assay Dish (Polystyrene, 245 mm x 245 mm x 25 mm) Fisher Scientific DIS-988-010M  9.4.
NaCl Sigma S7653  9.3.
Bacto-tryptone BD 211705 9.3.
Yeast extract BD 212750 9.3.
Agar Sigma
A1296
9.4.
Glycerol Sigma
G5516
9.17.
MNAse New England Biolabs M0247S 1.1.
Nanodrop Thermo Fisher Scientific ND-2000 throughout
Micropulser Biorad 165-2100 10.2.
Electroporation cuvettes Biorad 732-2267  10.2.
250 ml centrifuge tubes Corning 430776 9.1-9.9.

DOWNLOAD MATERIALS LIST

References

  1. Mali, P., Esvelt, K. M., Church, G. M. Cas9 as a versatile tool for engineering biology. Nat Methods. 10, (10), 957-963 (2013).
  2. Yang, H., et al. One-step generation of mice carrying reporter and conditional alleles by CRISPR/Cas-mediated genome engineering. Cell. 154, (6), 1370-1379 (2013).
  3. Stricker, S. H., Koferle, A., Beck, S. From profiles to function in epigenomics. Nat Rev Genet. 18, (1), 51-66 (2017).
  4. Dominguez, A. A., Lim, W. A., Qi, L. S. Beyond editing: repurposing CRISPR-Cas9 for precision genome regulation and interrogation. Nat Rev Mol Cell Biol. 17, (1), 5-15 (2016).
  5. Shalem, O., et al. Genome-scale CRISPR-Cas9 knockout screening in human cells. Science. 343, (6166), 84-87 (2014).
  6. Wang, T., Wei, J. J., Sabatini, D. M., Lander, E. S. Genetic screens in human cells using the CRISPR-Cas9 system. Science. 343, (6166), 80-84 (2014).
  7. Koike-Yusa, H., Li, Y., Tan, E. P., Velasco-Herrera Mdel, C., Yusa, K. Genome-wide recessive genetic screening in mammalian cells with a lentiviral CRISPR-guide RNA library. Nat Biotechnol. 32, (3), 267-273 (2014).
  8. Hart, T., et al. High-Resolution CRISPR Screens Reveal Fitness Genes and Genotype-Specific Cancer Liabilities. Cell. 163, (6), 1515-1526 (2015).
  9. Koferle, A., et al. CORALINA: a universal method for the generation of gRNA libraries for CRISPR-based screening. BMC Genomics. 17, (1), 917-940 (2016).
  10. Lane, A. B., et al. Enzymatically Generated CRISPR Libraries for Genome Labeling and Screening. Dev Cell. 34, (3), 373-378 (2015).
  11. Sambrook, J., Russell, D. W. Isolation of DNA fragments from polyacrylamide gels by the crush and soak method. CSH Protoc. (1), (2006).
  12. Gibson, D. G. Enzymatic assembly of overlapping DNA fragments. Methods Enzymol. 498, 349-361 (2011).
  13. Elsaesser, R., Paysan, J. Liquid gel amplification of complex plasmid libraries. Biotechniques. 37, (2), 200-202 (2004).
대규모 gRNA DNA 소스에서 라이브러리 제작에 대 한 범용 프로토콜
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Köferle, A., Stricker, S. H. A Universal Protocol for Large-scale gRNA Library Production from any DNA Source. J. Vis. Exp. (130), e56264, doi:10.3791/56264 (2017).More

Köferle, A., Stricker, S. H. A Universal Protocol for Large-scale gRNA Library Production from any DNA Source. J. Vis. Exp. (130), e56264, doi:10.3791/56264 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter