Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

En universell protokoll for store gRNA biblioteket produksjon fra en DNA-kilde

doi: 10.3791/56264 Published: December 6, 2017

Summary

Metoder for å generere storskala gRNA biblioteker bør være enkel, effektiv og kostnadseffektiv. Vi beskriver en protokoll for produksjon av gRNA biblioteker basert på enzymatisk fordøyelsen av målet DNA. Denne metoden CORALINA (omfattende gRNA biblioteket generasjon gjennom kontrollert nuclease aktivitet) presenterer et alternativ til kostbar egendefinerte oligonucleotide syntese.

Abstract

Populariteten til CRISPR/Cas9 systemet for både genomet og epigenome engineering stammer fra dens enkelhet og tilpasningsevne. En effektor (Cas9-nuclease eller en nuclease-død dCas9 fusion protein) er rettet mot et bestemt område i genomet av en liten syntetiske RNA kjent som guide RNA, eller gRNA. Bipartite natur CRISPR systemet kan bruken screening tilnærminger siden plasmider biblioteker som inneholder uttrykket kassetter av individuelle gRNAs kan brukes til å forhøre mange forskjellige områder i et enkelt eksperiment.

Hittil er gRNA sekvenser for bygging av biblioteker nesten utelukkende generert av oligonucleotide syntese, som begrenser oppnåelig kompleksiteten i sekvenser i biblioteket og er relativt kostnadskrevende. Her en detaljert protokollen for CORALINA (omfattende gRNA biblioteket generasjon gjennom kontrollert nuclease aktivitet), en enkel og kostnadseffektiv metode for generering av komplekse gRNA biblioteker basert på enzymatisk fordøyelsen av input DNA, er beskrevet. Siden CORALINA biblioteker kan genereres fra enhver kilde av DNA, finnes mange alternativer for tilpasning, aktivere et stort utvalg av CRISPR-baserte skjermer.

Introduction

Tilpasning av bakteriell CRISPR/Cas9 som molekylær målretting verktøy forårsaket siste revolusjonen i molekylærbiologi. Aldri før har det vært så lett å manipulere chromatin definert genomisk steder. Vanlige programmer av CRISPR inkluderer målrettet genet mutasjoner1, genomet engineering2, epigenome3, transcriptional aktivisering og gene stanse4. En bestemt fordel av CRISPR er at deres programmer ikke er begrenset til godt studert kandidat nettsteder, som gRNA bibliotek gjør mindre partisk skjermer mulig. Disse lette oppdagelsen av funksjonelle loci i genomet uten forutgående eksperimentelle kunnskap. Men gRNA biblioteket konstruksjon er for tiden hovedsakelig basert på oligo-nukleotid syntese, og begrenset alternativer kjøpe gRNA biblioteker som ikke er menneske eller musen opprinnelse eller målet områder utenfor åpne lesing rammer. Dermed, selv om CRISPR skjermer har allerede vist seg utrolig potente5,6,7,8, fullt ut har ikke ennå blitt utnyttet.

For å overvinne begrensning av klassisk gRNA metoder to strategier har nylig blitt utviklet. Begge er basert på kontrollert enzymatisk fordøyelsen av målet DNA i stedet for å stole på egendefinerte oligonucleotide syntese. Mens CORALINA9 benytter micrococcal nuclease, bare tilgjengelig alternativ metoden CRISPR-spising10, gjør bruk av begrensning enzymer (HpaII, ScrFjeg, uteksaminertjeg og Mmejeg). Betydelig, kan begge teknikkene brukes på alle innspill DNA, som tjener som kilde til gRNA protospacer sekvenser. Mens metoden CRISPR-spising sysselsetter en strategi for å redusere antall klonet gRNAs som målretting nettsteder ikke er etterfulgt av den nødvendige S.pyogenes PAM (protospacer tilstøtende motiv), genereres bare en liten brøkdel av alle mulige funksjonelle gRNAs for en område. CORALINA, derimot, er i stand til å generere alle potensielle gRNAs for kilde sekvenser, men inkluderer også en høyere brøkdel av ikke-fungerende guider. gRNA bibliotek generasjon gjennom kontrollert nuclease aktivitet kan omfattende gRNA biblioteker for noen arter, alle Cas9-protein eller -effektor system på en enkel og kostnadseffektiv måte. Videre er CORALINA tilpasses tilpasning, som riktig inngang og vektor valg definerer biblioteket type, størrelse og innhold. Her en detaljert protokoll er presentert som kan brukes til generering av omfattende gRNA biblioteker fra ulike kilder av DNA (figur 1), inkludert bakteriell kunstig kromosomene (BBS) eller genomisk DNA9. Representant resultatene følger denne protokollen var avledet ved hjelp CORALINA protokollen BAC DNA.

Protocol

1. fordøyelsen av DNA med Micrococcal Nuclease

  1. Utføre en optimalisering reaksjon for hver ny gruppe med micrococcal nuclease enzym (MNase).
    Merk: MNase brukes antall bør testes (med en seriell fortynning, figur 2A). Vanligvis 5-10 U på MNase fordøye 1 µg av renset genomisk eller BAC DNA til et utvalg av 5-100 bp med forholdene beskrevet nedenfor.
  2. Per reaksjon, definere 1 µL av 10 x MNase Buffer, 1 x bovin serum albumin (BSA), 1 µg av målet DNA, 1 µL av MNase (0,1-50 enheter) i et 10 µL reaksjon volum.
  3. Ruge på 37 ° C i 15 min.
  4. Umiddelbart deaktivere enzymet ved å legge til 1 µL av 500 mM etylenglykol-bis(β-aminoethyl ether)-N, N N', N'-tetraacetic syre (EGTA).

2. skille mellom DNA fragmenter bruker polyakrylamid Gel geleelektroforese (side)

  1. Legg eksempel buffer/gel lasting fargestoff til DNA-prøver og laste opp 20% siden gel. Laste inn en passende DNA stigen for skalering (5 bp DNA stigen). Ikke overbelast gel (1 µg DNA per brønn).
  2. Kjøre gels i riktig 1 x TRIS Borate EDTA (TBE) kjører buffer på 150 V (konstant) for rundt 1.5 h eller til lavere fargestoff foran (bromophenol blå, mørk blå farge) som reiser rundt 15 bp, når den nedre enden av gel.
  3. Stain gel med en ultra-følsom nukleinsyre flekken og visualisere under UV-lys.
  4. Fra gel bildet, bestemme optimal konsentrasjon av MNase for fordøye DNA til 20-30 bp i størrelse.
  5. Bruk optimalisert konsentrasjonen av MNase for å fordøye målet DNA ved å gjenta trinn 1.2-2.2. Vanligvis fordøyd sette opp 10-12 reaksjoner (dvs. 10-12 µg total starter materiale) vil gi nok DNA etter siden gel utvinning å fortsette til neste trinn.
  6. Bruker sterilt skalpell, kuttet gel ved merketråden kjørefelt og flekker bare delen av gel inneholder stigen med fersk 1 x TBE kjører buffer som inneholder 1 X av en ultra-følsom nukleinsyre flekken. Visualiser DNA stigen og avgiftsdirektoratet MNase-fordøyd DNA fragmenter i størrelse området mellom ca 18-30 bp med et barberblad.
    Merk: Unngå å utsette MNase fordøyd fragmenter til UV-lyset. Det er mulig å bruke en blå lyskilde (i stedet for UV) eller ta et bilde av stigen under UV, avtrykk den å skalere og bruk dette til å lede eksisjon av MNase-fordøyd DNA). Dette trinnet unngår flekker og eksponering av DNA for UV-lyset. Bruk alltid en ubrukt, sterile disponibel skalpell eller barberblad for dette trinnet for å unngå forurensning.
  7. Overføre gel stykket til et microcentrifuge rør.
  8. Stain resten av gel med nukleinsyre flekken som ovenfor, utsette å UV lys og registrere et bilde for å holde oversikt over gel excision trinn.

3. isolering av DNA fra side-gels med knuse og suge metode

Merk: Dette trinnet er vedtatt fra Sambrook et al. 11

  1. Forberede siden gel solubilization buffer (1.88 mL 4 M ammonium acetate, 150 µL av 1 M magnesium acetat, 30 µL av 0,5 M ethylenediaminetetraacetic syre (EDTA) (pH 8) i ultrapure H2O et samlet volum på 15 mL).
  2. Knuse forbrukeravgift gel sektoren mot veggen av mikro-sentrifuge røret ved hjelp av et sterilt pipette tips.
  3. Legg 2 gel mengder siden solubilization buffer og ruge på 37 ° C 16 h på en roterende plattform.
  4. Sentrifuge prøvene for 1 min for topphastigheten i en microcentrifuge. Overføre nedbryting til en ny microcentrifuge tube, ta vare ikke for å overføre noen knust gel brikker.
  5. Legge til 0,5 mengder siden solubilization buffer gel pellets, vortex, og gjenta sentrifugering (trinn 3.4). Kombiner supernatants.
  6. Ekstra DNA fragmenter bruker standard fenol-kloroform utvinning.
    FORSIKTIG: Fenol er giftig hvis det kommer i kontakt med huden eller svelging. Sikkerhetstiltak som hansker, vernebriller, en labfrakk og arbeider i avtrekksvifte er avgjørende. Kast alle fenol inneholder avfall etter instituttets forskrifter.
    1. Legge ett volum fenol: kloroform: isoamyl alkohol (25:24:1) til prøve og vortex grundig.
    2. Sentrifuge for 10 min med maksimal hastighet (16000 x g) i en tabletop sentrifuge ved romtemperatur. Nøye overføre den øvre vandige fasen til en frisk microcentrifuge tube. Ta vare ikke for å bære over alle fenol under pipettering.
    3. Gjenta trinn 3.6.1 og 3.6.2 en gang.
    4. Legge en liten mengde (0,2 µL) av glykogen, 0.1 mengder 3 M natrium acetate (pH 5.2) og 2 volum av 100% etanol (EtOH).
    5. Vortex og ruge på 20 ° C i flere timer eller over natten.
    6. Sentrifuger i 30 min med maksimal hastighet på 4 ° C ved hjelp av en tabletop sentrifuge.
    7. Nøye fjerne nedbryting og vask DNA pellets med 70% EtOH.
    8. Sentrifuger i 30 min med maksimal hastighet på 4 ° C ved hjelp av en tabletop sentrifuge.
    9. Fjern nedbryting og air-dry DNA-pellets. Kontroller alle EtOH har fordampet, men vær forsiktig med å over tørke pellet.
    10. Oppløse DNA pellet i 12 µL av H2O.
      Merk: Siden gel utvinning er svært ineffektiv. For hver 10 µg starter DNA fordøyd med MNase, forventer du å gjenopprette 1-20 ng av renset etter gel utvinning. Kontrollere mengden og integritet av fragmenter av lessing 1/6th (2 µL) på en side gel (figur 2C).

4. slutten reparasjon av MNase-fordøyd, Gel-renset fragmenter

  1. Definere følgende reaksjon med en DNA blunting kit: 10 µL av renset DNA fra trinn 3.6.10, 1,5 µL av 10 X blunting buffer, 1,5 µL av 1 mM dNTP, 0,6 µL av blunting enzym, 1,4 µL av H2O.
  2. Ruge på 22 ° C i 30 minutter, og deretter varme-Deaktiver enzymet av inkubasjon ved 70 ° C i 10 min.
  3. Legge til 85 µL av H2O og utføre en reaksjon rydde opp ved hjelp av standard fenol/kloroform-uttak og EtOH-nedbør (som beskrevet i delen 3.6). Fortsett rett til koblingsfunksjonalitet hemorroider.

5. linker generasjon

Merk: Linkers må mikrofonfunksjon parallelt med avsnitt 3 kunne fortsette umiddelbart koblingsfunksjonalitet hemorroider. Primer sekvenser brukes under må være passende for valgte gRNA uttrykk vektoren. De presenteres her er designet for vektor pgRNA-pLKO.1. 9 for forsterking av 5' linker fra pgRNA-pLKO.1, bruke grunning sekvenser 5'-linker-F (TTGGAATCACACGACCTGGA) og 5'-linker-R (CGGTGTTTCGTCCTTTCCAC), gir en 689 bp-amplicon. For forsterking av 3 linker fra pgRNA-pLKO.1, bruke grunning 3-linker-F: (GTTTTAGAGCTAGAAATAGCAAGTTAAAATA) og 3-linker-R: (ACTCGGTCATGGTAAGCTCC), som gir en 848 bp-amplicon.

  1. PCR-forsterke kortet sekvenser fra gRNA uttrykk vektor (med reagenser valgfrihet og egendefinerte primer sekvenser, om nødvendig). For pgRNA-pLKO.1 satt opp følgende 50 µL PCR reaksjon: 25 µL PCR master mix, 2,5 µL av primer F (10 µM), 2,5 µL av primer R (10 µM), 0.1 ng av gRNA uttrykk vektor (pgRNA-pLKO.1) i H2O.
  2. Inkuber reaksjoner på en thermocycler med følgende: 1 syklus 98 ° C for 30 s, 32 sykluser 98 ° C for 10 s, 59 ° C for 10 s, 72 ° C for 30 s, 1 syklus 72 ° C for 10 min.
  3. Rense PCR reaksjoner med solid fase reversibel immobilisering perler i henhold til produsentens instruksjoner. Elute i 30 µL av H2O.
  4. Å håndheve retningsbestemt ligation av linker til slutten-reparert, MNase-fordøyd DNA fragmenter, fordøye linkers med passende begrensning enzymer (her HindIII og SacII). Definere følgende reaksjoner:
    1. Fordøyelsen av 5' linker med HindIII, bruker 30 µL av renset 5' linker amplicon fra trinn 5.3., 5 µL av Buffer, 3 µL av HindIII (20U/µL) og 12 µL av H2O.
    2. Fordøyelsen av 3 linker med SacII, bruker 30 µL av renset 3' linker amplicon fra trinn 5.3., 5 µL av Buffer, 3 µL av SacII (20 U/µL), og 12 µL av H2O.
  5. Inkuber fordøyer på 37 ° C 3 h.
  6. Legge til DNA gel lasting fargestoff og kjøre begrensning enzym-format på en 1% agarose gel. Avgiftsdirektoratet band på 637 bp (5' linker oversikten) og 295 bp (3 koblingsfunksjonalitet oversikten).
  7. Rense fra forbrukeravgift gel bitene bruke en gel utvinning kit.

6. linker ligatur og forsterkning av innstikk

  1. Definere en 14 µL ligation reaksjon med ekvimolare mengder MNase-fordøyd, slutten-reparert fragmenter og koblingsfunksjonalitet sekvenser.
    Merk: Linker til fragment forholdene kan optimaliseres. Det anbefales å ta en no-fragment kontroll (NFC) reaksjon.
    1. Bruk 5 ng av MNase-fordøyd (slutten-reparert og renset), 120 ng av 5' linker (HindIII digest, renset), 55 ng 3 linker (SacII digest, renset), 1,4 µL av T4 ligase Buffer og 1,4 µL av konsentrert T4 DNA ligase i H2O.
  2. Inkuber ligation reaksjonene på 16 ° C 16 h. Gjør ikke varme-Deaktiver enzymet. Fortsett rett til nick-oversettelse.
    Merk: Slutten-reparert MNase-fordøyd fragmenter gi 5' fosfater nødvendig for ligation av linkers, som linker selv er un phosphorylated.
  3. Ligation reaksjon (og NFC reaksjonen) legge følgende: 25 µL av Taq 2 X master mix (kan nick oversettelse), 2,5 µL av primer Linker-Minus450-F (10 µM, GGGCAAGTTTGTGGAATTGG), 2,5 µL av primer Linker-Plus275-R (10 µM, AAGTGGATCTCTGCTGTCCC) og 6 µL av H2O.
  4. Inkluder en nei-mal kontroll (NTC). Inkuber reaksjoner på en thermocycler med følgende: 1 syklus (nick oversettelse): 72 ° C for 20 min, 1 syklus: 95 ° C i 5 minutter, 3-4 sykluser: 95 ° C i 15 s, 58 ° C i 15 s, 72 ° C for 30 s, 1 syklus: 72 ° C i 5 minutter.
  5. Utføre en reaksjon oppryddingen solid fase reversibel immobilisering perler med en prøve å perle forholdet 1:1. Elute i 40 µL av H2O.
  6. Ytterligere forsterke ønsket fragment (5' linker + MNase fragmentere 3 ' linker) bruker riktig PCR reagenser og følgende primerne:
    1. Bruk 12.5 µL PCR master mix, 1,25 µL av primer Linker-Minus450-F (10 µM, GGGCAAGTTTGTGGAATTGG), 1,25 µL av primer Linker-Plus275-R (10 µM, AAGTGGATCTCTGCTGTCCC), 2,5 µL av renset nick oversettelse produkt fra trinn 6.4. og 7,5 µL av H2O. bruker følgende: 1 syklus: 98 ° C for 30 s, 10-16 sykluser: 98 ° C for 10 s, 63 ° C for 10 s, 72 ° C i 15 s, 1 syklus: 72 ° C i 10 min.
      Merk: Eventuelt flere reaksjoner kan defineres i parallell å sikre det er nok PCR produkt for fremgangsmåten. For å visualisere små mengder PCR produktet på en agarose gel, definere flere reaksjoner som i trinn 6.5 og øke syklus fra 15 til 32. Dette kan brukes som kvalitetskontroll, hvis amplicons ikke er synlige etter 15 sykluser. Inkluder også en ingen mal kontroll (NTC).

7. størrelse

Merk: Dette trinnet skiller MNase-fragmenter med riktig vedlagte 5' og 3 linker fra fragmenter med to 5' eller to 3 linkers basert på størrelse.

  1. Kombinere alle 15-syklus PCR reaksjoner fra trinn 6.5., legge til DNA laste fargestoff og kjøre på en 0,8% agarose gel. Avgiftsdirektoratet bandet fremtredende på 869 bp og rense bruker en gel utvinning kit.
  2. Kvantifisere mengden DNA (f.eks med et spektrofotometer).

8. kloning av PCR-forsterket fragmenter i gRNA uttrykk vektor av Gibson montering

  1. Forberede montering master mix slik:
    Merk: Følgende er tilpasset fra Gibson et al. 12.
    1. Opprette 6 mL isotermiske reaksjon bufferen ved å kombinere 3 mL 1 M Tris (hydroxymethyl) aminomethane (Tris)-HCl pH 7.5 300 µL av 1 M MgCl, 60 µL av 100 mM deoxyguanosine trifosfat (dGTP), 60 µL av 100 mM deoxyadenosine trifosfat (dATP), 60 µL av 100 mM deoxythymidine trifosfat (dTTP), 60 µL av 100 mM deoxycytidine trifosfat (dCTP), 300 µL av 1 M dithiothreitol (DTT), 1,5 g polyetylenglykol (PEG)-8000, 300 µL av 100 mM nikotinamid adenine dinucleotide (NAD) i ultrapure H2O.
      Merk: Denne bufferen kan være aliquoted og lagret på 20 ° C.
    2. Opprette 1,2 mL montering master blanding ved å kombinere 320 µL av 5 X isotermiske reaksjon buffer, 3 µL av 10 U/µL T5 exonuclease, 20 µL av 2 U/µL DNA polymerase, 160 µL av 40 U/µL DNA ligase i ultrapure H2O. Bruk 15 µL av montering master mix med 5 µL av Sett inn.
      Merk: Montering master mix kan være aliquoted og lagret ved 20 ° C, hvor det er stabil for mer enn et år og tåler flere fryse-Tin sykluser. Den valgte T5 exonuclease er ideell for bruk med lang overheng.
  2. Vector ryggraden fordøyelse
    Merk: Husk å fordøye en tilstrekkelig mengde vektor som inndata for ønsket antall montering reaksjoner i trinn 8.3.
    1. Per reaksjon, legger du til følgende: 1,5 µg gRNA uttrykk vektor (pgRNA-pLKO.1), 5 µL bufferen, 1,5 µL alderjeg (5U/µL), og 38,5 µL av H2O. Incubate fordøye ved 37 ° C i 2 timer.
  3. Dephosphorylation av lineær vektoren.
    Merk: Dette trinnet er rådet, men ikke strengt nødvendig. T5 exonuclease i master mix, fjernes det meste alderjeg overhangs før Taq DNA ligase har hatt en sjanse til å handle. Derfor forventes ikke overdreven re ligation av vektoren.
    1. Legge til 2,5 µL av reker alkalisk fosfatase enzym (rSAP, 1 U/µL).
    2. Ruge på 37 ° C i 30 minutter, og deretter deaktivere enzymet av rugende ved 65 ° C i 5 minutter.
  4. Utføre DNA rensing
    Merk: Det anbefales å utføre en agarose gel utvinning trinn. Alternativt, kolonne- eller perle rensing kan brukes. Det er viktig å kontrollere at vektor fordøyelsen er fullført, f.eks ved agarose gel geleelektroforese. Til sammenligning ufordøyd vektor bør kjøres parallelt.
  5. Kvantifisere mengden renset fordøyd vektor i utvalget.
  6. Sette opp samlingen med 2-fold molar overskudd av setter inn til vektor. Per 20 µL reaksjon bruk 100 ng av vektor (alderjeg fordøye fra trinn 8.5), 12.2 ng av sett (fra trinn 7.1.), 15 µL av montering master mix fra trinn 8.1.2. i H2O.
  7. Inkuber ved 50 ° C i 1 time.
  8. Rense reaksjonene bruke kolonnen rensing. Resuspend DNA i 75 µL av H2O (eller riktig volum avhengig av omfanget av electroporation).
    Merk: Transformasjon effektiviteten er sterkt avhengig av DNA renhet. Ekstra rensing trinn (f.eks fenol/kloroform utvinning) kan forbedre effektiviteten.

9. forberedelse av elektro-kompetent TG1 E. coli celler

  1. Kontroller at alle sentrifuge flasker og flasker er fri fra vaskemidler skylling og påfølgende fylt med destillert vann før autoklavering.
    Merk: Dette trinnet bidrar til å fjerne urenheter som kan påvirke transformasjon effektivitet. Vannet bør forkastes umiddelbart før bruk. Alternativt, bruk av disponibel sentrifugering flasker kan være tilrådelig.
  2. Kontroller at sentrifuge flasker, rør og løsninger brukes for utarbeidelse av electrocompetent celler er kjølt på isen før bruk. Det er best å gjennomføre følgende trinn i et kaldt rom å minimere temperatur kursbevgelsene som kan påvirke transformasjon effektiviteten.
  3. Forberede 2TY medium. 16 g av bacto tryptone legge 10 g gjærekstrakt, og 5 g av NaCl, destillert vann til 1 L, mix og autoclave. Store medium ved romtemperatur.
  4. Forberede 2TY-agar belagt bioassay retter og 10 cm Petri retter som inneholder det aktuelle antibiotikumet. Lagre plater på 4 ° C.
    Merk: Valg av antibiotika, avhenger av hva slags gRNA uttrykk vektor, bruk 100 µg/mL ampicillin for pgRNA-pLKO.1.
  5. Skrape fra en glyserol lager TG1 celler å vaksinere 10 mL av 2TY medium (uten antibiotika).
  6. Inkuber kultur på 37 ° C over natten (~ 16 h) med skjelvende på 225 rpm.
  7. Vaksinere 1 L 2TY medium (uten antibiotika) med de 10 mL av natten kultur (1/100 fortynning) og dele det likt mellom to 2 L flasker (inneholder Bafflene).
  8. Inkuber kultur på 37 ° C, 225 rpm inntil en OD600 nm i 0,55 nås (ca etter 1,5-2 h). Bruk et spektrofotometer for å sjekke OD600 nm regelmessig.
  9. Chill kulturer på is 30 min.
  10. Delt kulturen likt mellom fire 500 mL sentrifuge flasker (pre kjølt på is).
  11. Sentrifuger i 15 min 4000 x g på 4 ° C i en pre kjølt sentrifuge.
  12. Dekanter supernatants og Legg til 1-volum (dvs. 250 mL) før kaldt iskald sterilt destillert H2O hver sentrifuge flaskene. Resuspend bakteriell pellet av virvlende eller vaskeløsningen (eller mild pipettering, om nødvendig).
    Merk: Det er enklere å resuspend pellet ved å legge en liten mengde vann. Sikre pellet er helt resuspended slutt.
  13. Sentrifuger i 15 min 4000 x g på 4 ° C.
  14. Gjenta vask to ganger (trinn 9,12. og 9.13). Fjerne nedbryting. Vær forsiktig når dekantere vin som den bakterielle pellet blir stadig mer løs etter vask.
  15. Resuspend pellet i 50 mL steril, iskalde 10% glyserol og overføre den til en pre kjølt 50 mL sentrifuge rør.
  16. Sentrifuger celler i 15 min ~ 4000 x g på 4 ° C. Fjern forsiktig nedbryting.
  17. Forsiktig resuspend bakterier i 2 mL iskald sterilt 10% glyserol.
  18. Hold på is hvis cellene skal brukes umiddelbart som electroporation.
    Merk: Cellene kan frosset i dele 50 µL i 0,5 mL rør i tørris etanol badekar og lagret på-80 ° C, men dette anbefales ikke.

10. Electroporation TG1 Electrocompetent E. coli celler

Merk: Electroporation er en av flaskehalser i omfattende bibliotek generasjon. Hvis du vil beholde biblioteket representasjon, det anbefales å utføre så mange personlige electroporation reaksjoner som nødvendig/praktisk og utføre kvalitetskontroll trinnene beskrevet nedenfor (10.6. og 10,8.).

  1. Aliquot renset reaksjonene (fra trinn 8,8) i sterilt og pre kjølt PCR-rør og holde dem på is (1 µL per rør). Chill 1 mm gapet electroporation cuvettes på is.
  2. Legg til 25 µL av nylagde TG1 celler direkte til en aliquot DNA og øyeblikkelig overføre blandingen i en electroporation cuvette. Sveip eller trykk cuvette slik celler/DNA blandingen er fordelt langs cuvette kammeret (uten innestengte luften eller bobler).
  3. Plasser cuvette i lysbildet kammeret og starte programmet riktig electroporation (f.eks 1 pulsen på 1,8 kV (EC1)).
    Merk: Tiden konstant bør ligge mellom 5.7 og 6.0 ms. i tilfelle de electroporator buer, Sveip til cuvette, sikre det er ingen luftbobler i kammeret og prøv på nytt.
  4. Umiddelbart legge 975 µL av romtemperatur 2TY medium til cuvette.
  5. Bruker en overføring pipette, flytte electroporated bakterier til en 50 mL tube. Gjenta fra trinn 10.2. og samle alle celler forvandlet med ett bibliotek i en 50 mL tube.
  6. Dokument totalt volum.
  7. Kvalitetskontroll trinn
    1. For å kvantifisere kompetanse fersk genererte electro-kompetent cellene, utføre en separat electroporation reaksjon med et definert antall uncut plasmider DNA (f.eks 10 pg pUC19 kontroll plasmider). Overføre dette til en 1,5 mL microfuge tube.
      Merk: Kompetansen bør være minst 1010 colony-forming enheter (cfu) per µg DNA. Nylagde celler gir vanligvis bedre enn dette.
  8. Inkuber transformert bakterier på 37 ° C for 60 min rister på 225 rpm.
  9. Kvalitetskontroll trinn:
    1. Plate definerte litt bakterier forvandlet biblioteket (f.eks 10 µL av en 10-100 fold fortynning) på en 10 cm agar plate med passende antibiotikumet utvalg.
      Merk: Å vite det totale kultur volumet (fra trinn 10.6.), kan hvor innhentet kolonien brukes til å beregne antall koloniene for hele biblioteket. 20-30 ganger representasjon av biblioteket bør ideelt opprettholdes.
  10. Spre resten av bakterier på 2TY agar belagt bioassay retter som inneholder det passende antibiotikumet utvalget.
    Merk: Volumet av kulturen kan reduseres med sentrifugering ~ 4000 x g i 10 min (eller til en synlig pellet har dannet og nedbryting synes klart). Dette reduserer tiden plater må tørke etter spredning av kulturen. Bruk av plater i stedet for flytende kultur minimerer uforholdsmessig vekst av enkelte koloniene. 13
  11. Spre en passende mengde pUC19 kontroll electroporation reaksjonen på en ekstra 10 cm agar parabolen med passende antibiotikumet utvalg.
  12. Inkuber agar plater natten (16 h) på 37 ° C.
  13. Tell fått kolonier på kontroll plater (pUC19 og kontroll biblioteket plate) til å beregne CFU/µg DNA for bakterier og biblioteket kompleksitet.

11. uttak av plasmider DNA

  1. Legge til 10 mL av 2-TY media overnatting platene, skrape bakteriell laget av platen med en engangs sprederen og samle den i en 50 mL tube. Gjenta et par ganger til alle platen vises rene.
  2. Ekstra DNA ved å bruke en plasmider Maxi kit (2-3 kolonner trengs per Bio-analysen plate).

Representative Results

Bruker protokollen for hånden, er CORALINA gRNA biblioteker generert fra menneskelige og mus genomisk DNA9 og BAC DNA (figur 1). For å produsere fragmenter av input DNA egnet for kloning i gRNA uttrykk vektorer, må optimale forhold for kontrollert nuclease fordøyelsen bestemmes. Et vanlig resultat for optimalisering av micrococcal nuclease fordøyelsen er avbildet i figur 2A. Utilstrekkelig mengde nuclease (0.1, 2, 3, 4, 4.5 eller 5 enheter) gir ingen merkbar produkter innenfor størrelse (10-100 bp) og 5.5-7.5 enheter fortsatt produsert fragmenter som er i gjennomsnitt for lang. Større mengder enzym (50 enheter) føre til overdreven nedverdigelsen inngang DNA etter 10 min. Derfor ble en mellomliggende beløpet valgt (10 enheter). Sammendraget ble skalert å produsere nok fordøyd fragmenter for påfølgende rensing og kloning (figur 2B). Mens det er anbefalt å blindt velger DNA fragmenter av størrelse og bare stole på DNA-stigen retning minimere eksponering av DNA UV lys, kan gels være farget etterpå for kvalitetskontroll av fordøyelsen og kutte. Figur 2B viser et representativt eksempel på en side gel fra som DNA fragmenter mellom 20 og 30 bp har vært excised. Gel renset MNase fragmenter ble lastet opp på 20% siden gel for å kontrollere vellykket størrelse og rensing av MNase-fordøyd fragmenter (figur 2C). Protokollen for hånden er kompatibel med bruk av tilpassede koblingsfunksjonalitet sekvenser, slik at for å klone MNase-fordøyd fragmenter i gRNA uttrykk vektorer valgfrihet. Her, ble gRNA-PLKO-9 brukt som ryggraden. Linkers er forsterket angrepsvektorene i gRNA-uttrykk ved hjelp av standard PCR. Figur 2D viser et representativt eksempel på forsterket koblingsfunksjonalitet sekvenser blottet for ekstra, feil eller ingen mal amplicons. Deretter er koblingsfunksjonalitet amplicons fordøyd med begrensning enzymer slik linkers er samskrevet på MNase-fordøyd fragmenter i riktig retning. Figur 2D viser agarose gelé av 5' og 3 linkers før og etter fordøyelsen HindIII og SacII, som angir fullstendig fordøyelsen av linkers de anslåtte 637 og 295 bp. Den høyre delen av gel bildet dokumenter eksisjon av fordøyd koblingsfunksjonalitet fragmenter. Følgende gel utvinning av fordøyd linkers er det neste trinnet i protokollen ligation av linkers til slutten-reparert MNase-fordøyd fragmenter. Fordi koblingsfunksjonalitet sekvenser genereres av PCR bruker unphosphorylated primere, skal selv ligation av linkers ikke oppstå. Bare slutten-reparert MNase-fordøyd DNA fragmenter gir fosfat gruppene nødvendig for hemorroider. Etter nick oversettelse, hemorroider produktet forsterkes av PCR. For å unngå overdreven PCR forsterkning skjevhet som kan gjøre representasjon av gRNA sekvenser i biblioteket, er forsterkning begrenset til mindre enn 20 sykluser totalt. Etter PCR er forsterkning produktene vanskelig å visualisere på agarose gels. Separate kontroll PCRene med 32 sykluser utføres derfor for å registrere produktene (men brukes ikke for biblioteket forberedelse). Resultatene fra denne kontrollen PCR vises i figur 2E. Dette gjør optimalisere ligation reaksjonene og sikre reaksjoner er blottet for PCR gjenstander, som skjer i "ingen fragmenter kontroller" (NFC). Figur 2E viser ønsket amplicon (5' linker + DNA fragment + 3 linker, lengde: 869 bp) etter forsterkning av hemorroider reaksjoner med ekvimolare (1:1) forhold mellom fragmenter og koblingsfunksjonalitet sekvenser.

Figure 1
Figur 1 : Foreslo tidslinjen for å forberede en gRNA biblioteket. CORALINA tilbyr en enkel og kostnadseffektiv strategi for generering av omfattende gRNA biblioteker fra en mengde ulike DNA kilder fra en organisme. Protokollen for hånden kan bringes til ferdigstillelse i en arbeidsuke. Koblingsfunksjonalitet generasjon kan utføres parallelt med DNA slutten-reparasjon. Utarbeidelse av electrocompetent bakterier tar to dager og inkluderer en overnatting vekst skritt og bør derfor startes før montering reaksjoner er definert. Klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2 : Avgjørende skritt i protokollen. (A) kontrollert fordøyelsen BAC DNA aktiverer generering av fragmenter av forskjellige størrelser. Vist her er optimalisering av MNase fordøyelsen. Renset BAC DNA ble behandlet med ulike mengder MNase for 10 min. 10 U av MNase generere DNA fragmenter av ønsket lengde (20-30 bp). (B) størrelse utvalg av fragmenter mellom 20 og 30 bp bruker excision fra polyakrylamid gels. Renset BAC DNA ble behandlet med 10 U MNase for 10 min. Bildet ble innspilt etter excision. (C) kvalitetskontroll av gel-renset. Etter gel-rensing, 1/6th av det renset MNase fragmenter ble lastet opp på 20% siden gel å sjekke vellykket størrelse og rensing. (D) forsterkning av koblingsfunksjonalitet sekvenser for montering og begrensning enzym fordøyelsen av linkers å sikre retningsbestemt kloning. 5' og 3 linkers ble forsterket og kuttet med HindIII og SacII, henholdsvis. No-mal kontroller (NTC) var inkludert å kontrollere for PCR gjenstander og DNA forurensning. Venstre: analytisk eksempelprogram; høyre: skytevåpen eksempelprogram. Bildet ble innspilt etter gel excision. (E) vellykket ligation av linkers DNA fragmenter kan analyseres bruker PCR med et økt antall PCR sykluser (32) og kontrollert av utfører ingen mal kontroller med H2O (NTC) eller bruke NTC i det forrige nick oversettelse inndata (NTC NT)). Det er viktig å inkludere et fragment valgfritt (NFC), som er en forsterkning fra en ligatur og nick oversettelse reaksjon som MNase fragmenter ble utelatt. Bare prøver i hvilke MNase fragmenter er kombinert med koblingsfunksjonalitet DNA produsere den forventede amplicon (869 bp). Klikk her for å se en større versjon av dette tallet.

Discussion

CORALINA kan brukes til å generere storskala gRNA biblioteker av kontrollert nuclease fordøyelse av målet DNA og bulk kloning av resulterende dobbel strandet fragmenter. Statistisk inferens angir at mange mer enn 107 personlige gRNA sekvenser har allerede blitt er fullført ved hjelp av protokollen hånd9. CORALINA kan tilpasses på flere måter. Valg av mal DNA definerer målregion og maksimal kompleksiteten i genererte biblioteket. Bruker denne protokollen, CORALINA biblioteker har tidligere blitt generert fra menneske og mus genomisk DNA9. Representant resultatene presenteres her skildre generering av et CORALINA bibliotek fra renset BAC DNA. Videre tilpasning kan oppnås av gRNA uttrykk vektor og koblingsfunksjonalitet sekvenser. Vi har tidligere testet tre forskjellige par linker lengder for Gibson montering med små variasjoner i effektivitet9.

På grunn av deres opprinnelse fra bulk fordøyd DNA, protospacer av CORALINA gRNAs er vanligvis ikke nøyaktig 20 bp i lengde, men showet en lengde distribusjon med en mening som avhenger både parameterne for MNase fordøyelsen og størrelsen på excision laget siden gel s. representant eksemplet i figur 2B og Cviser fragmenter med median lengde mellom 19 og 27 bp. I vår erfaring beholdes trofast lengden av fragmenter av genererte gRNA protospacer9. Mens fragmenter kortere enn 20 bp bør unngås på grunn av høyere off-målet antall resulterende gRNAs, lengre fragmenter trolig mye mindre av et problem for nedstrøms programmer, siden det har vært vist at gRNAs med protospacers så lenge 45 bp er fortsatt funksjonell9.

De to viktigste trinnene i CORALINA protokollen er størrelse valg av MNase-fordøyd fragmenter og kloning skritt. Generasjon av fragmenter som er for kort (f.eks gjennomsnitt under 18 bp) eller inkorporering av mange tomme gRNA uttrykk vektorer vil gjøre biblioteket ubrukelig. Derfor er det viktig å optimalisere MNase fordøyelsen trinn (figur 2A), overvåke excision (figur 2B, C) sjekk for komplett fordøyelsen av gRNA vektor ryggraden og inkludert noen fragment kontroller i protokollen. Forsiktighet må også tas å bevare representasjon av gRNA biblioteket. En vanlig flaskehalsen biblioteket generasjon er generelt effektiv overføring av plasmider i bakterier for forsterkning. Dermed er store mengder bakterier med utmerket kompetanse og en rekke personlige electroporation hendelser nødvendig for å oppnå et høyt antall gRNA kloner.

Nye strategier for gRNA biblioteket produksjon vil være nødvendig å høste det fulle potensialet av CRISPR-basert screening de neste tiårene. Det er en betydelig etterspørsel etter kostnadseffektive, enkle og passelig metoder for å generere store biblioteker, nødvendig å gjøre screening mottakelig for et større antall modellsystemer og annet CRISPR engineering tilnærminger. CORALINA gir et første skritt mot denne. Potensielle bruker er mange, spesielt for å lage omfattende biblioteker av genomer, cDNA avledet biblioteker av mindre vanlige modellsystemer, svært fokusert biblioteker og eksperimentelle oppsetninger i hvilke ulike CRISPR proteiner (med ulike PAM krav) brukes i kombinasjon.

I motsetning til andre metoder genererer CORALINA alle mulige gRNAs fra input DNA. En ulempe metoden er imidlertid at gRNAs mangler nødvendig PAM sekvensen er også inkludert i biblioteket, en funksjon som den deler med en annen enzymatisk metode for gRNA biblioteket generasjon, CRISPR-spising (tabell 1). Valg av metoden ideelt for gRNA biblioteket generasjon avhenger av spesifikasjonene til planlagte screening eksperiment, spesielt natur (genic, regulatoriske, intergenisk) og størrelsen på målregion (enkelt locus, flere regioner, genomet-bred). Vi ser en spesiell opp ved CORALINA når et stort antall ikke-koding eller regulatoriske regioner er til å analysere, hvis det er ufullstendig eller upålitelig oppstartsrekkefølgen (eksotiske modellsystemer, blandinger av arter (f.eks microbiomes) eller eksperimentelt oppnådd inngang), hvis ulike CRISPR endonucleases kombineres eller mette analyse utføres på et kort og definert locus (f.eks representert ved BACs).

Disclosures

Forfatterne ikke avsløre.

Acknowledgments

Forfatterne gjerne takke Prof. Dr. Stephan Beck og Prof. Dr. Magdalena Goetz for innspill, hjelp og støtte i å utvikle metoden CORALINA Maximilian Wiessbeck og Valentin Baumann for nyttige kommentarer. Arbeidet har blitt støttet av DFG (STR 1385/1-1).

Materials

Name Company Catalog Number Comments
500 mM EGTA Sigma Aldrich 03777-10G 1.4., Inactivation of Mnase
Novex Hi-Density TBE Sample Buffer Thermo Fisher Scientific LC6678 2.1.
Novex® TBE Gels, 20%, 10 well Thermo Fisher Scientific EC6315BOX 2.1., pre-made 20 % PAGE gel
O'RangeRuler 5 bp DNA Ladder, Thermo Fisher Scientific SM1303 2.1.
Novex® TBE Running Buffer Thermo Fisher Scientific LC6675 2.1., PAGE gel running buffer
Disposable scalpel, sterile VWR  233-5363  2.3., other equivalent reagents may be used
SYBR Green I nucleic acid stain (1000x concentrate in DMSO) Sigma Aldrich
S9430
2.3. +2.5., also available from Thermo Fisher Scientific (S7563)
UltraPure Phenol:Chloroform:Isoamyl Alcohol (25:24:1) Thermo Fisher Scientific 15593-031 3.6.1. + 4.3., other equivalent reagents may be used
Glycogen Sigma 10901393001 3.6.4., other equivalent reagents may be used
3M Sodium acetate , pH5.2 Thermo Fisher Scientific   R1181 3.6.4., other equivalent reagents may be used
Ethanol  3.6.4. + 9.1.8., molecular biology grade
Quick blunting kit  New England Biolabs E1201 4.1.
ammomium acetate Sigma
A1542
3.1., other equivalent reagents may be used
magnesium acetate Sigma
M5661
3.1., other equivalent reagents may be used
0.5 M EDTA (pH 8.0) VWR   MOLEM37465520 (or Promega V4231) 2.2. + 3.1., other equivalent reagents may be used
Agencourt AMPure XP beads Beckman coulter A63881 5.3. + 6.5.
Gel extraction kit QIAGEN 28704 5.7.+ 7.1. +8.4., other equivalent reagents may be used
concentrated T4 DNA ligase New England Biolabs  M0202T 6.1.+ 8.1.2.
Long Amp Taq 2X Master Mix  New England Biolabs M0287S 6.3.
Phusion High-Fidelity PCR Master Mix with HF Buffer New England Biolabs M0531S 5.1. + 6.6., other equivalent reagents may be used
HindIII New England Biolabs R0104S 5.4.1. 
SacII New England Biolabs R0157S 5.4.2.
AgeI New England Biolabs R0552S 8.2.1.
Tris base Sigma 93362 8.1.1.
2M MgCl Sigma 93362 8.1.1.
dGTP,dATP, dCTP, dTTP New England Biolabs N0446S 8.1.1.
DTT Sigam
DTT-RO
8.1.1.
PEG-8000  Sigma
P5413
8.1.1.
NAD Sigma
N6522
8.1.1.
T5 exonuclease New England Biolabs M0363S 8.1.2.
Phusion DNA polymerase  New England Biolabs M0530S 8.1.2.
Taq DNA ligase New England Biolabs M0208L 8.1.2.
rSAP New England Biolabs M0371S 8.3.1.
TG1 competent cells Lucigen 60502-1 9.1.
1mm gap electroporation cuvettes  VWR 732-2267  10.2.
Bio-Assay Dish (Polystyrene, 245 mm x 245 mm x 25 mm) Fisher Scientific DIS-988-010M  9.4.
NaCl Sigma S7653  9.3.
Bacto-tryptone BD 211705 9.3.
Yeast extract BD 212750 9.3.
Agar Sigma
A1296
9.4.
Glycerol Sigma
G5516
9.17.
MNAse New England Biolabs M0247S 1.1.
Nanodrop Thermo Fisher Scientific ND-2000 throughout
Micropulser Biorad 165-2100 10.2.
Electroporation cuvettes Biorad 732-2267  10.2.
250 ml centrifuge tubes Corning 430776 9.1-9.9.

DOWNLOAD MATERIALS LIST

References

  1. Mali, P., Esvelt, K. M., Church, G. M. Cas9 as a versatile tool for engineering biology. Nat Methods. 10, (10), 957-963 (2013).
  2. Yang, H., et al. One-step generation of mice carrying reporter and conditional alleles by CRISPR/Cas-mediated genome engineering. Cell. 154, (6), 1370-1379 (2013).
  3. Stricker, S. H., Koferle, A., Beck, S. From profiles to function in epigenomics. Nat Rev Genet. 18, (1), 51-66 (2017).
  4. Dominguez, A. A., Lim, W. A., Qi, L. S. Beyond editing: repurposing CRISPR-Cas9 for precision genome regulation and interrogation. Nat Rev Mol Cell Biol. 17, (1), 5-15 (2016).
  5. Shalem, O., et al. Genome-scale CRISPR-Cas9 knockout screening in human cells. Science. 343, (6166), 84-87 (2014).
  6. Wang, T., Wei, J. J., Sabatini, D. M., Lander, E. S. Genetic screens in human cells using the CRISPR-Cas9 system. Science. 343, (6166), 80-84 (2014).
  7. Koike-Yusa, H., Li, Y., Tan, E. P., Velasco-Herrera Mdel, C., Yusa, K. Genome-wide recessive genetic screening in mammalian cells with a lentiviral CRISPR-guide RNA library. Nat Biotechnol. 32, (3), 267-273 (2014).
  8. Hart, T., et al. High-Resolution CRISPR Screens Reveal Fitness Genes and Genotype-Specific Cancer Liabilities. Cell. 163, (6), 1515-1526 (2015).
  9. Koferle, A., et al. CORALINA: a universal method for the generation of gRNA libraries for CRISPR-based screening. BMC Genomics. 17, (1), 917-940 (2016).
  10. Lane, A. B., et al. Enzymatically Generated CRISPR Libraries for Genome Labeling and Screening. Dev Cell. 34, (3), 373-378 (2015).
  11. Sambrook, J., Russell, D. W. Isolation of DNA fragments from polyacrylamide gels by the crush and soak method. CSH Protoc. (1), (2006).
  12. Gibson, D. G. Enzymatic assembly of overlapping DNA fragments. Methods Enzymol. 498, 349-361 (2011).
  13. Elsaesser, R., Paysan, J. Liquid gel amplification of complex plasmid libraries. Biotechniques. 37, (2), 200-202 (2004).
En universell protokoll for store gRNA biblioteket produksjon fra en DNA-kilde
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Köferle, A., Stricker, S. H. A Universal Protocol for Large-scale gRNA Library Production from any DNA Source. J. Vis. Exp. (130), e56264, doi:10.3791/56264 (2017).More

Köferle, A., Stricker, S. H. A Universal Protocol for Large-scale gRNA Library Production from any DNA Source. J. Vis. Exp. (130), e56264, doi:10.3791/56264 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter