Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Um protocolo Universal para grande escala gRNA biblioteca de produção a partir de qualquer fonte de DNA

doi: 10.3791/56264 Published: December 6, 2017

Summary

Métodos para a geração de bibliotecas gRNA em larga escala devem ser simples, eficiente e econômica. Descreveremos um protocolo para a produção de bibliotecas de gRNA baseado na digestão enzimática de ADN alvo. Este método, CORALINA (geração de biblioteca gRNA abrangente através da actividade nuclease controlada) apresenta uma alternativa para síntese do oligonucleotide personalizado dispendiosos.

Abstract

A popularidade do sistema CRISPR/Cas9 para genoma e engenharia Epigenoma decorre de sua simplicidade e adaptabilidade. Um efetor (a nuclease Cas9 ou uma proteína de fusão de nuclease-mortos dCas9) é direcionado para um site específico no genoma por um pequeno RNA sintético conhecido como o guia do RNA, ou gRNA. A natureza bipartida do sistema CRISPR permite seu uso em triagem abordagens desde bibliotecas do plasmídeo contendo fitas de expressão de milhares de gRNAs individual podem ser usadas para interrogar a muitos locais diferentes em uma única experiência.

Até à data, sequências de gRNA para a construção de bibliotecas foi quase exclusivamente geradas pela síntese do oligonucleotide, que limita a complexidade alcançável de sequências na biblioteca e é relativamente onerosos. Aqui, uma detalhada do protocolo para CORALINA (geração de biblioteca de gRNA abrangente através da actividade nuclease controlada), um simples e método cost-effective para a geração de bibliotecas gRNA altamente complexo baseado na digestão enzimática da entrada do DNA, é descrito. Desde bibliotecas CORALINA podem ser geradas a partir de qualquer fonte de ADN, muitas opções para personalização existem, permitindo uma grande variedade de telas CRISPR-baseado.

Introduction

A adaptação do sistema CRISPR/Cas9 bacteriana como uma ferramenta de direcionamento molecular causou a mais recente revolução na biologia molecular. Nunca foi tão fácil de manipular a cromatina em locais definidos de genômicas. Aplicações comuns de CRISPR incluem de mutações do gene alvo1, genoma engenharia2, Epigenoma edição3, ativação transcricional e4de silenciamento do gene. Uma vantagem particular do sistema CRISPR é que suas aplicações não estão limitadas a sites de candidatos bem estudado, como bibliotecas de gRNA fazem menos tendenciosas telas possível. Estas facilitam a descoberta dos loci funcionais no genoma sem qualquer conhecimento prévio de experimental. No entanto, construção de biblioteca de gRNA baseia-se atualmente principalmente na síntese de oligo-nucleotide e existem opções limitadas para comprar gRNA bibliotecas que não são de humanos ou regiões de origem ou destino do mouse fora abra frames de leitura. Assim, embora CRISPR telas já provaram ser incrivelmente potente5,6,7,8, todo o seu potencial ainda não tenha sido explorado.

Para superar a limitação de duas estratégias de gRNA clássica geração métodos foram desenvolvidos recentemente. Ambos são baseados em digestão enzimática controlada do DNA alvo, em vez de depender de síntese do oligonucleotide personalizado. Enquanto CORALINA9 emprega micrococcal nuclease, o método alternativo disponível apenas atualmente, comedores de CRISPR10, faz uso de enzimas de restrição (HpaII, ScrFeu, Bfaeu e Mmeeu). Importante, ambas as técnicas podem ser aplicadas a qualquer entrada DNA, que serve como a fonte de gRNA protospacer sequências. Enquanto o método CRISPR-comendo emprega uma estratégia para diminuir o número de clonado gRNAs cujos sítios alvos não são seguidos pelo necessário S.pyogenes PAM (protospacer motivo adjacente), que gera apenas uma pequena fração de todos os possíveis gRNAs funcionais para uma determinada região. CORALINA, por outro lado, é capaz de gerar todos os gRNAs potenciais para a sequência de origem, mas também incorpora uma fração maior de guias não-funcional. geração de biblioteca gRNA através da actividade nuclease controlada permite a produção de bibliotecas de gRNA abrangente para todas as espécies, qualquer sistema Cas9-proteína ou - effector de forma simples e econômica. Além disso, a CORALINA é adaptável a personalização, como opções apropriadas de entrada e o vetor de definam o tipo de biblioteca, o tamanho e o conteúdo. Aqui, um protocolo detalhado é apresentado que pode ser usado para a geração de bibliotecas gRNA abrangente de diversas fontes de DNA (Figura 1), incluindo os cromossomos artificiais bacterianos (BACs) ou de DNA genômico9. Os resultados representativos que acompanha este protocolo foram derivados aplicando o protocolo CORALINA ao DNA de BAC.

Protocol

1. a digestão do DNA com Nuclease Micrococcal

  1. Realize uma reação de otimização para cada novo lote de enzima nuclease micrococcal (MNase).
    Nota: O número de unidades de MNase usados deve ser testado (usando uma diluição serial, Figura 2A). Normalmente, 5-10 U de MNase digest 1 µ g de purificado genoma ou DNA BAC até um intervalo de 5-100 bp com as condições descritas abaixo.
  2. Por reação, configurar 1 µ l de 10 x MNase Buffer, 1 x albumina de soro bovino (BSA), 1 µ g do ADN, 1 µ l de MNase alvo (0.1-50 unidades) em um volume de reação de 10 µ l.
  3. Incube a 37 ° C por 15 min.
  4. Imediatamente, inativar a enzima adicionando 1 µ l de 500mm glicol de etileno-bis(β-aminoethyl ether)-N, N, N', N'-ácido etilenodiaminotetracético (EGTA).

2. separação de DNA fragmentos usando electroforese em Gel de poliacrilamida (PAGE)

  1. Adicionar a amostra reserva/gel corante para amostras de DNA de carga e carregar para um 20% gel PAGE. Carregar uma escada de DNA apropriada para dimensionamento (5 bp DNA Ladder). Não sobrecarregue o gel (1 µ g DNA por alvéolo).
  2. Corra géis no apropriado 1x TRIS-borato-EDTA (TBE) execução buffer a 150 V (constante) para em torno de 1,5 h ou até a menor frente de tintura (bromofenol azul, escuro cor azul) que viaja a cerca de 15 bp, atinge a extremidade inferior do gel.
  3. Manchar o gel usando uma mancha ultra sensível do ácido nucleico e visualize sob luz UV.
  4. Na imagem de gel, determine a concentração ideal de MNase para digestão de DNA até 20-30 bp em tamanho.
  5. Use a concentração otimizada de MNase para digerir o ADN do alvo, repetindo as etapas 1,2-2.2. Geralmente, criação de 10-12 reações (ou seja, 10-12 µ g do total de material começar) irão produzir suficiente digerido DNA após a extração do gel de página para prosseguir para as etapas subsequentes.
  6. Usando um bisturi estéril, cortar o gel ao lado da pista de marcador e mancha apenas a parte do gel contendo a escada com fresco 1 x TBE execução buffer contendo 1 X de uma mancha de ultra sensível do ácido nucleico. Visualize a escada de DNA e fragmentos de DNA digerido MNase na faixa de tamanho entre aproximadamente 18-30 bp usando uma lâmina de barbear impostos especiais de consumo.
    Nota: Evite expor os fragmentos MNase digerido à luz UV. É possível usar uma fonte de luz azul (em vez de UV) ou ter uma imagem da escada sob luz ultravioleta, imprimi-lo para escalar e usam isto para guiar a excisão de fragmentos de DNA MNase-digerido). Esta etapa evita manchar e exposição de fragmentos de DNA à luz UV. Sempre use um bisturi descartável estéril, não utilizada ou lâmina de barbear para esta etapa para evitar contaminação.
  7. Transfira a fatia de gel para um tubo de microcentrifugadora.
  8. Manchar o restante do gel com ácido nucleico mancha como acima, expor à luz UV e gravar uma imagem para manter um registro da etapa de excisão de gel.

3. isolamento de fragmentos de DNA de géis de página usando o esmagamento e o método de imersão

Nota: Este passo foi adoptado pelo Sambrook et al . 11

  1. Prepare página amortecedor de solubilização de gel (1,88 mL de acetato de amônio de 4 M, 150 µ l de acetato de magnésio de 1 M, 30 µ l de 0,5 M ácido etilenodiaminotetracético (EDTA) (pH 8) em ultrapura H2O para um volume total de 15 mL).
  2. Esmaga a fatia extirpado gel contra a parede do microtubo usando uma ponta de pipeta estéril.
  3. Adicione 2 volumes de tampão de solubilização de página do gel e incubar a 37 ° C, durante 16 h em uma plataforma giratória.
  4. Centrifugar as amostras por 1 min na velocidade máxima em um microcentrifuge. Transferi o sobrenadante para um tubo de microcentrifugadora novo, tomando cuidado para não transferir quaisquer pedaços de gel esmagado.
  5. Adicionar 0,5 volumes de tampão de solubilização de página para o gel de Pelotas, vórtice e repetir a centrifugação (passo 3.4). Combine os sobrenadantes.
  6. Extrair os fragmentos de DNA usando extração padrão fenol-clorofórmio.
    Cuidado: Fenol é tóxico se ele entra em contato com a pele ou ingestão. Precauções de segurança tais como luvas, óculos de proteção, jaleco e trabalhando em uma coifa são críticas. Elimine todos os resíduos que contenham fenol, de acordo com regulamentos do Instituto.
    1. Adicione um volume de álcool isoamílico: fenol: clorofórmio (25:24:1) para a amostra e o vórtice completamente.
    2. Centrifugar por 10 minutos na velocidade máxima (16.000 x g) em uma centrífuga de mesa à temperatura ambiente. Transferi com cuidado, a fase aquosa superior para um tubo de microcentrifugadora fresco. Tome cuidado para não transitar qualquer fenol durante a pipetagem.
    3. Repita as etapas 3.6.1 e 3.6.2 uma vez.
    4. Adicionar uma pequena quantidade (0,2 µ l) de glicogênio, 0,1 volumes de acetato de sódio 3M (pH 5.2) e 2 volumes de 100% de etanol (EtOH).
    5. Vórtex e incubar a-20 º C por várias horas ou durante a noite.
    6. Centrífuga para 30 min na velocidade máxima a 4 ° C, utilizando uma centrífuga do tabletop.
    7. Cuidadosamente, remover o sobrenadante e lavar o sedimento de DNA com 70% EtOH.
    8. Centrífuga para 30 min na velocidade máxima a 4 ° C, utilizando uma centrífuga do tabletop.
    9. Remover o sobrenadante e secar o sedimento de DNA. Certifique-se de que todos o EtOH tenha evaporado, mas tenha cuidado para não secar demasiado a pelota.
    10. Dissolver o sedimento de DNA em 12 µ l de H2O.
      Nota: A extração do gel de página é muito ineficiente. Para cada 10 µ g de DNA digerido com MNase a começar, esperamos recuperar 1-20 ng de fragmentos purificados após a extração do gel. Controlar a quantidade e a integridade dos fragmentos carregando 1/6th (2 µ l) em um gel de página (Figura 2).

4. final reparação de fragmentos MNase-digerido, Gel-purificado

  1. Configurar a seguinte reação usando um DNA embotamento kit: 10 µ l de DNA purificado da etapa 3.6.10, 1,5 µ l de 10x embotamento buffer de 1,5 µ l do mix de 1 mM dNTP, 0,6 µ l da enzima embotamento, 1,4 µ l de H2O.
  2. Incubar a 22 ° C por 30 min e então calor-inativar a enzima por incubação a 70 ° C durante 10 min.
  3. Adicione 85 µ l de H2O e realizar uma reação limpar usando padrão fenol/clorofórmio-extração e EtOH-precipitação (conforme descrito na seção 3.6). Proceda de imediato à ligadura de vinculador.

5. o vinculador geração

Nota: Linkers precisam ser amplificado em paralelo com a seção 3 para poderes prosseguir imediatamente com ligadura de vinculador. Usado abaixo de sequências da primeira demão devem ser apropriadas para o vetor de expressão gRNA escolhido. Aqueles aqui apresentados foram concebidos para o vetor pgRNA-pLKO.1. 9 para a amplificação do vinculador 5' do pgRNA-pLKO.1, use a primeira demão sequências 5'-vinculador-F (TTGGAATCACACGACCTGGA) e 5'-vinculador-R (CGGTGTTTCGTCCTTTCCAC), rendendo um amplicon bp 689. Para a amplificação do vinculador 3' do pgRNA-pLKO.1, use as primeiras demão 3' vinculador-f: (GTTTTAGAGCTAGAAATAGCAAGTTAAAATA) e 3'-vinculador-r: (ACTCGGTCATGGTAAGCTCC), que rendem um amplicon bp 848.

  1. O adaptador de PCR-amplificar sequências do vetor de expressão de gRNA (usando reagentes de escolha e sequências de personalizado da primeira demão, se necessário). Para configurar a seguinte reação de PCR de 50 µ l do pgRNA-pLKO.1: 25 µ l de mistura de mestre de PCR, 2,5 µ l de primer F (10 µM), 2,5 µ l de primer R (10 µM), 0,1 ng do vetor de expressão de gRNA (pgRNA-pLKO.1) em H2O.
  2. Incubar as reações em um thermocycler usando as seguintes condições: 1 ciclo de 98 ° C por 30 s, 32 ciclos 98 ° C por 10 s, 59 ° C, durante 10 s, 72 ° C por 30 s, 1 ciclo de 72 ° C por 10 min.
  3. Purifica as reações de PCR usando grânulos de imobilização reversível de fase sólida de acordo com as instruções do fabricante. Eluir em 30 µ l de H2O.
  4. Para impor a ligadura direcional do vinculador aos fragmentos de DNA de final-reparado, MNase-digerido, linkers digerir com enzimas de restrição apropriadas (aqui HindIII e SacII). Configure as seguintes reações:
    1. Para a digestão de 5' vinculador com HindIII, use 30 µ l de vinculador amplicons de purificado 5' da etapa 5.3., 5 µ l de Buffer, 3 µ l de HindIII (20U / µ l) e 12 µ l de H2O.
    2. Para a digestão de 3' vinculador com SacII, usar 30 µ l de 3 purificado ' vinculador amplicons da etapa 5.3., 5 µ l de Buffer, 3 µ l de SacII (20 U / µ l) e 12 µ l de H2O.
  5. Incube digere a 37 ° C por 3 h.
  6. Adicione gel ADN carregando tintura e executar digere a enzima de restrição em um gel de agarose 1%. Excisar as bandas em 637 bp (Resumo de vinculador de 5') e 295 bp (3' digest de vinculador).
  7. Purifica o DNA das peças extirpado gel usando um kit de extração do gel.

6. o vinculador ligadura e amplificação de inserções

  1. Configure uma reação de ligadura µ 14 l usando montantes equimolar de fragmentos MNase-digerido, fim-reparado e sequências de vinculador.
    Nota: O vinculador a rácios de fragmento pode ser otimizado. Recomenda-se incluir uma reação de controle não-fragmento (NFC).
    1. Uso 5 ng MNase-digerido fragmentos (final-reparado e purificado), 120 ng de 5' vinculador (digerirHindIII, purificada), 55 ng de 3' vinculador (SacII s digest, purificada), 1.4 µ l de T4 ligase Buffer e 1,4 µ l de concentrado ligase do ADN T4 em H2O.
  2. Incube as reações de ligadura a 16 ° C, durante 16 h. Fazer não calor-inativar a enzima. Proceda de imediato à conversão de nick.
    Nota: Os fragmentos MNase-digerido reparada a fim fornecem os necessário de 5' fosfatos para ligadura dos linkers, como o vinculador si são un-fosforiladas.
  3. Para a ligadura da reação (e a reação de NFC) adicionam o seguinte: 25 µ l de Taq 2 X mestre mistura (capaz de nick tradução), 2,5 µ l de primer vinculador-Minus450-F (10 µM, GGGCAAGTTTGTGGAATTGG), 2,5 µ l de primer vinculador-Plus275-R (10 µM, AAGTGGATCTCTGCTGTCCC) e 6 µ l de H2O.
  4. Inclua um controle de não-modelo (NTC). Incubar as reações em um thermocycler usando as seguintes condições: 1 ciclo (tradução de nick): 72 ° C por 20 min, 1 ciclo: 95 ° C por 5 min, 3-4 ciclos: 95 ° C por 15 s, 58 ° C, por 15 s, 72 ° C por 30 s, 1 ciclo: 72 ° C por 5 min.
  5. Execute uma reação limpar usando grânulos de imobilização reversível de fase sólida com uma amostra para a proporção de grânulo de 1:1. Eluir em 40 µ l de H2O.
  6. Ampliar ainda mais o fragmento desejado (5' vinculador + MNase + 3 do fragmento ' vinculador) usando reagentes apropriados do PCR e os primers a seguintes:
    1. Use a 12,5 µ l de mistura de mestre de PCR, 1,25 µ l de primer vinculador-Minus450-F (10 µM, GGGCAAGTTTGTGGAATTGG), 1,25 µ l de primer vinculador-Plus275-R (10 µM, AAGTGGATCTCTGCTGTCCC), 2,5 µ l de produto de tradução nick purificado da etapa 6.4. e 7,5 µ l de H2O. Use as seguintes condições: 1 ciclo: 98 ° C por 30 s, 10-16 ciclos: 98 ° C, durante 10 s, 63 ° C, durante 10 s, 72 ° C por 15 s, 1 ciclo: 72 ° C por 10 min.
      Nota: Se necessário, várias reações podem ser configurar em paralelo para garantir que não há suficiente produto do PCR para as etapas subsequentes. Para visualizar a pequenas quantidades do produto do PCR em um gel de agarose, configurar reações adicionais como na etapa 6.5 e aumentar o número de ciclo de 15 a 32. Esta reação pode ser usada como controle de qualidade, se amplicons não são visíveis após 15 ciclos. Incluem também um sem controle do modelo (NTC).

7. seleção do tamanho

Nota: Este passo separa MNase-fragmentos com o vinculador corretamente anexado de 5' e 3' fragmentos com dois 5' ou dois 3' linkers baseiam no tamanho.

  1. Combinar todas as reações de PCR 15-ciclo da etapa 6.5., adicionar DNA tintura a carregar e executar em um gel de agarose 0,8%. Impostos especiais de consumo a banda proeminente em 869 bp e purificar DNA usando um kit de extração do gel.
  2. Quantificar a quantidade de DNA (por exemplo, usando um spectrophotometer).

8. clonagem de fragmentos amplificados por PCR para o vetor de expressão por Gibson Assembly gRNA

  1. Preparar a Assembleia mestre mistura da seguinte forma:
    Nota: As etapas a seguir são adaptadas de Gibson et al . 12.
    1. Criar 6 mL de tampão de reação isotérmica combinando 3 mL de 1 M Tris (hidroximetil) aminometano (Tris)-HCl pH 7,5, 300 µ l de 1 M de MgCl, 60 µ l de trifosfato de Desoxiguanosina 100mm (dGTP), 60 µ l de trifosfato de Desoxiadenosina 100 mM (dATP), 60 µ l de cromatografia de 100mm trifosfato (dTTP), 60 µ l de trifosfato de Desoxicitidina 100mm (dCTP), 300 µ l de 1m ditiotreitol (DTT), 1,5 g de polietileno glicol (PEG)-8000, 300 µ l de 100mm nicotinamida adenina dinucleótido (NAD) em ultrapura H2O.
      Nota: Esta reserva pode ser aliquotadas e armazenado a-20 ° C.
    2. Criar 1,2 mL montagem mestre mistura combinando 320 µ l de 5 X amortecedor da reação isotérmica, 3 µ l de 10 U / µ l T5 do exonuclease, 20 µ l de 2 U / µ l DNA polimerase, 160 µ l de 40 ligase de U / µ l de DNA em ultrapura H2O. uso de 15 µ l do mix de mestre de montagem com 5 µ l de inserir.
      Nota: A mistura de mestre de montagem pode ser aliquotadas e armazenado a-20 ° C, onde é estável por mais de um ano e pode tolerar vários ciclos de congelamento e descongelamento. A quantidade escolhida de T5 do exonuclease é ideal para uso com longas saliências.
  2. Digestão de espinha dorsal do vetor
    Nota: Certifique-se de digerir uma quantidade suficiente de vetor como entrada para o número desejado de reações de montagem no passo 8.3.
    1. Por reação, adicione o seguinte: 1,5 µ g de vetor de expressão de gRNA (pgRNA-pLKO.1), 5 µ l de tampão, 1,5 µ l de idadeeu (5U / µ l) e 38,5 µ l de H2O. Incubar digerir a 37 ° C por 2 h.
  3. Desfosforilação do vetor tornado linear.
    Nota: Este passo é aconselhado, mas não é estritamente necessário. T5 exonuclease na mistura mestre principalmente removerá a idadeeu saliências antes o Taq DNA ligase tenha tido a oportunidade de agir. Portanto, não se espera excessiva re-ligadura do vetor.
    1. Adicione 2,5 µ l da enzima fosfatase alcalina de camarão (rSAP, 1 U / µ l).
    2. Incubar a 37 ° C por 30 min e em seguida, inativar a enzima incubando a 65 ° C por 5 min.
  4. Realizar a purificação do DNA
    Nota: É aconselhável executar uma etapa de extração do gel de agarose. Alternativamente, purificação do grânulo ou coluna pode ser usada. É importante verificar que a digestão de vetor é completa, por exemplo, por eletroforese em gel de agarose. Para comparação, o vetor não digerido deve ser executado em paralelo.
  5. Quantificar a quantidade de vetor digerido purificada na amostra.
  6. Configure a montagem com 2 vezes excesso molar de inserções para vector. Por 20 µ l reação uso 100 ng do vetor (idadeeu digiro da etapa 8.5), 12.2 ng de inserir (da etapa 7.1.), 15 µ l do mix mestre de montagem da etapa 8.1.2. em H2O.
  7. Incube a 50 ° C, durante 1 h.
  8. Purifica as reações usando purificação da coluna. Resuspenda o DNA em 75 µ l de H2O (ou apropriado volume, dependendo da escala de eletroporação).
    Nota: A eficiência de transformação é extremamente dependente de pureza do DNA. Etapas de purificação adicional (por exemplo, extração fenol/clorofórmio) podem melhorar a eficiência.

9. preparação de células de Escherichia coli competente Electro TG1

  1. Certifique-se de que todos centrifugar garrafas e frascos estão livres de detergentes por lavagem e posterior enchimento com água destilada antes de esterilizar.
    Nota: Este passo ajuda a eliminar as impurezas que podem afetar a eficiência de transformação. Água, deve ser descartada imediatamente antes do uso. Alternativamente, o uso de garrafas descartáveis de centrifugação pode ser aconselhável.
  2. Certifique-se que garrafas de centrífuga, tubos e soluções utilizadas para a preparação de células electrocompetent são refrigeradas na prévia de gelo para usar. É melhor realizar as seguintes etapas em um quarto frio para minimizar as flutuações de temperatura que podem afetar a eficiência de transformação.
  3. Prepare 2TY médio. Com 16 g de bacto triptona, 10 g de extrato de levedura e 5 g de NaCl, adicionem água destilada 1L, mistura e autoclave. Meio de armazenamento à temperatura ambiente.
  4. Prepare pratos de bioensaio 2TY-agar revestido e cm 10 placas de Petri contendo o antibiótico adequado. Placas de armazenamento a 4 ° C.
    Nota: A escolha do antibiótico depende da natureza do vetor de expressão de gRNA, uso 100 µ g/mL de ampicilina para pgRNA-pLKO.1.
  5. Raspa de um estoque de glicerol de células TG1 para inocular 10 mL de meio de 2TY (sem antibióticos).
  6. Incube a cultura, a 37 ° C durante a noite (~ 16 h), com agitação a 225 rpm.
  7. Inocular a 10 mL de cultura durante a noite (diluição 1/100) 1 L de meio de 2TY (sem antibióticos) e divida igualmente entre dois balões de 2 L (contendo os defletores).
  8. Incube a cultura a 37 ° C, 225 rpm até atingir uma OD600 nm de 0,55 (aproximadamente após 1,5 a 2 h). Use um espectrofotômetro para verificar OD600 nm regularmente.
  9. Culturas de frio no gelo por 30 min.
  10. Dividi a cultura igualmente entre quatro garrafas de 500 mL centrífuga (pré-refrigerado no gelo).
  11. Centrifugar por 15 min a 4.000 x g a 4 ° C em uma centrífuga previamente refrigerada.
  12. Sobrenadantes de decantar e adicionar 1 volume (ou seja, 250 mL) de pre-refrigerados gelada estéril destilada H2O para cada uma das garrafas de centrífuga. Resuspenda o pellet bacteriano por agitação ou invertendo o frasco (ou pipetando suave, se necessário).
    Nota: É mais fácil Ressuspender o primeiro adicionando um pequeno volume de água. Garantir que a pelota é completamente resuspended eventualmente.
  13. Centrifugar por 15 min a 4.000 x g a 4 ° C.
  14. Repetir a lavagem duas vezes (passos 9.12. e 9,13). Remova o sobrenadante. Tenha cuidado quando decantação como a pelota bacteriana torna-se cada vez mais solta, após a lavagem.
  15. Resuspenda o pellet em 50 mL de glicerol a 10% estéril, gelada e transferi-lo para um tubo de centrifugação pré-50ml refrigerados.
  16. Células de centrifugar por 15 min a ~ 4.000 x g a 4 ° C. Remova cuidadosamente o sobrenadante.
  17. Delicadamente Ressuspender as bactérias em 2 mL de glicerol a 10% estéril gelada.
  18. Manter em gelo, se as células devem ser usados imediatamente para eletroporação.
    Nota: As células podem ser congeladas em alíquotas de 50 µ l em tubos de 0,5 mL em banho de gelo seco-etanol e armazenadas a-80 ° C, mas isso não é recomendado.

10. eletroporação de células de Escherichia coli Electrocompetent TG1

Nota: Eletroporação é um dos gargalos em geração de biblioteca abrangente. Para preservar a representação de biblioteca, é recomendável realizar tantas reacções individuais electroporation quanto possível/necessário e para executar as etapas de controle de qualidade descritas abaixo (10.6. e 10.8.).

  1. Tubos de alíquota as reações purificadas (da etapa 8,8) em PCR estéril e pre-refrigerado e mantê-los no gelo (1 µ l pelo tubo). Fica frio cubetas de eletroporação de lacuna de 1 mm no gelo.
  2. Adicione 25 µ l de células de TG1 preparadas diretamente a uma alíquota de DNA e imediatamente, transfira a mistura para uma cubeta de eletroporação. Súbito ou toque a cubeta para assegurar a mistura de células/DNA é distribuído ao longo do comprimento da câmara de cubeta (sem ar aprisionado ou bolhas).
  3. Colocar a cubeta na câmara de slide e iniciar o programa de eletroporação apropriado (por exemplo, 1 pulso de 1,8 kV (EC1)).
    Nota: A constante de tempo deve estar entre 5,7 e 6,0 ms. no caso dos arcos electroporator, flick a cubeta, garantir que não há nenhuma bolha de ar na câmara e tente novamente.
  4. Imediatamente adicione 975 µ l de temperatura 2TY médio para a cubeta.
  5. Utilizando uma pipeta de transferência, mova as bactérias electroporated para um tubo de 50 mL. Repita da etapa 10.2. e recolher todas as células transformadas com uma biblioteca em um tubo de 50 mL.
  6. O volume total do documento.
  7. Etapa de controle de qualidade
    1. Para quantificar a competência das células recém geradas electro-competente, realize uma reação de eletroporação separadas usando uma quantidade definida de uncut plasmídeo (por exemplo, 10 pg pUC19 controle do plasmídeo). Transferi isto para um tubo de microcentrífuga de 1,5 mL.
      Nota: A competência deve ser pelo menos 1010 formadoras unidades (cfu) por µ g de DNA. Células preparadas geralmente executam melhor do que isso.
  8. Incube a bactéria transformada a 37 ° C por 60 min tremendo a 225 rpm.
  9. Etapa de controle de qualidade:
    1. Placa de uma pequena quantidade definida de bactéria transformada com a biblioteca (por exemplo, 10 µ l de uma diluição de dobra de 10-100) em uma placa de ágar de 10 cm com a seleção apropriada de antibióticos.
      Nota: Sabendo que o volume total da cultura (da etapa 10.6.), o número de colônia obtidos pode ser usado para estimar o número total de colônias por toda a biblioteca. representação de dobra de 20-30 da biblioteca idealmente deve ser mantida.
  10. Disperse o restante das bactérias para 2TY agar revestido bioensaio pratos contendo a seleção apropriada de antibióticos.
    Nota: O volume da cultura pode ser reduzido por centrifugação a ~ 4.000 x g durante 10 minutos (ou até um sedimento visível tem formado e o sobrenadante claro). Isto reduz o tempo de placas precisam secar após a disseminação da cultura. Uso de placas ao invés de cultura líquida minimiza o crescimento desproporcional das colônias individuais. 13
  11. Espalhe um volume adequado da reação de eletroporação de controle pUC19 em um prato de ágar de adicional de 10 cm com seleção antibiótica apropriada.
  12. Incubar as placas de ágar durante a noite (16 h) a 37 ° C.
  13. Conte colônias obtidas com as placas de controle (placa pUC19 e controle da biblioteca) para estimar CFU / µ g DNA para as bactérias bem como a complexidade de biblioteca.

11. extração de DNA de plasmídeo

  1. Adicionar 10 mL de mídia 2-TY para as placas durante a noite, raspar a camada bacteriana no prato usando um difusor de descartável e recolhê-la em um tubo de 50 mL. Repita algumas vezes até que todos da placa aparece limpo.
  2. Extrair DNA usando um kit de plasmídeo Maxi (2-3 colunas necessárias por Bio-ensaio da placa).

Representative Results

Usando o protocolo em mãos, bibliotecas de gRNA CORALINA foram geradas de humanos e de DNA genômico de rato9 e BAC DNA (Figura 1). Para produzir fragmentos de DNA de entrada apropriado para clonagem em vetores de expressão gRNA, condições ideais para a digestão controlada nuclease precisa ser determinado. Um resultado típico para a otimização da digestão micrococcal nuclease é retratado na Figura 2A. Quantidade insuficiente de nuclease (0,1, 2, 3, 4, 4.5 ou 5 unidades) produz sem produtos perceptíveis na faixa de tamanho necessário (10-100 bp) e 5,5-7,5 unidades ainda produziram fragmentos que são em média muito tempo. Maiores quantidades de enzima (50 unidades) levam a degradação excessiva de entrada DNA após 10 min. Consequentemente, uma quantidade intermediária foi escolhida (10 unidades). O resumo foi aumentado produzir suficiente digerido fragmentos para purificação subsequente e clonagem (Figura 2B). Enquanto é recomendável cegamente selecionar fragmentos de DNA por tamanho e só contar com a escada de DNA para orientação minimizar a exposição de fragmentos de DNA à luz UV, géis podem ser manchados depois para controle de qualidade da digestão e do corte. Figura 2B mostra um exemplo representativo de um gel de página da qual DNA fragmentos entre 20 e 30 bp tem sido extirpados. Gel purificada MNase fragmentos foram carregados em um 20% gel de página para verificar a seleção de tamanho sucesso e purificação de fragmentos de MNase-digerido (Figura 2). O protocolo na mão é compatível com o uso de sequências de vinculador personalizado, permitindo a clonar os fragmentos MNase-digerido em vetores de expressão gRNA de escolha. Aqui, gRNA-PLKO9 foi usado como backbone. Os linkers são amplificados do vetor de expressão gRNA usando PCR padrão. Figura 2D retrata um exemplo representativo de sequências de vinculador amplificado desprovida de adicionais, incorreto ou sem amplicons de modelo. Em seguida, vinculador amplicons são digeridas com enzimas de restrição para assegurar linkers são ligados para os fragmentos MNase-digerido na orientação correta. Mostra Figura 2D gel de agarose de linkers 5' e 3' antes e depois da digestão com HindIII e SacII, respectivamente, indicando a digestão completa dos linkers o predito 637 e 295 bp. Porção direita da imagem gel de documentos a excisão dos fragmentos do vinculador digerido. Seguinte gel extração de linkers digeridos, o próximo passo no protocolo é a ligadura dos linkers aos fragmentos MNase-digerido final-reparado. Como sequências de vinculador são geradas por PCR utilizando primers unphosphorylated, Auto ligadura dos linkers não deveria ocorrer. Apenas os fragmentos de DNA digerido MNase reparado a fim fornecem os necessário para ligadura de grupos fosfato. Após tradução de nick, o produto da ligadura é amplificado por PCR. Para evitar excessivo viés de amplificação da PCR que podem distorcer a representação das sequências de gRNA na biblioteca, amplificação é limitada a menos de 20 ciclos no total. Após a PCR, os produtos de amplificação são difíceis de Visualizar em gel de agarose. PCRs controle separado com 32 ciclos, portanto, são realizados para detectar os produtos (mas não são usados para a preparação de biblioteca). Os resultados deste controle PCR são mostrados na Figura 2E. Isto permite otimizar as reações da ligadura e certifique-se de reações são desprovidas de artefactos PCR, que às vezes ocorrem em "controles sem fragmentos" (NFC). Figura 2E mostra o amplicon desejado (5' vinculador, fragmento de DNA + 3' vinculador, comprimento: 869 bp) seguindo a amplificação das reações de ligadura usando relações equimolar de (1:1) entre fragmentos e sequências de vinculador.

Figure 1
Figura 1 : Sugeriu o cronograma para a preparação de uma biblioteca de gRNA. CORALINA oferece uma estratégia simples e eficiente para a geração de bibliotecas gRNA abrangente de uma infinidade de diferentes fontes de DNA de qualquer organismo. O protocolo na mão pode ser levado à conclusão durante uma semana. Geração de vinculador pode ser realizada em paralelo com final-reparação do DNA. Preparação de bactérias electrocompetent leva dois dias e inclui uma etapa de crescimento durante a noite e, portanto, deve ser iniciada antes da montagem, as reações são criadas. Clique aqui para ver uma versão maior desta figura.

Figure 2
Figura 2 : Passos críticos durante o protocolo de. (A) controladas digestão do DNA de BAC permite geração de fragmentos de diferentes tamanhos. Mostrado aqui é a otimização da digestão MNase. DNA purificado de BAC foi tratada com diferentes quantidades de MNase por 10 min. 10 U de MNase gerar fragmentos do ADN do comprimento desejado (bp 20-30). (B) seleção de fragmentos entre 20 e 30 bp usando excisão do gel de polyacrylamide do tamanho. DNA purificado de BAC foi tratado com 10 U de MNase por 10 min. A imagem foi gravada após excisão. (C) controle de qualidade de fragmentos de gel-purificado. Após a purificação de gel, 1/6 de MNase o purificado fragmentos foi carregado em um 20% gel de página para verificar a seleção de tamanho sucesso e purificação. (D) amplificação de sequências de vinculador para digestão de montagem e enzima de restrição de linkers para garantir a clonagem direcional. linkers 5' e 3' foram amplificados e corte com HindIII e SacII, respectivamente. Controles não-modelo (NTC) foram incluídos para controle de contaminação de DNA e PCR artefactos. Esquerda: aplicativo de amostra para análise; Certo: aplicativo de exemplo preparativa. Imagem foi gravada após a excisão de gel. (E) bem sucedida ligadura dos linkers de fragmentos de DNA pode ser analisada usando PCR com um aumento do número de ciclos PCR (32) e controlada por executar sem controles de modelo com H2O (NTC) ou usando o NTC da etapa anterior para a tradução de nick como entrada (NTC NT)). É importante não incluir um nenhum fragmento controle (NFC), que é uma ampliação de uma ligadura e a reação de nick tradução do qual foram omitidos os fragmentos de MNase. Apenas amostras no qual MNase fragmentos foram combinados com DNA de vinculador produzem o amplicon esperado (869 bp). Clique aqui para ver uma versão maior desta figura.

Discussion

CORALINA pode ser usado para gerar bibliotecas de gRNA em grande escala por digestão controlada nuclease do ADN alvo e clonagem de fragmentos encalhados dobro resultantes a granel. Inferência estatística indica que muitos mais do que 107 sequências de gRNA individuais já foram com sucesso clonadas usando o protocolo na mão9. CORALINA pode ser personalizado de várias maneiras. A escolha do modelo de DNA define a região de destino e a complexidade máxima da biblioteca gerada. Usando este protocolo, bibliotecas CORALINA anteriormente foram geradas de humano e DNA genômico de rato9. Resultados representativos aqui apresentados retratam a geração de uma biblioteca CORALINA de DNA purificado de BAC. Personalização pode ser alcançada pela escolha de gRNA expressão vetorial e vinculador sequências. Anteriormente, nós testamos três pares diferentes de comprimentos de vinculador de assembly de Gibson, com pequenas variações na eficiência9.

Devido a sua origem a partir de DNA em massa digerida, protospacer de CORALINA gRNAs geralmente não são exatamente 20 bp em comprimento, mas mostrar uma distribuição de comprimento, com uma média que depende de ambos os parâmetros da digestão MNase, bem como o tamanho da excisão feita a partir do gel de página s. representativo exemplo mostrado na Figura 2B e C, retrata fragmentos com um comprimento médio entre 19 e 27 bp. Em nossa experiência, o comprimento dos fragmentos é fielmente preservado pelo gRNA gerado protospacer9. Enquanto fragmentos menores do que 20 bp deve ser evitado devido à taxa mais elevada do alvo de gRNAs resultante, mais fragmentos são provavelmente muito menos de um problema para aplicações a jusante, uma vez que tem sido demonstraram que gRNAs com protospacers, enquanto 45 bp são ainda funcional,9.

As duas etapas mais críticas no protocolo CORALINA são a seleção de tamanho de fragmentos MNase-digerido e passos de clonagem. Geração de fragmentos que são muito curtos (por exemplo, média abaixo de 18 bp) ou incorporação de muitos vetores de expressão vazia gRNA processará a biblioteca inútil. Assim, é importante otimizar a etapa de digestão de MNase (Figura 2A), para monitorar a excisão (Figura 2B, C), verificar para a digestão completa do backbone vector gRNA e não incluindo controles nenhum fragmento em todo o protocolo. Cuidados especiais também tem que ser tomado para preservar a representação da biblioteca gRNA. Em geral, um gargalo comum de geração de biblioteca é a transferência eficiente de plasmídeos em bactérias para a amplificação. Assim, grandes quantidades de bactérias com excelente competência e um grande número de eventos electroporation individuais são necessários para atingir um elevado número de clones de gRNA.

Novas estratégias para a produção de biblioteca de gRNA será necessárias colher todo o potencial de rastreio baseado em CRISPR abordagens durante as próximas décadas. Há uma demanda significativa por métodos de baixo custo, simples e customizáveis gerar bibliotecas em grande escala, um pré-requisito para fazer triagem passível de um maior número de sistemas modelo e diferentes abordagens de engenharia baseada em CRISPR. CORALINA constitui um primeiro passo para isso. Os usos potenciais são múltiplos, especialmente para produzir abrangentes bibliotecas de genomas, cDNA derivados bibliotecas de sistemas modelo menos comuns, bibliotecas altamente concentradas e experimentais set-ups no quais diferentes proteínas CRISPR (com diferente PAM requisitos) são usados em combinação.

Ao contrário de outros métodos, CORALINA gera todos os possíveis gRNAs da entrada DNA. No entanto, uma desvantagem do método é que gRNAs falta a necessária sequência PAM também estão incluídos na biblioteca, uma característica que ele compartilha com um segundo método enzimático para a geração de biblioteca gRNA CRISPR-comer (tabela 1). A escolha do método ideal para geração de biblioteca gRNA depende das especificações da análise planejada experiência, especialmente a natureza (genic, regulamentar, intergênica) e o tamanho da região de destino (locus único, várias regiões, todo o genoma). Vemos uma cabeça especial em usar CORALINA quando um grande número de não-codificantes ou regiões reguladoras estão a ser analisados, se não houver informações de sequência incompleta ou não confiáveis (sistemas modelo exótico, misturas de espécies (por exemplo, microbiomes) ou obtidos experimentalmente entrada), se as endonucleases CRISPR diferentes são combinadas ou se saturando a análise é realizada em um locus curto e definido (por exemplo, representada por BACs).

Disclosures

Os autores não têm nada para divulgar.

Acknowledgments

Os autores gostaria de agradecer sua entrada Prof. Dr. Stephan Beck e Prof Dr. Magdalena Goetz, ajudar e apoiar no desenvolvimento do método de CORALINA, Maximilian Wiessbeck e Valentin Baumann para comentários úteis. O trabalho foi apoiado pelo DFG (STR 1385/1-1).

Materials

Name Company Catalog Number Comments
500 mM EGTA Sigma Aldrich 03777-10G 1.4., Inactivation of Mnase
Novex Hi-Density TBE Sample Buffer Thermo Fisher Scientific LC6678 2.1.
Novex® TBE Gels, 20%, 10 well Thermo Fisher Scientific EC6315BOX 2.1., pre-made 20 % PAGE gel
O'RangeRuler 5 bp DNA Ladder, Thermo Fisher Scientific SM1303 2.1.
Novex® TBE Running Buffer Thermo Fisher Scientific LC6675 2.1., PAGE gel running buffer
Disposable scalpel, sterile VWR  233-5363  2.3., other equivalent reagents may be used
SYBR Green I nucleic acid stain (1000x concentrate in DMSO) Sigma Aldrich
S9430
2.3. +2.5., also available from Thermo Fisher Scientific (S7563)
UltraPure Phenol:Chloroform:Isoamyl Alcohol (25:24:1) Thermo Fisher Scientific 15593-031 3.6.1. + 4.3., other equivalent reagents may be used
Glycogen Sigma 10901393001 3.6.4., other equivalent reagents may be used
3M Sodium acetate , pH5.2 Thermo Fisher Scientific   R1181 3.6.4., other equivalent reagents may be used
Ethanol  3.6.4. + 9.1.8., molecular biology grade
Quick blunting kit  New England Biolabs E1201 4.1.
ammomium acetate Sigma
A1542
3.1., other equivalent reagents may be used
magnesium acetate Sigma
M5661
3.1., other equivalent reagents may be used
0.5 M EDTA (pH 8.0) VWR   MOLEM37465520 (or Promega V4231) 2.2. + 3.1., other equivalent reagents may be used
Agencourt AMPure XP beads Beckman coulter A63881 5.3. + 6.5.
Gel extraction kit QIAGEN 28704 5.7.+ 7.1. +8.4., other equivalent reagents may be used
concentrated T4 DNA ligase New England Biolabs  M0202T 6.1.+ 8.1.2.
Long Amp Taq 2X Master Mix  New England Biolabs M0287S 6.3.
Phusion High-Fidelity PCR Master Mix with HF Buffer New England Biolabs M0531S 5.1. + 6.6., other equivalent reagents may be used
HindIII New England Biolabs R0104S 5.4.1. 
SacII New England Biolabs R0157S 5.4.2.
AgeI New England Biolabs R0552S 8.2.1.
Tris base Sigma 93362 8.1.1.
2M MgCl Sigma 93362 8.1.1.
dGTP,dATP, dCTP, dTTP New England Biolabs N0446S 8.1.1.
DTT Sigam
DTT-RO
8.1.1.
PEG-8000  Sigma
P5413
8.1.1.
NAD Sigma
N6522
8.1.1.
T5 exonuclease New England Biolabs M0363S 8.1.2.
Phusion DNA polymerase  New England Biolabs M0530S 8.1.2.
Taq DNA ligase New England Biolabs M0208L 8.1.2.
rSAP New England Biolabs M0371S 8.3.1.
TG1 competent cells Lucigen 60502-1 9.1.
1mm gap electroporation cuvettes  VWR 732-2267  10.2.
Bio-Assay Dish (Polystyrene, 245 mm x 245 mm x 25 mm) Fisher Scientific DIS-988-010M  9.4.
NaCl Sigma S7653  9.3.
Bacto-tryptone BD 211705 9.3.
Yeast extract BD 212750 9.3.
Agar Sigma
A1296
9.4.
Glycerol Sigma
G5516
9.17.
MNAse New England Biolabs M0247S 1.1.
Nanodrop Thermo Fisher Scientific ND-2000 throughout
Micropulser Biorad 165-2100 10.2.
Electroporation cuvettes Biorad 732-2267  10.2.
250 ml centrifuge tubes Corning 430776 9.1-9.9.

DOWNLOAD MATERIALS LIST

References

  1. Mali, P., Esvelt, K. M., Church, G. M. Cas9 as a versatile tool for engineering biology. Nat Methods. 10, (10), 957-963 (2013).
  2. Yang, H., et al. One-step generation of mice carrying reporter and conditional alleles by CRISPR/Cas-mediated genome engineering. Cell. 154, (6), 1370-1379 (2013).
  3. Stricker, S. H., Koferle, A., Beck, S. From profiles to function in epigenomics. Nat Rev Genet. 18, (1), 51-66 (2017).
  4. Dominguez, A. A., Lim, W. A., Qi, L. S. Beyond editing: repurposing CRISPR-Cas9 for precision genome regulation and interrogation. Nat Rev Mol Cell Biol. 17, (1), 5-15 (2016).
  5. Shalem, O., et al. Genome-scale CRISPR-Cas9 knockout screening in human cells. Science. 343, (6166), 84-87 (2014).
  6. Wang, T., Wei, J. J., Sabatini, D. M., Lander, E. S. Genetic screens in human cells using the CRISPR-Cas9 system. Science. 343, (6166), 80-84 (2014).
  7. Koike-Yusa, H., Li, Y., Tan, E. P., Velasco-Herrera Mdel, C., Yusa, K. Genome-wide recessive genetic screening in mammalian cells with a lentiviral CRISPR-guide RNA library. Nat Biotechnol. 32, (3), 267-273 (2014).
  8. Hart, T., et al. High-Resolution CRISPR Screens Reveal Fitness Genes and Genotype-Specific Cancer Liabilities. Cell. 163, (6), 1515-1526 (2015).
  9. Koferle, A., et al. CORALINA: a universal method for the generation of gRNA libraries for CRISPR-based screening. BMC Genomics. 17, (1), 917-940 (2016).
  10. Lane, A. B., et al. Enzymatically Generated CRISPR Libraries for Genome Labeling and Screening. Dev Cell. 34, (3), 373-378 (2015).
  11. Sambrook, J., Russell, D. W. Isolation of DNA fragments from polyacrylamide gels by the crush and soak method. CSH Protoc. (1), (2006).
  12. Gibson, D. G. Enzymatic assembly of overlapping DNA fragments. Methods Enzymol. 498, 349-361 (2011).
  13. Elsaesser, R., Paysan, J. Liquid gel amplification of complex plasmid libraries. Biotechniques. 37, (2), 200-202 (2004).
Um protocolo Universal para grande escala gRNA biblioteca de produção a partir de qualquer fonte de DNA
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Köferle, A., Stricker, S. H. A Universal Protocol for Large-scale gRNA Library Production from any DNA Source. J. Vis. Exp. (130), e56264, doi:10.3791/56264 (2017).More

Köferle, A., Stricker, S. H. A Universal Protocol for Large-scale gRNA Library Production from any DNA Source. J. Vis. Exp. (130), e56264, doi:10.3791/56264 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter