Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Универсальный протокол для крупномасштабных gRNA библиотека производства из любого источника ДНК

doi: 10.3791/56264 Published: December 6, 2017

Summary

Методы для создания крупномасштабных gRNA библиотек должна быть простой, эффективной и рентабельной. Мы описываем протокол для производства gRNA библиотек на основе ферментативного пищеварения ДНАО цели. Этот метод, женский (всеобъемлющий gRNA библиотека поколения через контролируемые нуклеиназы деятельности) представляет альтернатива дорогостоящим пользовательских олигонуклеотида синтеза.

Abstract

Популярность ТРИФОСФАТЫ/Cas9 системы для генома и epigenome техники проистекает из его простоту и технологичность. Эффектор (Cas9 Нуклеаза или нуклеиназы Мертвое dCas9 синтез белка) ориентирован на определенный сайт в геноме небольшой синтезированную РНК, известный как руководство РНК, или gRNA. Двусторонний характер системы ТРИФОСФАТЫ позволяет его использовать в скрининг подходы с плазмида библиотек, содержащих выражение кассеты тысяч отдельных оформления может использоваться допросить много различных сайтов в одном эксперименте.

На сегодняшний день, gRNA последовательности для строительства библиотек был почти исключительно порожденных синтеза олигонуклеотида, который ограничивает достижимых сложность последовательностей в библиотеке и относительно дорогостоящими. Здесь подробный протокол для женский (библиотека поколения всеобъемлющей gRNA через контролируемые нуклеиназы деятельности), простой и эффективный метод для поколения весьма сложные gRNA библиотек на основе ферментативного пищеварения ввода ДНК, описано. Поскольку женский библиотеки могут быть созданы из любого источника ДНК, множество опций для настройки существуют, что позволяет большое разнообразие основанный ТРИФОСФАТЫ экранов.

Introduction

Адаптация системы бактериальной ТРИФОСФАТЫ/Cas9 как инструмент молекулярной ориентации причиной последней революции в молекулярной биологии. Никогда не было так легко манипулировать хроматина в определенных местах генома. Общие приложения ТРИФОСФАТЫ включают целевые ген мутации1, геном инженерных2, epigenome3, transcriptional активации и4экспрессию гена редактирования. Один особым преимуществом ТРИФОСФАТЫ системы является, что ее применения изученной кандидат сайтов, не ограничены как gRNA библиотеки сделать менее предвзято экраны можно. Они облегчают открытие функционального локусов генома без каких-либо предварительных знаний экспериментальной. Однако gRNA библиотека строительство в настоящее время главным образом основывается на oligo нуклеотидного синтеза и существуют ограниченные возможности для приобретения gRNA библиотек, которые не являются человека или мыши происхождения или целевые регионы за пределами открыть чтения фреймов. Таким образом хотя ТРИФОСФАТЫ экраны уже доказали невероятно мощным5,6,7,8, их полный потенциал не еще не использовалась.

Чтобы преодолеть ограничение классической gRNA поколения методы две стратегии недавно был разработан. Обе они основаны на контролируемых ферментативного пищеварения целевой ДНК, вместо того чтобы полагаться на пользовательских олигонуклеотида синтеза. Хотя женский9 использует Микрококковая Нуклеаза, в настоящее время доступна только альтернативный метод, ТРИФОСФАТЫ-есть10, позволяет использовать энзимы ограничения (HpaII, ScrFя, БФАя и Mmeя). Важно отметить, что оба методы могут применяться к любой входной ДНК, которая служит источником gRNA protospacer последовательностей. В то время как метод еды ТРИФОСФАТЫ использует стратегию для уменьшения числа клонированных оформления сайтов которых таргетинга не следуют необходимые все PAM (protospacer прилегающие мотив), он генерирует только небольшая часть всех возможных функционального оформления для данного региона. ЖЕНСКИЙ, с другой стороны, способен генерировать все потенциальные оформления для исходной последовательности, но также включает в себя выше часть нефункциональные гидов. gRNA библиотека поколения через контролируемые нуклеиназы деятельности позволяет производство всеобъемлющей gRNA библиотек для любого вида, любого Cas9-белка или - эффекторные системы простой и экономически эффективным образом. Кроме того женский приспособлена для настройки, как соответствующие ввода и вектора выбора определяют тип библиотеки, размер и содержание. Здесь, который представлен подробный протокол может использоваться для формирования всеобъемлющих gRNA библиотек из различных источников ДНК (рис. 1), включая бактериальных искусственных хромосом (BACs) или геномной ДНК9. Представитель результаты, сопровождающих этот протокол были получены путем применения протокола женский BAC ДНК.

Protocol

1. пищеварение ДНК с Микрококковая Нуклеаза

  1. Выполните оптимизация реакции для каждой новой партии Микрококковая Нуклеаза фермента (MNase).
    Примечание: Количество единиц MNase используется должны испытываться (с помощью последовательного разрежения, рис. 2A). Как правило 5-10 U MNase дайджест 1 мкг очищенного геномной или дна BAC вплоть до диапазона 5-100 bp с соблюдением условий, описанных ниже.
  2. В реакции, настройка 1 мкл 10 x буфер MNase, 1 x бычьим сывороточным альбумином (БСА), 1 мкг целевого ДНК, 1 мкл MNase (0,1-50 единиц) в объеме 10 мкл реакции.
  3. Инкубируйте при 37 ° C 15 мин.
  4. Сразу же инактивирует фермент, добавив 1 мкл 500 мм этиленгликоля bis(β-aminoethyl ether)-N, N, N', N'-tetraacetic кислота (EGTA).

2. разделение ДНК фрагментов с помощью электрофореза геля полиакриламида (страница)

  1. Добавить пример буфера/гель загрузки краситель для образцов ДНК и загрузить на 20% гель страницы. Загрузить соответствующий трап дна для калибровки (5 bp лестница ДНК). Не перегружайте геля (1 мкг ДНК на хорошо).
  2. Запустите гели в соответствующих 1 x работает буфер TRIS-Борат-ЭДТА (КЭ) 150 V (константа) для около 1,5 ч или до нижней краситель фронт (бромфеноловый синий, темно синего цвета), который путешествует в около 15 bp, достигает нижнего конца геля.
  3. Пятно гель с использованием ультра-чувствительных нуклеиновых кислот пятна и визуализировать под УФ светом.
  4. Из образа гель определите оптимальную концентрацию MNase усваивая ДНК вплоть до 20-30 bp в размер.
  5. Используйте оптимизированные концентрации MNase усвоить дна цели, повторив шаги 1.2-2.2. Как правило Настройка 10-12, которую реакций (т.е. 10-12 мкг всего исходного материала) даст достаточно переваривается ДНК после извлечения геля страницы перейти к последующим шагам.
  6. С помощью стерильным скальпель, вырезать гель рядом с маркером Лейн и пятно только часть гель, содержащий лестница с свежий 1 x TBE идущий буфер, содержащий 1 X пятно сверхчувствительных нуклеиновых кислот. Визуализировать ДНК лестница и акцизных фрагментов ДНК, MNase переваривается в диапазоне размеров между приблизительно 18-30 bp с помощью лезвия бритвы.
    Примечание: Не подвергайте MNase переваривается фрагментов к ультрафиолету. Это можно использовать синий источник света (вместо УФ) или принять изображение лестницы под УФ, распечатать его и использовать это для вырезания фрагментов ДНК, MNase усваивается). Этот шаг позволяет избежать окрашивания и фрагментов ДНК подвергаются воздействию УФ-излучения. Всегда используйте неиспользованные, стерильные одноразовые скальпелем или лезвием для этого шага, чтобы избежать загрязнения.
  7. Передать среза геля пробки microcentrifuge.
  8. Пятно на оставшуюся часть геля с пятен нуклеиновой кислоты как выше, подвергать ультрафиолетового света и записывать изображение, чтобы сохранить запись иссечение шаг гель.

3. изоляция фрагментов ДНК с помощью раздавить и замочить метод страницы гели

Примечание: Этот шаг был принят от Sambrook и др. 11

  1. Подготовка страницы гель солюбилизация буфера (1.88 мл 4 М аммония ацетат, 150 мкл магния ацетат 1 М, 30 мкл 0,5 М Этилендиаминтетрауксусная кислота (ЭДТА) (рН 8) в сверхчистого H2O к общим объемом 15 мл).
  2. Раздавить подакцизным гель ломтик против стены микро пластиковых пробирок, используя кончик стерильной пипеткой.
  3. Добавьте 2 гель томов страницы солюбилизация буфера и инкубировать при 37 ° C для 16 h на вращающейся платформе.
  4. Центрифугуйте образцы на 1 мин на максимальной скорости в microcentrifuge. Супернатант передать новой microcentrifuge трубки, заботясь не передавать любой части измельченных гель.
  5. Добавить 0,5 томов страницы буфера солюбилизация гель Пелле, вихрь и повторять центрифугирования (шаг 3.4). Объединить supernatants.
  6. Извлечения фрагментов ДНК с помощью стандартного фенол хлороформ добычи.
    Предупреждение: Фенол является токсичным, если он вступает в контакт с кожей или проглатывании. Меры предосторожности как перчатки, защитные очки, лаборатории пальто и работающих в вытяжного шкафа имеют решающее значение. Утилизация всех отходов, содержащих фенол, согласно правилам института.
    1. Добавьте один объем фенола: хлороформ: изоамилового спирта (25:24:1) образца и вихревой тщательно.
    2. Центрифуги для 10 мин на максимальной скорости (16000 x g) в настольной центрифуги при комнатной температуре. Тщательно передать свежие microcentrifuge трубки верхняя водной фазе. Заботиться не проводить над любой фенола во время закупорить.
    3. Повторите шаги 3.6.1 и 3.6.2 один раз.
    4. Добавить небольшое количество гликогена, 0.1 объемы ацетат натрия 3 M (рН 5.2) (0.2 мкл) и 2 тома 100% этанола (EtOH).
    5. Вортекс и инкубировать при-20 ° C на несколько часов или на ночь.
    6. Центрифуги для 30 мин на максимальной скорости на 4 ° C, с помощью настольной центрифуги.
    7. Тщательно удалить супернатант и помыть лепешка ДНК с 70% EtOH.
    8. Центрифуги для 30 мин на максимальной скорости на 4 ° C, с помощью настольной центрифуги.
    9. Удалить супернатант и просушите Пелле ДНК. Убедитесь, что все EtOH испарилась, но будьте осторожны, чтобы не слишком сухие гранулы.
    10. Растворяют гранулы ДНК в 12 мкл H2O.
      Примечание: Страница извлечения геля очень неэффективно. За каждые 10 мкг начиная ДНК переваривается с MNase ожидаете, чтобы восстановить 1-20 нг очищенный фрагментов после извлечения геля. Контролировать количество и сохранность фрагментов путем загрузки 1/6-й (2 мкл) на странице гель (рис. 2 c).

4. конец ремонт MNase переваривается, гель очищенная фрагментов

  1. Созданы следующие реакции с использованием ДНК притупления комплект: 10 мкл очищенная ДНК из шага 3.6.10, 1,5 мкл 10 X притупления буфера, 1.5 мкл dNTP смеси 1 мм, 0,6 мкл притупления фермента, 1.4 мкл H2O.
  2. Инкубируйте на 22 ° C в течение 30 мин, а затем тепло инактивирует фермент по инкубации при 70 ° C на 10 мин.
  3. Мкл 85 H2O и выполнить реакции очистки с помощью стандартного фенол/хлороформ добыча и EtOH осадков (как описано в разделе 3.6). Немедленно приступить к компоновщика перевязки.

5. компоновщика поколение

Примечание: Линкеры нужно усиливается параллельно с разделом 3, чтобы иметь возможность немедленно приступить к компоновщика перевязки. Грунтовка последовательности используется ниже должны быть подходящими для выбранной gRNA вектора выражения. Представленные здесь были разработаны для векторных pgRNA-pLKO.1. 9 для амплификации компоновщик 5' от pgRNA-pLKO.1, используйте грунт последовательности 5'-компоновщик F (TTGGAATCACACGACCTGGA) и 5'-компоновщик R (CGGTGTTTCGTCCTTTCCAC), уступая 689 ампликон bp. Для усиления компоновщик 3' от pgRNA-pLKO.1 Используйте праймеры 3'-компоновщик F: (GTTTTAGAGCTAGAAATAGCAAGTTAAAATA) и 3'-компоновщик R: (ACTCGGTCATGGTAAGCTCC), которые дают 848 ампликон bp.

  1. ПЦР усилить адаптер последовательностей из вектора выражения gRNA (с использованием реагентов выбора и последовательности пользовательских грунт, при необходимости). Для pgRNA-pLKO.1, созданы следующие реакции PCR 50 мкл: 25 мкл мастер смеси ПЦР, 2.5 мкл праймера F (10 мкм), 2,5 мкл грунтовка R (10 мкм), 0.1 нг gRNA вектора выражения (pgRNA-pLKO.1) в H2O.
  2. Инкубировать реакции на Термоциклер с использованием следующих условий: 1 цикл 98 ° C за 30 s, 32 циклов 98 ° C 10 s, 59 ° C 10 s, 72 ° C для 30 s, 1 цикл 72 ° C для 10 мин.
  3. Очищайте ПЦР-реакции с использованием твердой фазы реверсивные иммобилизации бусины согласно инструкциям производителя. Элюировать в 30 мкл H2O.
  4. Для обеспечения соблюдения направленного лигирование компоновщику фрагментов ДНК конце отремонтированы, MNase переваривается, дайджест линкеры с соответствующим энзимами ограничения (здесь ХиндIII и SacII). Установите следующие реакции:
    1. Для переваривания 5' компоновщик с ХиндIII, используйте 30 мкл очищенная 5' компоновщика ампликон из шага 5.3., 5 мкл буфера, 3 мкл ХиндIII (20U/мкл) и 12 мкл H2O.
    2. Для переваривания 3' компоновщик с SacII, используйте 30 мкл очищенной 3' компоновщика ампликон из шага 5.3., 5 мкл буфера, 3 мкл SacII (20 U/мкл) и 12 мкл H2O.
  5. Инкубируйте дайджесты при 37 ° C в течение 3 ч.
  6. Добавить ДНК гель загрузки красителя и запустить дайджесты энзима ограничения на геле агарозы 1%. Акцизный полосы в 637 bp (5' компоновщика дайджест) и 295 bp (3' компоновщика дайджест).
  7. Очищайте ДНК из кусочков подакцизным гель, используя набор для извлечения геля.

6. компоновщика перевязки и усиления вставок

  1. Настройка реакции перешнуровки 14 мкл, используя эквимолярных количествах MNase переваривается, отремонтированы конец фрагментов и компоновщик последовательности.
    Примечание: Компоновщику фрагмент соотношения могут быть оптимизированы. Рекомендуется включить без фрагмент контроля (NFC) реакции.
    1. Использование 5 нг MNase переваривается фрагментов (конец отремонтированы и очищенного), 120 нг 5' компоновщика (ХиндIII дайджест, очищенный), 55 нг 3' компоновщик (SacII дайджест, очищенный), 1.4 мкл T4 лигаза буфера и 1.4 мкл концентрированного T4 ДНК лигаза в H2O.
  2. Инкубируйте реакции перешнуровки в 16 ° C для 16 h. Делать не тепло инактивирует фермент. Немедленно приступить к Ник перевод.
    Примечание: Фрагменты переваривается MNase конце отремонтированы предоставить 5' фосфаты необходимые для перевязки компоновщики, как компоновщик сами ООН фосфорилированных.
  3. Для перевязки реакции (и NFC реакции) добавить следующее: 25 мкл Taq 2 X Главный микс (способных Ник перевода), 2,5 мкл грунтовка компоновщик-Minus450-F (10 мкм, GGGCAAGTTTGTGGAATTGG), 2,5 мкл грунтовка компоновщик-Plus275-R (10 мкм, AAGTGGATCTCTGCTGTCCC) и 6 мкл H2O.
  4. Включите элемент без шаблон (NTC). Инкубировать реакции на Термоциклер с использованием следующих условий: 1 цикл (Ник перевод): 72 ° C для 20 минут, 1 цикл: 95 ° C за 5 мин., 3-4 циклов: 95 ° C 15 s, 58 ° C 15 s, 72 ° C для 30 s, 1 цикл: 72 ° C за 5 мин.
  5. Выполните реакции очистки с помощью твердой фазы реверсивные иммобилизации бусы с образцом шарик соотношение 1:1. Элюировать в 40 мкл H2O.
  6. Дальнейшего усиления нужный фрагмент (5' компоновщика + MNase фрагмент + 3 ' компоновщика) с помощью соответствующих ПЦР реактивы и следующих грунтовок:
    1. Используйте 12,5 мкл мастер смеси ПЦР, 1,25 мкл грунтовка компоновщик-Minus450-F (10 мкм, GGGCAAGTTTGTGGAATTGG), 1,25 мкл грунтовка компоновщик-Plus275-R (10 мкм, AAGTGGATCTCTGCTGTCCC), 2,5 мкл очищенный Ник перевод продукта из шага 6.4. и 7,5 мкл H2O. использование следующих условий: 1 цикл: 98 ° C за 30 сек, 10-16 циклов: 98 ° C 10 s, 63 ° C 10 s, 72 ° C для 15 s, 1 цикл: 72 ° C для 10 мин.
      Примечание: В случае необходимости, несколько реакции может быть создан параллельно чтобы убедиться, что есть достаточно продукт PCR для последующих шагов. Чтобы визуализировать небольшое количество продукта ПЦР на геле агарозы, настроить дополнительные реакции как шаг 6.5 и увеличить число цикла от 15 до 32. Эта реакция может использоваться как контроль качества, если ампликонов не видно после 15 циклов. Включить также не шаблон элемента (NTC).

7. размер выделения

Примечание: Этот шаг отделяет MNase фрагменты с компоновщик правильно прилагаемый 5' и 3' от фрагментов с двумя 5' или два 3' линкеры на основе размера.

  1. Объединить все 15-цикла ПЦР-реакции от шага 6.5., добавить ДНК загрузки красителя и на 0,8% агарозном геле. Акцизный видные группы в 869 bp и очистить ДНК, используя набор для извлечения геля.
  2. Подсчитать количество ДНК (например используя спектрофотометр).

8. клонирование PCR-усиливается фрагментов в gRNA вектора выражения Ассамблеей Гибсон

  1. Подготовка Ассамблеи мастер смесь следующим образом:
    Примечание: Следующие шаги адаптированы из Гибсон и др. 12.
    1. Создание 6 мл изотермической реакции буфера путем объединения 3 мл 1 М трис (гидроксиметил) aminomethane (Tris)-HCl pH 7.5, 300 мкл 1 M MgCl, 60 мкл deoxyguanosine трифосфат 100 мм (dGTP), 60 мкл 100 мм деоксиаденозин трифосфата (dATP), 60 мкл 100 мм deoxythymidine Аденозинтрифосфат (dTTP), 60 мкл 100 мм Дезоксицитидин трифосфата (дЦТФ), 300 мкл 1 М Дитиотреитол (DTT), 1,5 г полиэтиленгликоля (PEG) -8000, 300 мкл 100 мм Никотинамидадениндинуклеотид (NAD) в сверхчистого H2O.
      Примечание: Этот буфер может быть aliquoted и хранятся при температуре-20 ° C.
    2. Создание 1,2 мл Ассамблеи Мастер микс, объединяя 320 мкл 5 X изотермической реакция буфера, 3 мкл 10 U/мкл T5 exonuclease, 20 мкл 2 U/мкл ДНК-полимеразы, 160 мкл 40 U/мкл ДНК лигаза в сверхчистого H2O. Использование 15 мкл Ассамблея мастер смеси с 5 мкл Вставьте.
      Примечание: Мастер смесь Ассамблея может быть aliquoted и хранятся при температуре-20 ° C, где он стабилизирован более чем на один год и может мириться несколько циклов замораживания оттаивания. Выбранной количество T5 exonuclease идеально подходит для использования с вылетами.
  2. Вектор позвоночника пищеварение
    Примечание: Не забудьте дайджест достаточное количество вектора как входные данные для требуемого числа Ассамблея реакций на шаге 8.3.
    1. В реакции, добавьте следующее: 1,5 мкг gRNA выражение вектор (pgRNA-pLKO.1), 5 мкл буфера, 1.5 мкл возрастая (5U/мкл) и 38,5 мкл H2O. инкубировать дайджест при 37 ° C на 2 ч.
  3. Дефосфорилирование линеаризованного вектора.
    Примечание: Этот шаг рекомендуется, но не строго необходимо. При exonuclease T5 в мастер смеси будет главным образом удалить возрастсвесы, прежде чем Taq ДНК лигаза имел возможность действовать. Таким образом не ожидается, чрезмерного повторного перешнуровка вектора.
    1. 2.5 мкл креветок фермента щелочной фосфатазы (РСПД, 1 U/мкл).
    2. Инкубировать при 37 ° C за 30 минут, а затем инактивирует фермент, инкубации при 65 ° C за 5 мин.
  4. Выполнение очистки ДНК
    Примечание: Рекомендуется выполнить шаг извлечения геля агарозы. В качестве альтернативы можно использовать столбец или шарик очистки. Важно проверить, что пищеварение вектор является полным, например, электрофорез геля агарозы. Для сравнения следует параллельно непереваренных вектор.
  5. Подсчитать количество очищенной переваривается вектора в образце.
  6. Настроить сборку с 2 раза Молярная избыток вставок для векторных. За 20 мкл реакции использования 100 ng вектора (возрастя дайджест из шага 8.5) 12.2 ng вставки (из шага 7.1.), 15 мкл Ассамблея Мастер микс из шага 8.1.2. в H2O.
  7. Инкубируйте на 50 ° C за 1 час.
  8. Очищайте реакции, с помощью столбца очистки. Ресуспензируйте ДНК в 75 мкл H2O (или соответствующие тома в зависимости от масштаба электропорации).
    Примечание: Эффективность преобразования во многом зависит от чистоты ДНК. Дополнительная очистка шаги (например извлечение фенола/хлороформ) может повысить эффективность.

9. Подготовка TG1 электро компетентных клеток E. coli

  1. Убедитесь, что все центрифуга бутылки и флаконы свободны от моющих средств путем промывки и последующего заполнения с дистиллированной водой перед автоклавированием.
    Примечание: Этот шаг помогает для удаления любых загрязнений, которые могут повлиять на эффективность преобразования. Вода должны быть отброшены непосредственно перед использованием. Кроме того использование одноразовых центрифугирования бутылок может быть целесообразным.
  2. Убедитесь, что бутылки центрифуги, трубок и решения, используемые для приготовления electrocompetent клетки охлажденной на льду до использования. Лучше всего проводить следующие шаги в холодной комнате, чтобы свести к минимуму колебания температуры, которые могут повлиять на эффективность преобразования.
  3. Подготовка среднего 2TY. 16 g bacto Триптон 10 г дрожжей экстракт и 5 г NaCl, добавьте дистиллированной воды 1 Л, смеси и автоклав. Средний хранить при комнатной температуре.
  4. Готовят блюда биопроб 2TY-агар покрытием и Петри 10 см, содержащие соответствующий антибиотик. Пластины хранить при 4 ° C.
    Примечание: Выбор антибиотика зависит от характера gRNA вектора выражения, ампициллин использования 100 мкг/мл для pgRNA-pLKO.1.
  5. Очистите от глицерина запас TG1 клеток для инокуляции 10 мл 2TY среды (без антибиотиков).
  6. Инкубируйте культуры при 37 ° C ночь (~ 16 h) с встряхивания на 225 об/мин.
  7. Прививок 1 Л 2TY среды (без антибиотиков) с 10 мл на ночь культуры (1/100 разрежения) и одинаково разделить его между двух 2 Л флаконы (содержащие перегородок).
  8. Инкубируйте культуры при 37 ° C, 225 об/мин до OD600 Нм 0.55 (примерно через 1,5-2 ч). Используйте спектрофотометр регулярно проверять OD600 Нм.
  9. Холод культур на льду за 30 мин.
  10. Разделение культуры поровну между четырьмя 500 мл бутылки центрифуги (предварительно охлажденным на льду).
  11. Центрифуги для 15 мин на 4000 x g при 4 ° C в предварительно охлажденной центрифуге.
  12. Декант supernatants и добавить 1 тома (т.е. 250 мл) предварительно охлажденные ледяной стерильной дистиллированной H2O каждому из бутылки центрифуги. Ресуспензируйте бактериальных Пелле закрученного или переворачивать бутылку (или нежный закупорить, если это необходимо).
    Примечание: Это легче Ресуспензируйте гранулы первого добавлением небольшого количества воды. Убедитесь, что гранулы в конечном итоге полностью высокомобильна.
  13. Центрифуги для 15 мин на 4000 x g при 4 ° C.
  14. Повторите мыть два раза (шаги 9.12. и 9,13). Удалите супернатант. Будьте осторожны, когда декантирующие как бактериальный Пелле становится все более свободно после стирки.
  15. Ресуспензируйте гранулы в 50 мл стерильного, ледяной 10% глицерина и перенести его на предварительно охлажденные 50 мл пластиковых пробирок.
  16. Центрифуга клетки для 15 минут ~ 4000 x g при 4 ° C. Осторожно удалите супернатант.
  17. Нежно ресуспензируйте бактерий в 2 мл ледяной стерильные 10% глицерина.
  18. Держите на льду, если клетки должны использоваться сразу же для электропорации.
    Примечание: Клетки могут быть заморожены в аликвоты 50 мкл в 0,5 мл трубки в ванне с сухим льдом этанола и хранятся при температуре-80 ° C, но это не рекомендуется.

10. электропорации TG1 клеток кишечной палочки Electrocompetent

Примечание: Электропорация является одним из узких мест в поколение всеобъемлющая библиотека. Чтобы сохранить в представлении библиотеки, рекомендуется проводить столько индивидуальных электропорации реакции/сроки необходимые и выполните описанные ниже шаги контроля качества (10.6. и 10.8.).

  1. Аликвота очищенный реакций (из шага 8.8) в стерильных и предварительно охлажденные ПЦР пробирок и держать их на льду (1 мкл на трубу). Холод 1 мм зазор электропорации кюветы на льду.
  2. 25 мкл свежеприготовленные TG1 клеток непосредственно к одной Алиготе ДНК и немедленно перевести смесь в кювет электропорации. Флик или коснитесь кювета для обеспечения клеток/ДНК смесь распределяется по длине кювет камеры (без воздуха или пузырьки).
  3. Поместите кювету в камере слайд и запустите программу, соответствующую электропорации (например 1 импульса 1,8 кв (EC1)).
    Примечание: Постоянная времени должно лежать между 5.7 и 6,0 г-жа в случае electroporator дуги, Флик кювета, убедитесь, что нет пузырьков воздуха в камере и повторите попытку.
  4. Сразу же мкл 975 комнатной температуре 2TY среды в кювет.
  5. С помощью пипетки передачи, переместите electroporated бактерий в 50 мл трубки. Повторите шаг 10.2. и собрать все клетки превращается с одной библиотекой в один тюбик 50 мл.
  6. Документ общий объем.
  7. Этап контроля качества
    1. Для количественного определения компетенции недавно созданного электро компетентных клеток, выполните отдельный электропорации реакции, используя определенное количество режиссерский плазмидной ДНК (например 10 pg pUC19 управления плазмида). Передаете это 1,5 мл отцентрифугировать.
      Примечание: Компетенция должна быть по крайней мере 1010 колонии формирование единиц (cfu) в мкг ДНК. Свежеприготовленные клетки обычно работают лучше, чем это.
  8. Инкубируйте преобразованные бактерий при 37 ° C 60 мин, тряски на 225 об/мин.
  9. Этап контроля качества:
    1. Плиты определено небольшое количество бактерий, преобразована с библиотекой (например 10 мкл 10-100 раз разрежения) на табличке агар 10 см с соответствующим антибиотиком выбора.
      Примечание: Зная объем общей культуры (из шага 10.6.), полученные колонии номер может использоваться для оценки общее количество колоний для всей библиотеки. 20-30 раз представление библиотеки в идеале должна быть сохранена.
  10. Разогнать оставшуюся часть бактерий на 2TY агар покрытием биопроб блюда, содержащие соответствующий выбор антибиотика.
    Примечание: Объем культуры может быть уменьшена центрифугирования в ~ 4000 x g 10 мин (или пока не сформировалась видны гранулы и супернатант появляется ясно). Это уменьшает время, необходимое пластины для просушки после распространения культуры. Использование плит, а не жидкой культуры минимизирует несоразмерного роста отдельных колоний. 13
  11. Распространять соответствующий объем pUC19 управления электропорации реакции на дополнительные 10 см блюдо агар с соответствующим антибиотиком выбора.
  12. Инкубировать плиты агара на ночь (16 ч) при температуре 37 ° C.
  13. Количество полученных колоний на тарелках управления (pUC19 и управления Библиотека пластина) для оценки CFU/мкг ДНК для бактерий а также библиотека сложности.

11. Добыча плазмидной ДНК

  1. Добавить 10 мл 2-ты СМИ на ночь тарелки, скрести бактериальных слой от пластину, используя одноразовые разбрасыватель и собирают его в 50 мл трубки. Повторите несколько раз до тех пор, пока все пластины кажется чистой.
  2. Извлечь ДНК плазмиды макси комплект (2-3 колонки необходимо в био пробирного пластины).

Representative Results

С помощью протокола под рукой, женский gRNA библиотеки были получены от человека и мыши, геномной ДНК9 и дна BAC (рис. 1). Для получения фрагментов ввода ДНК для клонирования в векторы выражения gRNA, оптимальные условия для контролируемых нуклеиназы пищеварение должны определяться. Типичный результат для оптимизации Микрококковая Нуклеаза пищеварение изображен на рисунке 2A. Недостаточное количество нуклеиназы (0,1, 2, 3, 4, 4,5-5 единиц) производит не заметно продукции в пределах требуемого размера (10-100 bp) и 5,5-7,5 подразделения по-прежнему производится фрагменты, которые находятся на среднем слишком долго. Большее количество фермента (50 единиц) привести к чрезмерной деградации входных данных ДНК после 10 мин. Следовательно промежуточные объем был выбран (10 единиц). Дайджест была расширена производить достаточно переваривается фрагменты для последующей очистки и клонирования (рис. 2B). Хотя это рекомендуется слепо выбирать фрагменты ДНК по размеру и полагаться только на лестнице ДНК для ориентации для сведения к минимуму воздействия фрагментов ДНК УФ света, гели можно потом витражи для контроля качества пищеварения и резки. Рисунок 2B показывает репрезентативного примера страницы геля, из которых ДНК была иссечена фрагменты между 20 и 30 bp. Гель очищенный MNase фрагменты были погружены на 20% гель страницы для проверки успешного размер выделения и очистки MNase переваривается фрагментов (рис. 2 c). Протокол рукой совместим с использованием настраиваемых компоновщика последовательностей, позволяя клонировать MNase переваривается фрагменты в gRNA векторы выражения выбора. Здесь gRNA-PLKO9 был использован как основа. Линкеры усиливаются от вектора выражения gRNA, используя стандартное PCR. 2D рисунок изображает репрезентативного примера усиливается компоновщика последовательности лишена дополнительных, неправильный или не ампликонов шаблон. Затем компоновщик ампликонов усваиваются с энзимами ограничения для обеспечения что линкеры лигируют на MNase переваривается фрагментов в правильной ориентации. 2D рисунок показывает Гели агарозы 5' и 3' линкеры до и после переваривания ХиндIII и SacII соответственно, указав полное переваривание линкеры предсказал 637 и 295 bp. Правая часть геля изображения документов иссечение переваривается компоновщика фрагментов. После гель добыча переваривается компоновщики, следующий шаг в протоколе — перевязка линкеры фрагменты отремонтированы конец MNase переваривается. Потому что компоновщик последовательностей создаются с использованием unphosphorylated праймеры PCR, самолигирование линкеры не должно происходить. Только конец ремонт MNase переваривается фрагментов ДНК обеспечивают фосфатные группы, необходимые для перевязки. После перевода Ник продукт перешнуровки усиливается ПЦР. Для того, чтобы избежать чрезмерного смещения амплификации PCR, которые могут исказить представление gRNA последовательностей в библиотеке, усиление ограничивается менее 20 циклов в общей сложности. После ПЦР усиление продукции трудны для визуализации на гелях агарозы. PCR отдельный элемент управления с 32 циклы таким образом выполняются для выявления продукции (но не используются для приготовления библиотека). Результаты из этого элемента управления ПЦР показаны на рисунке 2E. Это позволяет оптимизировать реакции перешнуровки и для обеспечения реакции лишены ПЦР артефакты, которые иногда имеют место в «без элементов управления фрагменты» (NFC). 2E рисунок показывает нужный ампликон (5' компоновщика + фрагмент ДНК + 3' компоновщика, длина: 869 bp) после усиления лигирование реакций с помощью эквимолярных соотношения (1:1) фрагменты и компоновщик последовательности.

Figure 1
Рисунок 1 : Предложил сроки для подготовки библиотеки gRNA. Женский предлагает простой и экономичной стратегии для создания всеобъемлющей gRNA библиотек из множества различных источников ДНК от любого организма. Протокол под рукой может быть доставлен завершения в течение одной рабочей недели. Компоновщик поколения могут выполняться параллельно с конца репарации ДНК. Подготовка electrocompetent бактерий занимает два дня и включает в себя ночь шаг роста и поэтому должен быть запущен перед Ассамблеей, которые настроены реакции. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 2
Рисунок 2 : Критические шаги во время протокол. (A) контролируемых пищеварение BAC ДНК позволяет поколение фрагментов разных размеров. Здесь показан оптимизации MNase пищеварение. Очищенная ДНК BAC лечился с различными объемами MNase за 10 минут 10 U MNase генерировать фрагменты ДНК желаемой длины (bp 20-30). (B) размер выделения фрагментов между 20 и 30 bp, используя иссечение от полиакриламидных гелей. Очищенная ДНК BAC лечили 10 U MNase за 10 мин. Изображение было записано после обрезания. Контроль качества (C) гель очищенная фрагментов. После гель очищение 1/6 из очищенного MNase фрагменты страницы гель для проверки успешного размер выделения и очистки была погружена на 20%. (D) амплификация последовательностей компоновщик для Ассамблеи и энзима ограничения пищеварение линкеры обеспечить дирекционного клонирования. 5' и 3' линкеры были усилены и сократить с HindIII и SacII, соответственно. No шаблон элементов управления (NTC) были включены в элемент управления для ПЦР артефактов и ДНК загрязнения. Слева: пример аналитическое приложение; справа: препаративные образца приложения. Изображение было записано после иссечения гель. (E) успешно лигирование линкеры фрагментов ДНК могут быть проанализированы с помощью ПЦР с возросшим числом циклов PCR (32) и контролируется выполнение без шаблона элементов управления с H2O (NTC) или с помощью НПС на предыдущем шаге Ник перевод вход (NTC NT)). Важно включить элемент не фрагмент управления (NFC), который является усиление от перевязки и перевод реакции Ник, из которого были опущены фрагменты MNase. Только образцы, в которых MNase фрагменты были объединены с компоновщик ДНК производить ожидаемых ампликон (869 bp). Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Discussion

Женский может использоваться для создания больших масштабах gRNA библиотек, контролируемых нуклеиназы переваривания ДНАО цели и массовое клонирование фрагментов результирующего двойной мель. Статистический вывод показывает, что многие более чем 107 отдельных gRNA последовательностей уже были успешно клонирован рука9-протоколу. Женский можно настроить несколькими способами. Выбор шаблона ДНК определяет целевого региона и максимальной сложности созданного библиотеки. Используя этот протокол, женский библиотеки ранее были получены от человека и мыши геномной ДНК9. Представитель результаты, представленные здесь изображают поколения женский библиотеки из очищенного BAC ДНК. Дальнейшая настройка может быть достиган выбор gRNA выражение вектор и компоновщик последовательностей. Ранее мы проверили три разных пар компоновщика длин для Ассамблеи Гибсон с мало вариаций в эффективности9.

Из-за их происхождения от массовых переваривается ДНК, protospacer женский оформления, как правило, не точно 20 bp в длину, но показывают распределение длины с означает, что зависит как параметры MNase пищеварение, а также размер обрезания сделаны из геля страницы s. представителя пример, показанный на рисунке 2B и C, изображает фрагментов с Средний Длина между 19 и 27 bp. Наш опыт показывает длина фрагментов добросовестно сохраняется созданный gRNA protospacer9. Хотя фрагменты, короче, чем 20 bp следует избегать из-за выше от целевого показателя в результате оформления, больше фрагментов, вероятно, гораздо меньше, проблема для нисходящие приложения, так как он был показал что оформления с protospacers, пока 45 bp по-прежнему являются функциональные9.

Два наиболее важных шагов в протоколе женский являются выбор размера MNase переваривается фрагментов и клонирования шаги. Поколение фрагментов, которые являются слишком короткими (например в среднем ниже 18 bp) или включение слишком много пустых gRNA векторов выражения будет оказывать библиотека бесполезно. Таким образом важно оптимизировать шаг MNase пищеварения (рисунок 2A), для мониторинга эксцизии (Рисунок 2Б, C), проверьте для полного переваривания gRNA вектор позвоночника и включая контроль не фрагмент во всем протокол. Особое внимание также должно быть принято сохранить представление библиотеки gRNA. Один из распространенных узким библиотека поколения в целом является эффективной передачи плазмид в бактерии для амплификации. Таким образом большое количество бактерий с отличным компетентности и большое количество отдельных электропорации событий необходимы для достижения большого числа gRNA клонов.

Новые стратегии для производства gRNA библиотека будет необходимо собрать весь потенциал скрининга, основанный ТРИФОСФАТЫ подходов в течение следующих десятилетий. Существует значительный спрос на экономически эффективных, простых и настраиваемые методы для создания крупных библиотек, предпосылкой сделать скрининг поддаются большего числа типовых систем и различных основанный ТРИФОСФАТЫ инженерных подходов. Первым шагом к этому является предоставление женский. Потенциального использования коллектора, особенно для получения всеобъемлющей библиотеки геномов, cDNA полученных библиотек менее распространенные модели систем, целенаправленных библиотек и экспериментальных установок, в которых различные белки ТРИФОСФАТЫ (с разными Пэм требования) используются в сочетании.

В отличие от других методов женский генерирует все возможные оформления из входных данных ДНК. Однако недостатком метода является, что оформления, недостает необходимой последовательности PAM также включены в библиотеку, особенность, что он разделяет с второй ферментативного метода для gRNA библиотека поколения, ПИТАЮЩИХСЯ ТРИФОСФАТЫ (Таблица 1). Выбор идеальный метод для gRNA библиотека поколения зависит от характеристик планируемой проверки эксперимент, особенно природы (генно, нормативных, intergenic) и размер целевого региона (одном локусе, несколько регионов, геном общесистемной). Мы видим специального вверх в использовании женский, когда большое количество некодирующих или регулирования регионах должны быть проанализированы, если есть информация о неполной или ненадежной последовательности (экзотические модели систем, смеси видов (например , microbiomes) или экспериментально полученных входных данных), если разные ТРИФОСФАТЫ эндонуклеазами комбинируются или насыщения анализ выполняется на короткий и определенных локус (например представлены BACs).

Disclosures

Авторы не имеют ничего сообщать.

Acknowledgments

Авторы хотели бы поблагодарить профессора д-ра Стефана Бек и профессор доктор Магдалена Гетц за их вклад, помощь и поддержку в разработке метода женский, Максимилиан Wiessbeck и Валентин Бауманн за полезные замечания. Работа была поддержана DFG (STR 1385/1-1).

Materials

Name Company Catalog Number Comments
500 mM EGTA Sigma Aldrich 03777-10G 1.4., Inactivation of Mnase
Novex Hi-Density TBE Sample Buffer Thermo Fisher Scientific LC6678 2.1.
Novex® TBE Gels, 20%, 10 well Thermo Fisher Scientific EC6315BOX 2.1., pre-made 20 % PAGE gel
O'RangeRuler 5 bp DNA Ladder, Thermo Fisher Scientific SM1303 2.1.
Novex® TBE Running Buffer Thermo Fisher Scientific LC6675 2.1., PAGE gel running buffer
Disposable scalpel, sterile VWR  233-5363  2.3., other equivalent reagents may be used
SYBR Green I nucleic acid stain (1000x concentrate in DMSO) Sigma Aldrich
S9430
2.3. +2.5., also available from Thermo Fisher Scientific (S7563)
UltraPure Phenol:Chloroform:Isoamyl Alcohol (25:24:1) Thermo Fisher Scientific 15593-031 3.6.1. + 4.3., other equivalent reagents may be used
Glycogen Sigma 10901393001 3.6.4., other equivalent reagents may be used
3M Sodium acetate , pH5.2 Thermo Fisher Scientific   R1181 3.6.4., other equivalent reagents may be used
Ethanol  3.6.4. + 9.1.8., molecular biology grade
Quick blunting kit  New England Biolabs E1201 4.1.
ammomium acetate Sigma
A1542
3.1., other equivalent reagents may be used
magnesium acetate Sigma
M5661
3.1., other equivalent reagents may be used
0.5 M EDTA (pH 8.0) VWR   MOLEM37465520 (or Promega V4231) 2.2. + 3.1., other equivalent reagents may be used
Agencourt AMPure XP beads Beckman coulter A63881 5.3. + 6.5.
Gel extraction kit QIAGEN 28704 5.7.+ 7.1. +8.4., other equivalent reagents may be used
concentrated T4 DNA ligase New England Biolabs  M0202T 6.1.+ 8.1.2.
Long Amp Taq 2X Master Mix  New England Biolabs M0287S 6.3.
Phusion High-Fidelity PCR Master Mix with HF Buffer New England Biolabs M0531S 5.1. + 6.6., other equivalent reagents may be used
HindIII New England Biolabs R0104S 5.4.1. 
SacII New England Biolabs R0157S 5.4.2.
AgeI New England Biolabs R0552S 8.2.1.
Tris base Sigma 93362 8.1.1.
2M MgCl Sigma 93362 8.1.1.
dGTP,dATP, dCTP, dTTP New England Biolabs N0446S 8.1.1.
DTT Sigam
DTT-RO
8.1.1.
PEG-8000  Sigma
P5413
8.1.1.
NAD Sigma
N6522
8.1.1.
T5 exonuclease New England Biolabs M0363S 8.1.2.
Phusion DNA polymerase  New England Biolabs M0530S 8.1.2.
Taq DNA ligase New England Biolabs M0208L 8.1.2.
rSAP New England Biolabs M0371S 8.3.1.
TG1 competent cells Lucigen 60502-1 9.1.
1mm gap electroporation cuvettes  VWR 732-2267  10.2.
Bio-Assay Dish (Polystyrene, 245 mm x 245 mm x 25 mm) Fisher Scientific DIS-988-010M  9.4.
NaCl Sigma S7653  9.3.
Bacto-tryptone BD 211705 9.3.
Yeast extract BD 212750 9.3.
Agar Sigma
A1296
9.4.
Glycerol Sigma
G5516
9.17.
MNAse New England Biolabs M0247S 1.1.
Nanodrop Thermo Fisher Scientific ND-2000 throughout
Micropulser Biorad 165-2100 10.2.
Electroporation cuvettes Biorad 732-2267  10.2.
250 ml centrifuge tubes Corning 430776 9.1-9.9.

DOWNLOAD MATERIALS LIST

References

  1. Mali, P., Esvelt, K. M., Church, G. M. Cas9 as a versatile tool for engineering biology. Nat Methods. 10, (10), 957-963 (2013).
  2. Yang, H., et al. One-step generation of mice carrying reporter and conditional alleles by CRISPR/Cas-mediated genome engineering. Cell. 154, (6), 1370-1379 (2013).
  3. Stricker, S. H., Koferle, A., Beck, S. From profiles to function in epigenomics. Nat Rev Genet. 18, (1), 51-66 (2017).
  4. Dominguez, A. A., Lim, W. A., Qi, L. S. Beyond editing: repurposing CRISPR-Cas9 for precision genome regulation and interrogation. Nat Rev Mol Cell Biol. 17, (1), 5-15 (2016).
  5. Shalem, O., et al. Genome-scale CRISPR-Cas9 knockout screening in human cells. Science. 343, (6166), 84-87 (2014).
  6. Wang, T., Wei, J. J., Sabatini, D. M., Lander, E. S. Genetic screens in human cells using the CRISPR-Cas9 system. Science. 343, (6166), 80-84 (2014).
  7. Koike-Yusa, H., Li, Y., Tan, E. P., Velasco-Herrera Mdel, C., Yusa, K. Genome-wide recessive genetic screening in mammalian cells with a lentiviral CRISPR-guide RNA library. Nat Biotechnol. 32, (3), 267-273 (2014).
  8. Hart, T., et al. High-Resolution CRISPR Screens Reveal Fitness Genes and Genotype-Specific Cancer Liabilities. Cell. 163, (6), 1515-1526 (2015).
  9. Koferle, A., et al. CORALINA: a universal method for the generation of gRNA libraries for CRISPR-based screening. BMC Genomics. 17, (1), 917-940 (2016).
  10. Lane, A. B., et al. Enzymatically Generated CRISPR Libraries for Genome Labeling and Screening. Dev Cell. 34, (3), 373-378 (2015).
  11. Sambrook, J., Russell, D. W. Isolation of DNA fragments from polyacrylamide gels by the crush and soak method. CSH Protoc. (1), (2006).
  12. Gibson, D. G. Enzymatic assembly of overlapping DNA fragments. Methods Enzymol. 498, 349-361 (2011).
  13. Elsaesser, R., Paysan, J. Liquid gel amplification of complex plasmid libraries. Biotechniques. 37, (2), 200-202 (2004).
Универсальный протокол для крупномасштабных gRNA библиотека производства из любого источника ДНК
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Köferle, A., Stricker, S. H. A Universal Protocol for Large-scale gRNA Library Production from any DNA Source. J. Vis. Exp. (130), e56264, doi:10.3791/56264 (2017).More

Köferle, A., Stricker, S. H. A Universal Protocol for Large-scale gRNA Library Production from any DNA Source. J. Vis. Exp. (130), e56264, doi:10.3791/56264 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter