Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Un protocolo Universal para la gRNA a gran escala de producción de la biblioteca de cualquier fuente de ADN

doi: 10.3791/56264 Published: December 6, 2017

Summary

Métodos para la generación de bibliotecas de gRNA a gran escala deben ser simple, eficiente y rentable. Se describe un protocolo para la producción de bibliotecas de gRNA basado en la digestión enzimática del ADN diana. Este método, CORALINA (gRNA integral generación de biblioteca a través de la actividad de nucleasa controlados) presenta una alternativa a la síntesis de oligonucleótidos de encargo costosos.

Abstract

La popularidad del sistema CRISPR/Cas9 de genoma y epigenoma ingeniería proviene de su simplicidad y adaptabilidad. Una unidad de efectos (la nucleasa Cas9 o una proteína de fusión de nucleasa-dead dCas9) está dirigido a un sitio específico en el genoma por un pequeño arn sintético conocido como RNA de la guía, o gRNA. La naturaleza bipartita del sistema CRISPR permite su utilización en los enfoques de detección desde bibliotecas de plásmidos que contienen cassettes de expresión de miles de gRNAs individual se pueden utilizar para interrogar a muchos sitios diferentes en un solo experimento.

Hasta la fecha, gRNA secuencias para la construcción de las bibliotecas se han generado casi exclusivamente por síntesis de oligonucleótidos, que limita la posible complejidad de secuencias en la biblioteca y es relativamente costosa. Aquí, un detallado protocolo de CORALINA (generación de biblioteca de gRNA integral a través de la actividad de nucleasa controlados), un sencillo y un método rentable para la generación de bibliotecas de gRNA altamente complejo basado en la digestión enzimática de la entrada de ADN, se describe. Puesto que de cualquier fuente de ADN, se pueden generar bibliotecas CORALINA, un montón de opciones para personalización existen, lo que permite una gran variedad de pantallas de CRISPR.

Introduction

La adaptación del sistema CRISPR/Cas9 bacteriana como herramienta segmentación molecular causó la más reciente revolución en biología molecular. Nunca antes ha sido tan fácil manipular cromatina en lugares genómicos definidos. Usos comunes de CRISPR incluyen mutaciones de genes específicos1, genoma ingeniería2, epigenoma, edición3, activación transcripcional y4el silenciamiento del gen. Una ventaja particular del sistema CRISPR es que sus aplicaciones no se limitan a sitios candidato bien estudiados, como bibliotecas de gRNA pantallas menos sesgadas posible. Éstos facilitan el descubrimiento de lugares geométricos funcionales en el genoma sin ningún previo conocimiento experimental. Sin embargo, gRNA biblioteca construcción actualmente en su mayoría se basa en la síntesis de oligo-nucleótidos y existen limitadas opciones para comprar gRNA bibliotecas que no son de humanos o regiones de origen o destino de ratón fuera abren marcos de lectura. Así, aunque CRISPR pantallas ya han demostrado ser increíblemente potente5,6,7,8, su potencial ha no sido explotado.

Para superar la limitación de dos estrategias de gRNA clásica generación métodos han sido desarrollados recientemente. Ambas se basan en la digestión enzimática controlada de ADN diana en lugar de depender de la síntesis del oligonucleótido personalizado. Mientras que CORALINA9 emplea nucleasa micrococcal, el método alternativo actualmente disponible sólo, comer CRISPR10, hace uso de enzimas de restricción (HpaII, ScrFI, BfaI y MmeI). Lo importante, ambas técnicas pueden ser aplicadas a cualquier entrada del ADN, que sirve como fuente de gRNA protospacer secuencias. Mientras que el método comer CRISPR emplea una estrategia para disminuir el número de gRNAs clonados cuyos sitios apuntados no son seguidos por la necesaria PAM S.pyogenes (motivo adyacente protospacer), genera sólo una pequeña fracción de todos los gRNAs funcionales posible para un región determinada. CORALINA, por otra parte, es capaz de generar todos los gRNAs posibles para la secuencia de origen, pero también incorpora una mayor fracción de guías no funcional. gRNA generación de biblioteca a través de la actividad de nucleasa controlado permite la producción de bibliotecas de gRNA integral para cualquier especie, cualquier sistema Cas9 proteína o - efectoras de una manera simple y rentable. Por otra parte, CORALINA es adaptable a la personalización, como opciones de entrada y el vector apropiados definición el tipo de biblioteca, tamaño y contenido. Aquí, se presenta un protocolo detallado que puede ser utilizado para la generación de bibliotecas de gRNA integral de diversas fuentes de ADN (figura 1), incluyendo los cromosomas artificiales bacterianos (BACs) o genomic ADN9. Los resultados representativos que acompaña a este protocolo se obtuvieron aplicando el protocolo CORALINA al ADN BAC.

Protocol

1. digestión del ADN con nucleasa Micrococcal

  1. Llevar a cabo una reacción de optimización para cada nuevo lote de enzima nucleasa micrococcal (MNase).
    Nota: El número de unidades de MNase utilizado debe ser probado (usando una dilución seriada, figura 2A). Generalmente, 5-10 U de MNase digerir 1 μg de purificada genómico o DNA BAC a un rango de 5-100 bp con las condiciones descritas a continuación.
  2. Por reacción, configurar 1 μl de 10 x Buffer de MNase, 1 x albúmina de suero bovino (BSA), 1 μg de ADN, 1 μl de MNase Diana (0.1-50 unidades) en un volumen de reacción de 10 μl.
  3. Incubar a 37 ° C durante 15 minutos.
  4. Inmediatamente inactivar la enzima al añadir 1 μl de 500 mM el glicol de etileno-bis(β-aminoethyl ether)-N, N, N', N'-tetraacético ácido (EGTA).

2. separación de ADN de fragmentos mediante electroforesis en Gel de poliacrilamida (PAGE)

  1. Añadir gel tampón muestra cargando el tinte que muestras de ADN y cargar en un 20% gel de página. Una escalera de ADN apropiada para el tamaño de la carga (5 bp DNA Ladder). No sobrecargue el gel (1 μg ADN por pozo).
  2. Deje correr geles en apropiado 1 x TRIS-borato-EDTA (TBE) corriente buffer a 150 V (constante) de alrededor de 1.5 h o hasta que el frente inferior de tinte (color azul oscuro, azul de bromofenol) que viaja a alrededor de 15 bp, alcanza el extremo inferior del gel.
  3. Teñir el gel con una mancha de ácido nucleico ultra sensible y visualizar bajo luz UV.
  4. De la imagen de gel, determinar la concentración óptima de MNase que digiere ADN hasta 20-30 PB de tamaño.
  5. Utilizar la concentración optimizada de MNase digerir el ADN diana mediante la repetición de pasos 1.2-2.2. Por lo general, configuración de 10-12 reacciones (es decir, 10-12 μg del total a partir de material) producirá suficiente digiere ADN después de la extracción del gel de página para proceder a realizar los siguientes pasos.
  6. Con un bisturí estéril, cortar el gel junto al carril de marcador y solamente la parte del gel que contiene la escalera con frescos 1 x TBE funcionamiento tampón que contiene 1 X de una mancha de ácido nucleico ultra sensible de la mancha. Visualizar la escalera de ADN y suprimir fragmentos de ADN digeridos MNase en el rango de tamaño entre aproximadamente 18-30 bp usando una cuchilla de afeitar.
    Nota: Evite exponer los fragmentos digerido MNase a la luz UV. Es posible utilizar una fuente de luz azul (en vez de UV) o tomar una imagen de la escalera bajo UV, imprimirlo para escalar y utilícelo para la supresión de fragmentos de ADN digeridos MNase). Este paso evita la coloración y la exposición de fragmentos de ADN a la luz UV. Siempre use un bisturí desechable estéril, sin usar u hoja de afeitar para este paso para evitar la contaminación.
  7. Transferir el trozo de gel a un tubo de microcentrífuga.
  8. El resto del gel de la mancha con la mancha de ácido nucleico como arriba, exponer a la luz UV y grabar una imagen para llevar un registro del paso de la supresión de gel.

3. aislamiento de fragmentos de ADN de geles de página utilizando el método de remojo y Crush

Nota: Este paso se ha adoptado de Sambrook et al. 11

  1. Preparar página de tampón de solubilización de gel (1,88 mL de acetato de amonio de 4 M, 150 μL de acetato de magnesio de 1 M, 30 μl de ácido de 0,5 M de etilendiaminotetracético (EDTA) (pH 8) ultrapura de H2O para un volumen total de 15 mL).
  2. Aplastar la rebanada de gel suprimido contra la pared del tubo de microcentrífuga utilizando una pipeta estéril.
  3. Añadir 2 volúmenes de tampón de solubilización página del gel e incubar a 37 ° C por 16 h en una plataforma giratoria.
  4. Centrifugar las muestras durante 1 min a velocidad máxima en una microcentrífuga. Transferir el sobrenadante a un tubo nuevo de microcentrífuga, teniendo cuidado de no para transferir los trozos de gel machacado.
  5. Añadir 0,5 volúmenes de tampón de solubilización de página sobre el gel de la pelotilla, vortex y repita la centrifugación (paso 3.4). Combinar los sobrenadantes.
  6. Extraiga los fragmentos de ADN mediante extracción estándar de fenol-cloroformo.
    PRECAUCIÓN: El fenol es tóxico si entra en contacto con la piel o ingestión. Medidas de seguridad tales como guantes, gafas protectoras, una bata de laboratorio y trabajar en una campana de humos son críticos. Deseche todos los residuos que contienen fenol según las normas del Instituto.
    1. Añadir un volumen de fenol: cloroformo: isoamílico alcohol (25:24:1) a la muestra y el vórtice completamente.
    2. Centrifugar 10 min a máxima velocidad (16.000 x g) en una centrífuga de mesa a temperatura ambiente. Cuidadosamente transferir la fase acuosa superior a un tubo de microcentrífuga fresco. Tenga cuidado de no para llevar sobre cualquier fenol durante el pipeteo.
    3. Repita los pasos 3.6.1 y 3.6.2 una vez.
    4. Añadir una cantidad pequeña (0.2 μL) del glucógeno, 0,1 volúmenes de acetato de sodio de 3 M (pH 5,2) y 2 volúmenes de etanol (EtOH) del 100%.
    5. Vórtice e incubar a-20 ° C durante varias horas o toda la noche.
    6. Centrifugar por 30 min a velocidad máxima a 4 ° C utilizando una centrífuga de mesa.
    7. Cuidadosamente Quite el sobrenadante y lavar el pellet de ADN con el 70% EtOH.
    8. Centrifugar por 30 min a velocidad máxima a 4 ° C utilizando una centrífuga de mesa.
    9. Quite el sobrenadante y secar el pellet de DNA. Asegúrese de que se haya evaporado todo el EtOH, pero tenga cuidado de no sobre-secar el pellet.
    10. Disolver el pellet de ADN en 12 μl de H2O.
      Nota: La página gel de extracción es muy ineficiente. Por cada 10 μg de ADN digerido con MNase de comenzar, espera recuperar ng 1-20 de fragmentos purificados después de la extracción del gel. Controlar la cantidad e integridad de los fragmentos por la carga de 1/6th (2 μL) en un gel de página (figura 2).

4. final reparación de fragmentos digeridos MNase, purificada de Gel

  1. Establecer la siguiente reacción utilizando un ADN embotar kit: 10 μl de DNA purificado de paso 3.6.10, 1,5 μl de 10 X mitigar de buffer, 1,5 μl de mezcla de dNTP 1 mM, 0,6 μl de enzima blunting, 1,4 μL de H2O.
  2. Incubar a 22 ° C durante 30 minutos y luego calor-inactivar la enzima por la incubación a 70 ° C durante 10 minutos.
  3. Añadir 85 μl de H2O y realizar una reacción de limpiar utilizando estándar de fenol y cloroformo-extracción y precipitación de EtOH (como se describe en la sección 3.6). Proceder inmediatamente a la ligadura de vinculador.

5. vinculador generación

Nota: Enlazadores deban ampliarse en paralelo con la sección 3 para poder proceder de inmediato con la ligadura del vinculador. Secuencias de primer utilizadas a continuación deben ser apropiadas para el vector de expresión de gRNA solicitadas. Los presentados aquí han sido diseñados para el vector pgRNA-pLKO.1. 9 para la amplificación de 5' linker de pgRNA-pLKO.1, use la cartilla secuencias 5'-linker-F (TTGGAATCACACGACCTGGA) y 5'-linker-R (CGGTGTTTCGTCCTTTCCAC), obtención de un amplicón de bp 689. Para la amplificación de 3' linker de pgRNA pLKO.1, utilizar los primers 3'-linker-F: (GTTTTAGAGCTAGAAATAGCAAGTTAAAATA) y 3'-linker-R: (ACTCGGTCATGGTAAGCTCC), que producen un amplicón de bp 848.

  1. Amplificar por PCR el adaptador secuencias desde el vector de expresión de gRNA (reactivos de opción personalizado primer secuencias y, si es necesario). Para configurar la siguiente reacción de PCR de 50 μl de pgRNA-pLKO.1: 25 μl de la mezcla principal de PCR, 2.5 μl de primer F (10 μm), 2.5 μl de primer R (10 μm), 0,1 ng de vector de la expresión de la gRNA (pgRNA-pLKO.1) en H2O.
  2. Incubar las reacciones en un termociclador con las siguientes condiciones: 1 ciclo de 98 ° C por 30 s, 32 ciclos de 98 ° C por 10 s, 59 ° C por 10 s, 72 ° C por 30 s, 1 ciclo de 72 ° C durante 10 minutos.
  3. Purificar las reacciones de polimerización en cadena con perlas de inmovilización reversible fase sólida según las instrucciones del fabricante. Eluir en 30 μl de H2O.
  4. Aplicar ligadura direccional del vinculador a los fragmentos de ADN reparado extremo, la digestión MNase, enlazadores de digestión con enzimas de restricción apropiadas ( HindIII y SacII). Configurar las siguientes reacciones:
    1. Para la digestión de 5' linker con HindIII, usar 30 μl de purificada 5' linker amplicon de paso 5.3., 5 μl de tampón, 3 μl de HindIII (20U/μL) y 12 μl de H2O.
    2. Para la digestión de 3' linker con SacII, usar 30 μl de purificada 3' linker amplicon de paso 5.3., 5 μl de tampón, 3 μl de SacII (20 U/μL) y 12 μl de H2O.
  5. Incubar los resúmenes a 37 ° C durante 3 horas.
  6. Añadir gel de ADN carga colorante y ejecutar los resúmenes de la enzima de la restricción en un gel de agarosa al 1%. Suprimir las bandas en 637 bp (5' digest linker) y 295 bp (recopilación del vinculador de 3').
  7. Purificar el ADN de las piezas de gel suprimido usando un kit de extracción de gel.

6. enlazador ligadura e insertos

  1. Establecer una reacción de ligadura 14 μl utilizando cantidades equimolares de fragmentos digeridos MNase, fin reparar y secuencias del linker.
    Nota: Vinculador a los cocientes del fragmento puede ser optimizado. Se recomienda incluir una reacción no-fragmento control (NFC).
    1. Uso 5 ng de MNase digiere fragmentos (final reparado y purificada), 120 ng de 5' linker (HindIII recopilación, purificada), 55 ng 3' linker (recopilación IISac, purificada) y 1,4 μL de T4 ligasa Buffer 1,4 μL de concentración T4 ADN ligasa en H2O.
  2. Incubar las reacciones de ligadura a 16 ° C por 16 h. Hacer no Inactive por calor el enzima. Proceder de inmediato a nick-traducción.
    Nota: Los fragmentos de MNase-digerido fin reparado que los 5' fosfatos necesarios para la ligadura de los enlazadores, como el enlazador son no-fosforiladas.
  3. A la ligadura de la reacción (y la reacción de NFC) agregar lo siguiente: 25 μl de Taq 2 X master mix (capaz de traducción de nick), 2.5 μl de primer vinculador-Minus450-F (10 μm, GGGCAAGTTTGTGGAATTGG), 2.5 μl de primer vinculador-Plus275-R (10 μm, AAGTGGATCTCTGCTGTCCC) y 6 μl de H2O.
  4. Incluir un control de plantilla no (NTC). Incubar las reacciones en un termociclador con las siguientes condiciones: 1 ciclo (nick translation): 72 ° C por 20 min, 1 ciclo: 95 ° C por 5 min, 3-4 ciclos: 95 ° C por 15 s, 58 ° C durante 15 s, 72 ° C por 30 s, 1 ciclo: 72 ° C durante 5 minutos.
  5. Llevar a cabo una reacción limpiar usando granos de inmovilización reversible de fase sólida con una muestra y la proporción de grano de 1:1. Eluir en 40 μl de H2O.
  6. Más amplificar el fragmento deseado (fragmento de vinculador 5' + MNase + 3 ' linker) utilizando reactivos de PCR correspondientes y los siguientes cebadores:
    1. Uso de 12,5 μl de la mezcla principal de PCR, 1.25 μl de cebador vinculador-Minus450-F (10 μm, GGGCAAGTTTGTGGAATTGG), 1.25 μl de cebador vinculador-Plus275-R (10 μm, AAGTGGATCTCTGCTGTCCC), 2.5 μl de producto de traducción de nick purificada de paso 6.4. y 7.5 μl de H2O. de las siguientes condiciones: 1 ciclo: 98 ° C por 30 s, ciclos de 10-16: 98 ° C por 10 s, 63 ° C durante 10 s, 72 ° C durante 15 s, 1 ciclo: 72 ° C durante 10 minutos.
      Nota: Si es necesario, varias reacciones pueden configurarse en paralelo para asegurar que hay suficiente producto PCR para los pasos posteriores. Para visualizar pequeñas cantidades del producto PCR en un gel de agarosa, establecer reacciones adicionales como en el paso 6.5 y aumentar el número de ciclo de 15 a 32. Esta reacción puede utilizarse como control de calidad, si amplicones no son visibles después de 15 ciclos. No incluyen también un ninguna plantilla control (NTC).

7. preselección

Nota: Este paso separa MNase fragmentos con el vinculador correctamente adjunto 5' y 3' de fragmentos con dos 5' o dos 3' enlazadores basan en el tamaño.

  1. Combinar todas las reacciones de PCR 15-ciclo de paso 6.5. Añadir ADN carga del tinte y correr en un gel de agarosa al 0.8%. Impuestos especiales de la prominente banda 869 bp y purificar el ADN utilizando un kit de extracción de gel.
  2. Cuantificar la cantidad de ADN (por ejemplo, usando un espectrofotómetro).

8. clonación de fragmentos amplificados por PCR en el gRNA expresión Vector por Asamblea de Gibson

  1. Preparar la Asamblea principal mezcla como sigue:
    Nota: Los siguientes pasos son adaptados de Gibson et al. 12.
    1. Crear 6 mL de tampón de reacción isotérmica mediante la combinación de 3 mL de 1 M Tris (hidroximetil) aminometano (Tris)-HCl, pH 7,5, 300 μL de MgCl M 1, 60 μL de trifosfato de desoxiguanosina de 100 mM (dGTP), 60 μL de trifosfato de desoxiadenosina de 100 mM (dATP), 60 μL de deoxythymidine de 100 mM trifosfato (dTTP), 60 μL de trifosfato de 100 mM desoxicitidina (dCTP), 300 μL de 1 M dithiothreitol (DTT), 1,5 g de polietilenglicol (PEG)-8000, 300 μL de 100 mM nicotinamida adenina dinucleótido (NAD) en ultrapura H2O.
      Nota: Esta memoria intermedia puede alícuotas y almacenado a-20 ° C.
    2. Crear 1,2 mL Asamblea principal mezcla combinando 320 μl de 5 X buffer de reacción isotérmico, 3 μl de 10 U/μl T5 exonucleasa, 20 μl de 2 U/μl de ADN polimerasa, 160 μl de 40 ligase de la DNA U/μL en ultrapura H2O. uso 15 μl de la mezcla principal Asamblea con 5 μl de insertar.
      Nota: La mezcla principal de montaje puede ser alícuotas y almacenado a-20 ° C, donde es estable durante más de un año y puede tolerar múltiples ciclos de hielo-deshielo. La cantidad solicitada de T5 exonucleasa es ideal para uso con voladizos largos.
  2. Digestión de vector columna vertebral
    Nota: Asegúrese de que digerir una cantidad suficiente de vector como entrada para el número deseado de las reacciones de ensamblaje en paso 8.3.
    1. Por reacción, añadir lo siguiente: 1,5 μg de gRNA expresión vector (pgRNA-pLKO.1), 5 μl de tampón, 1,5 μl de edaddigerir la I (5U/μL) y 38.5 μl de H2O. incubar a 37 ° C por 2 h.
  3. Desfosforilación del vector linearizado.
    Nota: Este paso es aconsejable, pero no es estrictamente necesaria. Exonucleasa de T5 en la mezcla principal sobre todo eliminará la edadsobresale antes el ligase de la DNA de Taq ha tenido la oportunidad de actuar. Por lo tanto, no se espera excesiva la ligadura del vector.
    1. Añadir 2,5 μl de enzima de phosphatase alcalino del camarón (rSAP, 1 U/μL).
    2. Incubar a 37 ° C durante 30 min y luego inactivar la enzima por incubación a 65 ° C durante 5 minutos.
  4. Realizar la purificación de DNA
    Nota: Se recomienda realizar un paso de extracción de gel de agarosa. Como alternativa, puede usarse purificación columna o grano. Es importante comprobar que la digestión del vector es completa, por ejemplo, la electroforesis en gel de agarosa. Para la comparación, vector sin digerir se debe ejecutar en paralelo.
  5. Cuantificar la cantidad de purificada vector digerido de la muestra.
  6. Establecer la Asamblea 2 veces exceso molar de inserciones a vector. Por 20 μl reacción uso 100 ng de vector (edaddigiero del paso 8.5), 12.2 ng de introducir (desde el paso 7.1.), 15 μl de la mezcla principal montaje de paso 8.1.2. en H2O.
  7. Incubar a 50 ° C durante 1 hora.
  8. Purificar las reacciones mediante la purificación de la columna. Resuspender el DNA en 75 μl de H2O (o volumen dependiendo de la escala de la electroporación).
    Nota: La eficiencia de transformación es grandemente dependiente de la pureza del ADN. Pasos de purificación adicionales (por ejemplo, extracción de fenol/cloroformo) podrían mejorar la eficiencia.

9. preparación de células de e. coli competentes Electro TG1

  1. Asegúrese de que todos centrifugar botellas y frascos están libres de detergentes de lavado y posterior relleno con agua destilada antes de autoclavar.
    Nota: Este paso ayuda a eliminar las impurezas que puedan afectar la eficiencia de transformación. Agua debe ser desechado inmediatamente antes del uso. Alternativamente, puede ser recomendable utilizar botellas desechables de centrifugación.
  2. Asegúrese de que se enfría botellas de centrífuga, tubos y soluciones que se utilizan para la preparación de las células de espectro en antes hielo. Es mejor llevar a cabo los siguientes pasos en una cámara fría para minimizar las fluctuaciones de temperatura que pueden afectar la eficiencia de transformación.
  3. Preparar medio 2TY. 16 g de bacto triptona, 10 g de extracto de levadura y 5 g de NaCl, añaden agua destilada a 1 L, mezclar y autoclave. Medio de almacén a temperatura ambiente.
  4. Preparar agar 2TY cubierto prueba platos y platos de Petri de 10 cm que contienen el antibiótico apropiado. Almacenar las placas a 4 ° C.
    Nota: La elección del antibiótico depende de la naturaleza del vector de expresión de gRNA, uso 100 μg/mL ampicilina para pgRNA-pLKO.1.
  5. Quitar de un stock de glicerol de células TG1 para inocular 10 mL de medio de 2TY (sin antibióticos).
  6. Incubar el cultivo a 37 ° C durante la noche (~ 16 h) con agitación a 225 rpm.
  7. Inocular 1 L de medio 2TY (sin antibióticos) con 10 mL de la cultura durante la noche (dilución 1/100) y dividir igualmente entre dos frascos de 2 L (contiene deflectores).
  8. Incubar el cultivo a 37 ° C, 225 rpm hasta llega a una OD600 nm de 0.55 (después de aproximadamente 1.5-2 h). Use un espectrofotómetro Compruebe regularmente la OD600 nm.
  9. Culturas Chill en hielo durante 30 minutos.
  10. Dividir la cultura igualmente entre cuatro botellas de centrífuga 500 mL (previamente enfriado en hielo).
  11. Centrifugar 15 min a 4.000 x g a 4 ° C en una centrifuga previamente enfriada.
  12. Decantar el sobrenadante y agregar 1 volumen (es decir, 250 mL) de la fría helada estéril destilada H2O a cada una de las botellas de centrífuga. Resuspender el precipitado bacteriano por agitación o inversión de la botella (o mediante pipeteo suave, si es necesario).
    Nota: Es más fácil Resuspender el precipitado añadiendo primero un pequeño volumen de agua. Asegúrese de que el sedimento es totalmente suspendido finalmente.
  13. Centrifugar 15 min a 4.000 x g a 4 ° C.
  14. Repetir el lavado dos veces (pasos 9.12. y 9.13). Eliminar el sobrenadante. Tenga cuidado cuando la decantación como el pellet bacteriano se convierte cada vez más flojo después del lavado.
  15. Resuspender el precipitado en 50 mL de glicerol al 10% estéril, helada y transfiéralo a un tubo de centrífuga refrigerada pre-50 mL.
  16. Centrifugar las células durante 15 min a los ~ 4.000 x g a 4 ° C. Retire con cuidado el sobrenadante.
  17. Resuspender suavemente las bacterias en 2 mL de helado glicerol estéril al 10%.
  18. Mantenga en hielo si las células se van a utilizar inmediatamente para la electroporación.
    Nota: Las células se pueden congeladas en alícuotas de 50 μL en tubos de 0.5 mL en un baño de hielo seco etanol y almacenadas a-80 ° C, pero no es recomendable.

10. electroporación de células de e. coli de espectro TG1

Nota: Electroporación es uno de los cuellos de botella en la generación completa. Para conservar la representación de la biblioteca, se recomienda llevar a cabo tantas reacciones de electroporación individuales es necesario/posible y realizar los pasos de control de calidad se describen a continuación (10.6. y 10.8.).

  1. Tubos alícuota de las reacciones purificadas (de paso 8.8) en PCR estéril y previamente enfriada y mantenerse en hielo (1 μl por tubo). Chill cubetas de electroporación de brecha de 1 mm en el hielo.
  2. Añada 25 μl de células TG1 recién preparadas directamente a una alícuota de ADN y transferir inmediatamente la mezcla en una cubeta de electroporación. Flick o golpear ligeramente la cubeta para asegurar que la mezcla de células ADN está distribuida a lo largo de la longitud de la recámara de la cubeta (sin aire ni burbujas).
  3. Colocar la cubeta en la cámara de la diapositiva e inicia el programa de electroporación apropiado (por ejemplo 1 pulso de 1,8 kV (EC1)).
    Nota: La constante de tiempo debe mentir entre 5.7 y 6.0 la Sra. en el caso de los arcos electroporator, flick la cubeta, no existan burbujas de aire en la cámara y vuelva a intentarlo.
  4. 975 μl de medio de temperatura 2TY añadir a la cubeta.
  5. Utilizando una pipeta de transferencia, hacia las bacterias de electroporated un tubo de 50 mL. Repetir desde el paso 10.2. y recoger todas las células transformadas con una biblioteca en un tubo de 50 mL.
  6. El volumen total de documentos.
  7. Paso de control de calidad
    1. Para cuantificar la capacidad de las células recién generadas electro-competente, llevar a cabo una reacción de electroporación separado con una cantidad definida de plásmido sin cortar DNA (e.g. 10 pg pUC19 control plásmido). Transferir esto a un tubo de microcentrífuga de 1,5 mL.
      Nota: La competencia debe ser al menos 1010 colonias formando unidades (UFC) por μg de ADN. Las células recién preparadas suelen realizan algo mejor que esto.
  8. Incubar las bacterias transformadas a 37 ° C durante 60 min agitando a 225 rpm.
  9. Paso de control de calidad:
    1. Placa una pequeña cantidad definida de bacterias transformadas con la biblioteca (por ejemplo 10 μl de una dilución de 10-100 veces) en una placa de agar de 10 cm con la selección apropiada de antibióticos.
      Nota: Conociendo el volumen total de la cultura (desde el paso 10.6.), el número de colonias obtenido puede utilizarse para estimar el número total de colonias por toda la biblioteca. Idealmente debe mantenerse 20-30 doble representación de la biblioteca.
  10. Dispersar el resto de las bacterias a 2TY agar cubierto prueba platos que contiene la selección apropiada de antibióticos.
    Nota: El volumen de la cultura puede reducirse mediante centrifugación a ~ 4.000 x g durante 10 minutos (o hasta que se ha formado un sedimento visible y el sobrenadante aparece claro). Esto reduce el tiempo de las placas necesitan secar después de separarse de la cultura. Uso de placas en lugar de cultivo líquido minimiza el desproporcionado crecimiento de colonias individuales. 13
  11. Extender un volumen adecuado de la reacción de electroporación control de pUC19 en un plato de agar 10 cm adicionales de selección antibiótica apropiada.
  12. Incubar las placas de agar durante la noche (16 h) a 37 ° C.
  13. Cuenta colonias obtenidas en las placas de control (placa pUC19 y control de la biblioteca) para estimar la UFC/μg de ADN de las bacterias así como de la complejidad de la biblioteca.

11. extracción de ADN plásmido

  1. Añadir 10 mL de medio de 2-TY a las placas durante la noche, raspar la capa bacteriana la placa usando un esparcidor de desechable y recoger en un tubo de 50 mL. Repita unas cuantas veces hasta que todos los de la placa aparece limpia.
  2. Extraer ADN con el equipo de Maxi de plásmido (2-3 columnas necesitan por Bio-ensayo de la placa).

Representative Results

Utilizando el protocolo a mano, bibliotecas de gRNA CORALINA han sido generadas de humano y ratón genomic DNA9 y BAC ADN (figura 1). Para producir fragmentos de ADN de entrada adecuado para la clonación en vectores de expresión de gRNA, condiciones óptimas para la digestión de la nucleasa controlados tienen que determinarse. Un resultado típico para la optimización de la digestión de la nucleasa micrococcal es representado en la figura 2A. Cantidad insuficiente de nucleasa (0,1, 2, 3, 4, 4.5 o 5 unidades) produce unidades de 5.5-7.5 y no productos sensibles en el rango de tamaño (10-100 PB) todavía se producción fragmentos que son en promedio demasiado largo. Grandes cantidades de enzima (50 unidades) conducen a la degradación excesiva de la entrada de ADN después de 10 min. En consecuencia, una cantidad intermedia fue elegida (10 unidades). La recopilación fue aumentada producir suficientemente digeridos fragmentos para la posterior purificación y clonación (figura 2B). Aunque se recomienda ciegamente seleccionar fragmentos de ADN por tamaño y dependen sólo de la escalera de ADN para la orientación minimizar la exposición de fragmentos de ADN a la luz UV, geles se pueden mancharse luego para control de calidad de digestión y corte. Figura 2B muestra un ejemplo representativo de un gel de página de que ADN fragmentos de entre 20 y 30 bp han sido suprimidos. Gel purificado MNase fragmentos se cargan en un 20% gel página para comprobar tamaño acertada selección y purificación de fragmentos digeridos MNase (figura 2). El protocolo a mano es compatible con el uso de secuencias de vinculador modificado para requisitos particulares, lo que permite para clonar los fragmentos digeridos MNase en gRNA vectores de expresión de la opción. Aquí, gRNA PLKO9 fue utilizado como columna vertebral. Los conectores son amplificadas desde el vector de expresión de gRNA usando PCR estándar. Figura 2D representa un ejemplo representativo de vinculador amplificado secuencias desprovisto de adicional, incorrecta o no amplicons de la plantilla. A continuación, vinculador amplicons son digeridos con enzimas de restricción para conectores se unen a los fragmentos digeridos MNase en la orientación correcta. Figura 2D muestra geles de agarosa de enlazadores 5' y 3' antes y después de la digestión con HindIII y SacII respectivamente, indicando una digestión completa de los enlazadores 637 predicha y 295 bp. La parte derecha de la imagen de gel documenta la supresión de los fragmentos digeridos vinculador. Siguiente extracción de enlazadores digeridos del gel, el siguiente paso en el protocolo es la ligadura de enlazadores a los fragmentos de MNase-digerido fin reparado. Porque se generan secuencias de vinculador por PCR usando las cartillas de unphosphorylated, uno mismo-ligadura de los enlazadores no debería ocurrir. Sólo los fragmentos de ADN digeridos MNase reparado extremo proporcionan los grupos fosfato necesarios para la ligadura. Tras la traducción de nick, el producto de la ligadura es amplificado por PCR. Para evitar el excesivo sesgo de amplificación de PCR que podría sesgar la representación de secuencias de gRNA en la biblioteca, la amplificación se limita a menos de 20 ciclos en total. Tras la PCR, los productos de amplificación son difíciles de visualizar en geles de agarosa. Control independiente de PCRs con 32 ciclos por lo tanto se realizaron para detectar los productos (pero no se utilizan para la preparación de la biblioteca). Resultados de este control PCR se muestran en la Figura 2E. Esto permite optimizar las reacciones de ligadura y asegurar las reacciones están desprovistos de artefactos de la polimerización en cadena, que a veces ocurren en "no controles de fragmentos" (NFC). Figura 2E muestra el amplicón deseado (5' linker + fragmento de ADN 3' linker, longitud: 869 bp) después de la amplificación de las reacciones de ligadura usando equimolares (1:1) relación entre fragmentos y secuencias de vinculador.

Figure 1
Figura 1 : Sugiere la línea de tiempo para preparar una biblioteca de gRNA. CORALINA ofrece una estrategia simple y costo-eficiente para la generación de bibliotecas de gRNA integral de una plétora de diferentes fuentes de ADN de cualquier organismo. El protocolo a mano puede llevarse a término durante una semana de trabajo. Generación de enlazador puede realizarse en paralelo con el final de la reparación del ADN. Preparación de bacterias espectro toma dos días e incluye un paso de crecimiento durante la noche y por lo tanto se debe comenzar antes del montaje se establecen reacciones. Haga clic aquí para ver una versión más grande de esta figura.

Figure 2
Figura 2 : Pasos críticos durante el protocolo de. Controladas (A) digestión del ADN BAC permite generación de fragmentos de diferentes tamaños. Se muestra aquí es la optimización de la digestión MNase. El ADN purificado de BAC fue tratado con diferentes cantidades de MNase para 10 min 10 U de MNase generar fragmentos de ADN de la longitud deseada (20-30 PB). (B) selección de fragmentos de entre 20 y 30 bp mediante supresión de geles de poliacrilamida del tamaño. El ADN purificado de BAC fue tratado con 10 U de MNase durante 10 minutos. La imagen fue grabada después de la supresión. (C) control de calidad de fragmentos purificados de gel. Después de la purificación del gel, 1/6 de la MNase purificada fragmentos se cargan en un 20% gel página para comprobar tamaño acertada selección y purificación. (D) la amplificación de secuencias del linker para la Asamblea y enzima de la restricción digestión de conectores para clonación direccional. 5' y 3' enlazadores fueron amplificados y cortar con HindIII y SacII, respectivamente. Plantilla de no controles (NTC) se incluyeron para controlar artefactos PCR y la contaminación del ADN. Izquierda: aplicación de la muestra analítica; derecha: aplicación de la preparación muestra. Imagen se registró después de la supresión de gel. (E) ligadura acertada de enlazadores para fragmentos de ADN puede ser analizada mediante PCR con un mayor número de ciclos PCR (32) y controlado por no realizar ningún control de plantilla con H2O (NTC) o usando el CNT del paso de traducción anterior de nick como entrada (NTC NT)). Es importante no incluir un ningún fragmento control (NFC), que es una amplificación de una ligadura y nick traducción reacción que fueron omitidos los fragmentos MNase. Sólo las muestras en que MNase los fragmentos se han combinado con linker DNA producen el amplicón esperado (869 bp). Haga clic aquí para ver una versión más grande de esta figura.

Discussion

CORALINA permite generar bibliotecas de gRNA a gran escala mediante digestión controlada de la nucleasa del ADN diana y a granel clonación de fragmentos resultantes de trenzado doble. Inferencia estadística indica que muchas secuencias de gRNA individual7 más de 10 han ya sido con éxito reproducidas usando el protocolo a mano9. CORALINA se puede personalizar de múltiples maneras. La elección de la plantilla de ADN define la región de destino y la complejidad máxima de la biblioteca generada. Usando este protocolo, CORALINA bibliotecas previamente se han generado de humano y ADN genómico del ratón9. Resultados representativos presentados aquí representan la generación de una biblioteca CORALINA de ADN purificado de BAC. Personalización adicional puede lograrse mediante la opción de secuencias de vectores y vinculador de expresión gRNA. Previamente hemos probado tres diferentes pares de longitudes de vinculador para Asamblea de Gibson con pequeñas variaciones en eficiencia9.

Debido a su origen a granel digerido ADN, protospacer de CORALINA gRNAs no suelen ser exactamente 20 bp en longitud, pero mostrar una distribución de longitud con un promedio que depende tanto de los parámetros de la digestión MNase, así como el tamaño de la supresión hecha del gel de la página s. el ejemplo representativo se muestra en la figura 2B y C, muestra fragmentos con una longitud media entre 19 y 27 PB. En nuestra experiencia, la longitud de los fragmentos se conserva fielmente por la gRNA generado protospacer9. Mientras que los fragmentos más cortos de 20 bp debe evitarse debido a la tasa objetivo de gRNAs resultante, más fragmentos son probablemente mucho menos de un problema para aplicaciones posteriores, puesto que ha sido demostraron que gRNAs con protospacers tanto como 45 bp son todavía funcional9.

Los dos pasos más importantes en el protocolo CORALINA son la selección de tamaño de fragmentos digeridos MNase y medidas clonaje. Generación de fragmentos que son demasiado cortos (por ejemplo media menores de 18 años bp) o incorporación de muchos vectores de expresión de gRNA vacía será inutilizar la biblioteca. Por lo tanto, es importante optimizar el paso de la digestión de MNase (figura 2A), para supervisar la supresión (figura 2B, C), Compruebe la digestión completa de la columna vertebral de vector de gRNA y como no hay controles de fragmento en el protocolo. Especial cuidado tiene también que deben tomarse para preservar la representación de la biblioteca de gRNA. Un cuello de botella común de generación de la biblioteca en general es la eficiente transferencia de plásmidos en bacterias para la amplificación. Así, grandes cantidades de bacterias con capacidad excelente y un gran número de eventos de electroporación individuales son necesarias para lograr un alto número de clones de gRNA.

Nuevas estrategias para la producción de la biblioteca de gRNA será necesarios cosechar el potencial de los enfoques basado en el CRISPR durante las próximas décadas. Hay una importante demanda de métodos rentables, simple y personalizables para generar librerías a gran escala, un requisito previo para hacer proyección favorable a un mayor número de sistemas modelo y diferentes enfoques de ingeniería CRISPR. CORALINA es proporcionar un primer paso hacia esto. Los usos potenciales son múltiples, sobre todo para producir bibliotecas completa de los genomas, cDNA derivada bibliotecas de modelo menos común de los sistemas, bibliotecas altamente enfocadas y montajes experimentales en que diversas proteínas CRISPR (con PAM diferentes requisitos) se utilizan en combinación.

A diferencia de otros métodos, CORALINA genera todos gRNAs posible de la entrada de ADN. Sin embargo, una desventaja del método es que gRNAs carecer de la necesaria secuencia de PAM se incluyen también en la biblioteca, una característica que comparte con un segundo método enzimático para la generación de la biblioteca del gRNA, CRISPR-comer (tabla 1). La elección del método ideal para generación de gRNA biblioteca depende de las especificaciones de la proyección prevista experimentar, especialmente la naturaleza (génica, regulación, intergénica) y el tamaño de la región de destino (solo locus, múltiples regiones, genoma). Vemos una boca especial en el uso de CORALINA cuando un gran número de no codificante o regiones reguladoras deben ser analizadas, si hay información incompleta o poco confiable secuencia (sistemas de modelos exóticos, mezclas de especies (por ejemplo, microbiomes) o obtenidos experimentalmente entrada), si se combinan diferentes endonucleasas CRISPR o saturar el análisis se realiza en un lugar corto y definido (por ejemplo, representado por BACs).

Disclosures

Los autores no tienen nada que revelar.

Acknowledgments

Los autores quisieran gracias Prof. Dr. Stephan Beck y Prof. Dr. Magdalena Goetz por sus aportes, ayuda y apoyo en el desarrollo el método CORALINA, Maximiliano Wiessbeck y Valentin Baumann para comentarios. El trabajo ha sido apoyado por DFG (STR, 1385, 1-1).

Materials

Name Company Catalog Number Comments
500 mM EGTA Sigma Aldrich 03777-10G 1.4., Inactivation of Mnase
Novex Hi-Density TBE Sample Buffer Thermo Fisher Scientific LC6678 2.1.
Novex® TBE Gels, 20%, 10 well Thermo Fisher Scientific EC6315BOX 2.1., pre-made 20 % PAGE gel
O'RangeRuler 5 bp DNA Ladder, Thermo Fisher Scientific SM1303 2.1.
Novex® TBE Running Buffer Thermo Fisher Scientific LC6675 2.1., PAGE gel running buffer
Disposable scalpel, sterile VWR  233-5363  2.3., other equivalent reagents may be used
SYBR Green I nucleic acid stain (1000x concentrate in DMSO) Sigma Aldrich
S9430
2.3. +2.5., also available from Thermo Fisher Scientific (S7563)
UltraPure Phenol:Chloroform:Isoamyl Alcohol (25:24:1) Thermo Fisher Scientific 15593-031 3.6.1. + 4.3., other equivalent reagents may be used
Glycogen Sigma 10901393001 3.6.4., other equivalent reagents may be used
3M Sodium acetate , pH5.2 Thermo Fisher Scientific   R1181 3.6.4., other equivalent reagents may be used
Ethanol  3.6.4. + 9.1.8., molecular biology grade
Quick blunting kit  New England Biolabs E1201 4.1.
ammomium acetate Sigma
A1542
3.1., other equivalent reagents may be used
magnesium acetate Sigma
M5661
3.1., other equivalent reagents may be used
0.5 M EDTA (pH 8.0) VWR   MOLEM37465520 (or Promega V4231) 2.2. + 3.1., other equivalent reagents may be used
Agencourt AMPure XP beads Beckman coulter A63881 5.3. + 6.5.
Gel extraction kit QIAGEN 28704 5.7.+ 7.1. +8.4., other equivalent reagents may be used
concentrated T4 DNA ligase New England Biolabs  M0202T 6.1.+ 8.1.2.
Long Amp Taq 2X Master Mix  New England Biolabs M0287S 6.3.
Phusion High-Fidelity PCR Master Mix with HF Buffer New England Biolabs M0531S 5.1. + 6.6., other equivalent reagents may be used
HindIII New England Biolabs R0104S 5.4.1. 
SacII New England Biolabs R0157S 5.4.2.
AgeI New England Biolabs R0552S 8.2.1.
Tris base Sigma 93362 8.1.1.
2M MgCl Sigma 93362 8.1.1.
dGTP,dATP, dCTP, dTTP New England Biolabs N0446S 8.1.1.
DTT Sigam
DTT-RO
8.1.1.
PEG-8000  Sigma
P5413
8.1.1.
NAD Sigma
N6522
8.1.1.
T5 exonuclease New England Biolabs M0363S 8.1.2.
Phusion DNA polymerase  New England Biolabs M0530S 8.1.2.
Taq DNA ligase New England Biolabs M0208L 8.1.2.
rSAP New England Biolabs M0371S 8.3.1.
TG1 competent cells Lucigen 60502-1 9.1.
1mm gap electroporation cuvettes  VWR 732-2267  10.2.
Bio-Assay Dish (Polystyrene, 245 mm x 245 mm x 25 mm) Fisher Scientific DIS-988-010M  9.4.
NaCl Sigma S7653  9.3.
Bacto-tryptone BD 211705 9.3.
Yeast extract BD 212750 9.3.
Agar Sigma
A1296
9.4.
Glycerol Sigma
G5516
9.17.
MNAse New England Biolabs M0247S 1.1.
Nanodrop Thermo Fisher Scientific ND-2000 throughout
Micropulser Biorad 165-2100 10.2.
Electroporation cuvettes Biorad 732-2267  10.2.
250 ml centrifuge tubes Corning 430776 9.1-9.9.

DOWNLOAD MATERIALS LIST

References

  1. Mali, P., Esvelt, K. M., Church, G. M. Cas9 as a versatile tool for engineering biology. Nat Methods. 10, (10), 957-963 (2013).
  2. Yang, H., et al. One-step generation of mice carrying reporter and conditional alleles by CRISPR/Cas-mediated genome engineering. Cell. 154, (6), 1370-1379 (2013).
  3. Stricker, S. H., Koferle, A., Beck, S. From profiles to function in epigenomics. Nat Rev Genet. 18, (1), 51-66 (2017).
  4. Dominguez, A. A., Lim, W. A., Qi, L. S. Beyond editing: repurposing CRISPR-Cas9 for precision genome regulation and interrogation. Nat Rev Mol Cell Biol. 17, (1), 5-15 (2016).
  5. Shalem, O., et al. Genome-scale CRISPR-Cas9 knockout screening in human cells. Science. 343, (6166), 84-87 (2014).
  6. Wang, T., Wei, J. J., Sabatini, D. M., Lander, E. S. Genetic screens in human cells using the CRISPR-Cas9 system. Science. 343, (6166), 80-84 (2014).
  7. Koike-Yusa, H., Li, Y., Tan, E. P., Velasco-Herrera Mdel, C., Yusa, K. Genome-wide recessive genetic screening in mammalian cells with a lentiviral CRISPR-guide RNA library. Nat Biotechnol. 32, (3), 267-273 (2014).
  8. Hart, T., et al. High-Resolution CRISPR Screens Reveal Fitness Genes and Genotype-Specific Cancer Liabilities. Cell. 163, (6), 1515-1526 (2015).
  9. Koferle, A., et al. CORALINA: a universal method for the generation of gRNA libraries for CRISPR-based screening. BMC Genomics. 17, (1), 917-940 (2016).
  10. Lane, A. B., et al. Enzymatically Generated CRISPR Libraries for Genome Labeling and Screening. Dev Cell. 34, (3), 373-378 (2015).
  11. Sambrook, J., Russell, D. W. Isolation of DNA fragments from polyacrylamide gels by the crush and soak method. CSH Protoc. (1), (2006).
  12. Gibson, D. G. Enzymatic assembly of overlapping DNA fragments. Methods Enzymol. 498, 349-361 (2011).
  13. Elsaesser, R., Paysan, J. Liquid gel amplification of complex plasmid libraries. Biotechniques. 37, (2), 200-202 (2004).
Un protocolo Universal para la gRNA a gran escala de producción de la biblioteca de cualquier fuente de ADN
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Köferle, A., Stricker, S. H. A Universal Protocol for Large-scale gRNA Library Production from any DNA Source. J. Vis. Exp. (130), e56264, doi:10.3791/56264 (2017).More

Köferle, A., Stricker, S. H. A Universal Protocol for Large-scale gRNA Library Production from any DNA Source. J. Vis. Exp. (130), e56264, doi:10.3791/56264 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter