Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Cancer Research

Generation af prostatakræft Cell modeller af resistens over for anti-mitotiske Agent Docetaxel

doi: 10.3791/56327 Published: September 8, 2017

Summary

Resistens over for kræft behandlinger bidrager til sygdomsprogression og død. Bestemmelse af de mekanistiske fundament for modstand er afgørende for at forbedre terapeutisk respons. Dette manuskript detaljer protokol til at generere taxane-resistente cell modeller af prostatacancer (PC) til at dissekere veje, der er involveret i progression til Docetaxel modstand i PC patienter.

Abstract

Mikrotubulus målretning agenter (MTA'er) er en grundpille i behandlingen af en bred vifte af tumorer. Erhvervet modstand mod kemoterapeutiske stoffer er imidlertid en fælles ordning for sygdomsprogression og en prognostiske faktor funktion af maligne tumorer. Prostatacancer (PC) dikterer modstand mod MTA'er såsom taxane Docetaxel behandling fiasko samt progression mod dødbringende stadier af sygdommen, der er defineret af en dårlig prognose og høj dødelighed. Selvom studerede i årtier, vifte af mekanismer bidrager til erhvervet modstand er ikke helt forstået, og dermed udgøre en væsentlig begrænsning for udviklingen af nye terapeutiske strategier, der kunne gavne patienter i disse avancerede stadier af sygdom. I denne protokol, vi beskrive generation af Docetaxel-resistente prostata cancer cellelinjer, der efterligner dødbringende funktioner af sene prostatakræft, og derfor kan bruges til at studere mekanismerne af hvilke erhvervede chemoresistance opstår. På trods af potentielle begrænsninger iboende til celle-baserede model, tab af resistens egenskaber over tid, de Docetaxel-resistente cellelinjer produceret ved denne metode held har været anvendt i de seneste undersøgelser og tilbyder mulighed for at fremme vores Molekylær forståelse af erhvervet chemoresistance i dødbringende prostatakræft.

Introduction

En øget hyppighed af spredning forårsaget af tabet af cellecyklus kontrol er kendetegnende for kræft1. Denne funktionelle egenskab gør kræftceller entydigt afhængig af troskab af cellecykluss centrale processer under S - og M-faser, hvilket har ført til udviklingen af forskellige cellecyklus forstyrrende stoffer, der inducerer DNA-skader eller mitotiske defekter. Selvom mange anti-mitotiske agenter, som hæmmere af mitotiske kinaser eller motor proteiner, er i øjeblikket ved at blive udviklet og testet i kliniske forsøg, fortsat ældre mikrotubulus målretning agenter (MTA'er) at være den eneste klinisk godkendt tilgang til målretning mitosen i kræft2,3,4. MTA'er enten destabilisere (Vinblastine, Vincristin, vinorelbin) eller stabilisere (taxane-afledte agenter midlertidigt Paclitaxel eller Docetaxel Cabazitaxel) mikrotubuli og forhindre dermed dannelsen af en velfungerende mitotiske spindel5,6. Disse agenter udløse den spindel forsamling checkpoint7,8, hvilket resulterer i en langvarig mitotiske arrestation og eventuel celledød i kulturperler celler9,10 og mitotiske defekter i tumorer11 ,12 og er derfor nyttig til behandling af en lang række kræftformer, blandt dem prostatakræft13.

Prostatakræft er det hyppigst diagnosticeret kræft og en førende årsag til kræft dødsfald i mænd14. Antimitotic agenser såsom Docetaxel forbedre prostatakræft patientens overlevelse og er en grundpille i behandlingen af denne sygdom15,16,17. Desværre, trods indledende tumor krympning, tumorceller ofte udvikle resistens under behandling. Flere cellulære mekanismer har været impliceret i forårsager udviklingen af chemoresistance, herunder deregulering af apoptotiske og inflammatoriske veje eller aktivering/overekspression af stof efflux pumper som ATP-binding kassetten transportør P-glykoprotein (P-gp/ABCB1), hvor sidstnævnte resulterer i eksport af kemoterapeutiske stoffer ud af cellerne18,19. Modstand mod taxanes har også været forbundet med andre årsager, såsom ændringer i udtrykket af tubulin isotypes eller tubulin mutationer, som forhindrer interaktion mellem lægemidlet og dets mål 20,21. Derudover har modstand været relateret til genom ustabilitet ophobning og tumor heterogenitet22,23. Dog er de mekanismer, der bidrager til taxane modstand ikke helt forstået, hvilket er tydeligt i mangel af terapeutiske strategier, der forhindrer dens udseende. Derfor er der et presserende behov for at generere eksperimentelle modeller, der kan hjælpe i dissektion af disse mekanismer og identificere roman terapeutiske tilgange, der forhindrer udviklingen af resistens over for disse stoffer.

I denne artikel beskriver vi en metode, som giver mulighed for generation af Docetaxel-resistente (DR) prostata cancerceller. Yderligere vil vi beskrive, hvordan du validere modstand status for disse celler ved hjælp af kolonien dannelse assays og kvantitativ RT-PCR. Celler fremstillet ved denne metode har den fordel af recapitulating mange af de molekylære funktioner findes i offentligt tilgængelige menneskelige tumor Eksempeldatabaser med den ekstra fordel giver alsidighed for at udføre en lang række eksperimentelle assays over længere tid end tilladt af tumor prøver. Disse kræftmodeller terapi modstand kan udvides til mange uger i vævskultur og blandt andre tilgange, kan være genetisk manipuleret, visualiseret ved mikroskopi metoder og analyseret for genekspression. Derudover kan de være xenotrasplanted i mus til yderligere analysere virkningerne i tumor dannelse og vækst in vivo. I øjeblikket er den vigtigste alternative metode til at studere resistens i forbindelse med prostatakræft den direkte analyse af tumor prøver. Mens disse prøver præsenterer en meget potent system for at indsamle oplysninger om genekspression og mutationsmønstre status af en given tumorer, adgang til dem kan være meget begrænset, og de er vanskelige at vedligeholde for yderligere manipulationer og eksperimentel analyse, som kan nemt gøres med cellelinjer genereret med denne protokol24,25. Vigtigere, i fremtiden, metoder alternative som generation af menneskelige afledt organoids direkte fra patienter ville være et meget stærkt værktøj og alternativ til den nuværende metode26,27. Da de vil sammenfatte i en 3D sammenhæng hvad en tumor var i sit oprindelige miljø, vil organoids være den perfekte model mellem cellelinjer og humane tumorer. De eksperimentelle cell modeller er beskrevet i denne protokol er dog stadig mere overkommeligt at vedligeholde og egnet til hurtigere analyse. Resultaterne ved at studere disse cellelinjer kan ekstrapoleres til og bekræftet i humane prøver og 3D kulturer. Denne protokol kan derfor af interesse for forskere søger cell modeller til at studere chemoresistance mekanismer i enhver cellelinje, da vores protokol kan tilpasses til studiet af andre narkotika og kræft typer. Metoderne beskrevet her er let at anvende på et laboratorium, overkommelige og tillade indledende studier af de molekylære og cellulære mekanismer af resistens over for lægemidler.

Protocol

1. bestemmelse af Docetaxel koncentration, der forårsager 50% fald i kolonien dannelse evne (IC50)

NOTE: I denne protokol, Docetaxel IC50 koncentration er blevet evalueret ved hjælp af kolonien dannelse evne. Kan anvendes alternative metoder anvendes til at evaluere cellernes levedygtighed (dvs. MTS assays) baseret på efterforskere ' præferencer.

  1. Vokse DU145 eller 22Rv1-celler i en 75 cm 2 kolbe og forberede nok bestand af 10 mM Docetaxel fortyndet i DMSO skal bruges i fremtidige eksperimenter.
  2. Plade celler for bestemmelsen af IC50 af Docetaxel, fjerne medier fra kolben, omhyggeligt vaske cellerne med 5 mL PBS og inkuberes med 2 mL 0,05% Trypsin-EDTA i 3-5 min ved 37 ° C Adskil celler fra kolben overflade.
  3. Skylles trypsinized celler fra kolben med 5 mL frisk medier og indsamle cellesuspension i en 15 mL tube. Pellet celler ved centrifugering (300 x g, 3 min, stuetemperatur (RT)).
  4. Fjern supernatanten, resuspenderes celle i 5 mL frisk medier og tælle cellerne. Fortyndet cellesuspension til 2-2,5 x 10 5 celler/mL for DU145 og 4-4,5 x 10 5 celler/mL for 22Rv1, bland godt af pipettering op og ned og frø suspension i hvert hul i to 6-godt pladerne sættes 2 mL.
  5. Efter 24 timer, når cellerne er på 70-80% confluence, tilføje dosis-eskalerer Docetaxel koncentrationer af 1 nM, 2,5 nM, 5 nM, 10 nM, 25 nM, 50 nM, 100 nM, 250 nM, 500 nM, og 1000 nM for hver brønd. Behandle kontrol godt med DMSO på den højeste volumen bruges til Docetaxel ( figur 2A).
  6. Efter 72 h, Aspirér lægemiddel indeholdende medier og der tilsættes 2 mL frisk medier. Inden for ca. 4-5 dage, pladerne bliver klar til farvning.
  7. For at plette kolonierne, vaske dem forsigtigt med 2-3 mL PBS og inkuberes dem med 2-3 mL krystalviolet løsning (0,1% w/v i 10% formalin) i 20 min. inde i vævskultur hætte eller et stinkskab.
  8. Fjerne farvning løsning og vask plader med 2-3 mL H 2 O, fjerne H 2 O og lufttørre plader.
  9. Analysere resultaterne ved at visualisere brønde for at bestemme, hvor man har Docetaxel koncentrationen, der reducerer cellernes levedygtighed med 50% (IC50). Manuelt tælle kolonier ved hjælp af en tusch (for at undgå optælling samme kolonierne to gange) og repræsenterer procentdelen af cellernes levedygtighed i en graf ( figur 2A). Endelig tage digitale billeder af plader til figur repræsentation (som vist i figur 3A).

2. Generation af Docetaxel-resistente prostata cancerceller

Bemærk: udføre celle behandlinger ved hjælp af den samme Docetaxel løsning materiel anvendes til bestemmelsen af IC50 drug koncentration (forberede nok bestand på forhånd for eksperimentel Brug). Altid holde en lille kolbe af celler fra det forrige trin, bare i tilfælde af at noget ikke virker godt. Forældrenes celler bør vokset parallelt i en lille kolbe under hele proceduren og udsat for køretøjet (DMSO) i tilsvarende mængder efterligne de beløb, der anvendes i Docetaxel behandlet kolberne.

  1. Plade DU145 eller 22Rv1 celler i 150 cm 2 beholdere indeholdende 20 mL af medier (3,5 x 10 6 celler pr. kolbe til DU145 og 6,5 * 10 6 celler pr. kolbe til 22Rv1). Brug af 10 til 20 flasker af celler anbefales at have nok celler i slutningen af protokollens.
  2. Efter 24 timer, når cellerne er på omkring 70-80% sammenløbet ( figur 2B, før Docetaxel), tilføje Docetaxel i IC50 koncentration bestemmes i trin 1 i protokollen (5 nM for cellerne i denne protokol beskrevne).
  3. Efter 72 h, Aspirér lægemiddel indeholdende medier og tilføje frisk, Docetaxel-gratis medier ( figur 2B, 72 h efter Docetaxel). Ændre medierne hver 3-4 dage. Inden for ca. 1-2 uger, resistente kloner vises tydeligt under mikroskop ( figur 2B, 7 og 14 dage efter Docetaxel).
  4. Opsug medier, omhyggeligt vaske cellerne med 15 mL PBS og inkuberes med 4 mL 0,05% Trypsin-EDTA i 3-5 min ved 37 ° C Adskil celler fra kolben overflade.
  5. Resuspend trypsinized celler fra kolben ved hjælp af 8 mL frisk medier. Pool celler fra alle behandlede kolber. Pellet celler ved centrifugering (300 x g, 3 min, RT).
  6. Fjern supernatanten, resuspenderes celle i 20 mL af friske medier og plade celler i 150 cm 2 flasker (3,5 x 10 6 celler pr. kolbe til DU145 og 6,5 * 10 6 celler pr. kolbe til 22Rv1).
  7. Efter 24 timer, når cellerne er på omkring 70-80% sammenløb, tilføje 5 nM Docetaxel (begyndelseskoncentration IC50) igen.
  8. Gentag trin 2.3 til 2.6 på dag 3.
  9. Efter 24 timer, når cellerne er på omkring 70-80% sammenløb, behandle celler med 2 X IC50 Docetaxel koncentration (10 nM til de celler, der er beskrevet i denne protokol).
  10. Gentag trin 2.3 til 2.8, efter en dosis-eskalering af Docetaxel koncentrationer (25 nM, 50 nM, 100 nM og 250 nM), til at generere en stabil bestand af celler vokser i din kolber under den endelige højeste koncentration. For højere koncentrationer, kan dosis-eskalering protokollen gennemføres i op til 6 måneder indtil 1.000 nM koncentrationen er nået ( figur 1A).

3. Funktionelle karakterisering af erhvervet Docetaxel modstand af kolonien dannelse Assay

NOTE: I denne protokol, chemoresistance er blevet evalueret ved hjælp af kolonien dannelse assays. Kan anvendes alternative metoder anvendes til at evaluere cellernes levedygtighed (dvs. MTS assays) baseret på efterforskere ' præferencer.

  1. Plade 2.000 celler (DU145 eller 22Rv1, både forældre og Docetaxel-resistent) pr. brønd i 6-godt plader, ved hjælp af 2 mL af medier pr. brønd.
  2. Efter 24 h, tilføje stigende koncentrationer af Docetaxel (parental celler: 0,25, 0,5, 1, 2,5 og 5 nM; DR celler: 50, 125, 250, 500 og 1.000 nM). For både DU145 og 22Rv1 cellelinjer. Tilføj DMSO kun til én brønd som en kontrol på den samme diskenhed for den højeste Docetaxel-dosis.
  3. 72 h, Aspirér lægemiddel indeholdende medier og tilføje frisk Docetaxel-gratis medier.
  4. Ruger plader til 1-2 uger indtil kolonier er synlige under mikroskop.
  5. For at plette kolonierne, vaske dem forsigtigt med 2-3 mL PBS og inkuberes dem med 2-3 mL krystalviolet løsning (0,1% w/v i 10% formalin) i 20 min. inde i vævskultur hætte eller et stinkskab.
  6. Fjerne farvning løsning og vask plader med 2-3 mL H 2 O, fjerne H 2 O og lufttørre plader.
  7. Analysere resultatet af visualisere brøndene og manuelt tælle kolonier ved hjælp af en tusch (for at undgå optælling samme kolonierne to gange) og repræsenterer procentdelen af cellernes levedygtighed i en graf. Tage digitale billeder af plader til figur repræsentation ( figur 3A).

4. Fænotypisk karakterisering af Docetaxel modstand erhvervet fænotype via qRT-PCR analyse

Bemærk: Docetaxel-resistente (DR) celler udstille et andet udtryk profil i forhold til deres forældres cellelinjer 28 , 29. derfor succes af udvælgelse kan kontrolleres af qRT-PCR ved hjælp af primere for specifikke markører (for primer sekvenser, henvise til afsnittet materialer; for detaljer, se afsnittet resultater). Dette bør ske efter hver runde af valg starter efter tredje runde. Alternativt, er også mulige vurdering af Docetaxel-resistente fænotype af Western blotting.

  1. Uddrag RNA fra både forældre og Docetaxel-resistente celler bruger et RNA udvinding kit og efter fabrikanten ' s instruktioner (Se Tabel af materialer og reagenser for detaljer). Ved hjælp af et minimum af 1-2 x 10 6 celler anbefales.
  2. Tal RNA på 260 nm absorbans, bruger et spektrofotometer. For bedste renhed, 260 nm/280 nm absorbans nøgletal skal være tæt på 2.0.
  3. PerfoRM reverse transkription at opnå supplerende DNA (cDNA) ved hjælp af reverse transkription kit og efter fabrikanten ' s instruktioner (Se Tabel af materialer og reagenser for detaljer), bruger 1 µg af RNA i en 20 µL Reaktionen mix (hvis en større mængde af cDNA er nødvendig, skala oppe mastermix i overensstemmelse hermed).
  4. Forberede qPCR reaktion i tre eksemplarer til hvert gen af interesse som følger:
    - 2 µL af 10 µM fremad primer
    - 2 µL af 10 µM omvendt primer
    - 10 µL SYBR Green PCR master mix
    - 5 µL H 2 O
    -1 µL af de nypræparerede cDNA fra trin 4.3.
    Bemærk: Se Tabel af materialer for sekvenser af primere, der anvendes i denne protokol.
  5. Sæt PCR program som følger:
    - 95 ° C i 15 min
    - 94 ° C til 30 s |
    -56 ° C i 40 s | 40 gange
    - 72 ° C i 30 s |
  6. Til at analysere qPCR resultater og fastslå ændringer i genekspression mellem forældre og DR prøver, cyklus (Ct) grænseværdierne for hvert gen interesse bestemmes i tre eksemplarer og gennemsnitlige normaliseret til kontrolelementet lastning (aktin tredobbelt gennemsnit ) til DR (Ct DR) og parental celler (Ct forældrekontrol). Værdier for forældrenes cellerne er normaliseret til 1. ΔCt (Ct DR - Ct forældrekontrol) er fast besluttet på at opnå endelige mRNA fold ændringer og repræsenteret i en graf. En stigning på > 2 eller et fald på < 0,5 betragtes som væsentlig og en god validering af oprettelsen af Docetaxel erhvervet resistente fænotype ( figur 3B).

Representative Results

Denne protokol vil føre til generation af Docetaxel-resistente (DR) prostata cancerceller. Tisdlinje for afslutningen kan variere fra 4 til 7 måneder som sammenfattet i en skematisk gengivelse af protokollen trinene i figur 1A og figur 1B. Tid investeringer kunne variere afhængigt af cellelinie af valg og vifte af narkotika koncentrationerne anvendes som beskrevet i protokollen. Vigtigere, giver bestemmelse af Docetaxel IC50 koncentration for hver cellelinje stoffet eskalerende koncentrationsområde design til brug i protokollen for celler af valg (figur 2A). Når protokollen startes, kan første Docetaxel virkninger på DU145 og 22Rv1 celler observeres på forskellige tidspunkter under mikroskop til at overvåge hvis protokollen fungerer korrekt. Foreslåede tidspunkter at overvåge Docetaxel behandlingsprocessen er: før Docetaxel eksponering (baseline), efter Docetaxel eksponering for 72 h, 7 og 14 dage. Bemærk, at kun et mindretal af tumorceller overleve Docetaxel eksponering og generere kloner, som kan overholdes under mikroskop (figur 2B).

Repræsentative koloni dannelse assays og kvantificering grafer af forældrenes og de nyligt genererede Docetaxel-resistente (DR) celler er vist i figur 3A. Bemærk, at de genererede Docetaxel-resistente celler kan overleve drug koncentrationer op til 1.000-fold højere end forældrenes cellerne.

Endelig kan Docetaxel-resistente Fænotypen valideres af qRT-PCR (figur 3B). Bemærk, at Docetaxel-resistente celler, i forhold til de parentale celler, vise karakteristiske op-regulering af ABCB1 og GATA2 og ned-regulering af CK19 og CDH1. Disse gener blev udvalgt til validering, fordi vi har allerede eksperimentelt vist i vores tidligere offentliggjorte arbejde GATA2 Opregulering og downregulation af CK19 sammen med CDH1 i både DR cell modeller28,29. ABCB1 gen blev også valgt som en korte-genet, der er udvist af andre til at være konsekvent upregulated i resistente celler18,19. Det er dog vigtigt at bemærke, at andre gener kan vælges efter litteratur og afhængigt af cell modellerne og de lægemidler, der er valgt til at generere resistente celler af forskeren.

Figure 1
Figur 1: tidslinje for generation af Docetaxel-resistente prostatakræft cell modeller. (A) repræsentative diagram af protokollen tidslinjen for generation af Docetaxel-resistente cell modeller. Illustration skildrer den Docetaxel behandling, validering trappe og tid for hver del. (B) skematisk fremstilling af validering trin i protokollen herunder funktionelle koloni dannelse assays af forældrenes og Docetaxel-resistente celler behandles med de angivne Docetaxel koncentrationer for 72 h (i rødt), repræsentant Graf af kolonien procentdel og qRT-PCR for fænotypisk validering. Venligst klik her for at se en større version af dette tal.

Figure 2
Figur 2: Generation af Docetaxel-resistente prostata kræft celle modelsystemer. (A) Diagram skildrer bestemmelse af Docetaxel IC50 i forældrenes prostata cancer cellelinjer DU145 og 22Rv1 (trin 1 i protokollen). Forventede procenter af cellernes levedygtighed og Docetaxel dosis-eskalerer koncentrationer behov er inkluderet. Repræsentant DU145 og 22Rv1 celle levedygtighed grafer der angiver 5 nM som IC50 efter 72 h af Docetaxel eksponering er inkluderet. Forsøgene er tre og data repræsenterer gennemsnit ± SD. (B) repræsentative lysfelt mikroskopi billeder af DU145 og 22Rv1 celler på angivne tidspunkter under generation af Docetaxel modstand (trin 2 i protokollen). Røde pile indikerer en Docetaxel resistent klon efter protokollen er afsluttet. Skalere barer = 50 nm. Venligst klik her for at se en større version af dette tal.

Figure 3
Figur 3: funktionelle og fænotypiske karakterisering af Docetaxel-resistente cell modeller. (A) repræsentative koloni dannelse assays af forældrenes og Docetaxel-resistente celler behandles med de angivne Docetaxel koncentrationer for 72 h. procentdel af kolonier for hver behandling koncentration er repræsenteret i den medfølgende graf. Forsøgene er tre og data repræsenterer den gennemsnit ± SD. skala barer = 5 mm. (B) DR/forældrenes relative mRNA fold stigning kvantificeres ved qRT-PCR for ABCB1, GATA2, CK19 og CDH1 er vist. Alle qPCR rådata er normaliseret til aktin (Se protokol for detaljer). Forsøgene er tre og data repræsenterer den gennemsnit ± SD. * p < 0,05. Venligst klik her for at se en større version af dette tal.

Discussion

I dette manuskript beskriver vi en metode til at generere Docetaxel-resistente prostata kræft celle modelsystemer, der giver mulighed for undersøgelse af mekanismer bidrager til erhvervelse af chemoresistance Fænotypen. Mens denne tilgang er meget pålidelig og reproducerbar, bør nogle potentielle begrænsninger overvejes. Da kun en lille brøkdel af befolkningens hovedparten af celler vil udstille chemoresistance28, anbefales det at starte med en stor population af celler (vi normalt plade 20 kolber af 150 cm2, som tegner sig for ca. 1,2 x 108 celler). Vigtige trin i protokollen bør overvejes at sikre succes i proceduren. Først, er det meget vigtigt at bruge den samme Docetaxel frisklavet lager for lang tids brug (10 mM stock delprøver kan bruges til år når gemmes korrekt i på-80 ° C). Små ændringer i den aliquot Docetaxel kan påvirke resultaterne af IC50, generation af celle linje timing og koloni dannelse resultater. For det andet er det afgørende at starte den protokol, der fastlægger IC50 i hver enkelt cellelinje, da varianter kan forekomme ved brug af et nyt parti af celler. For det tredje er det vigtigt at overvåge, at medicinsk behandling er effektiv ved at kontrollere celler under mikroskopet ofte, så eventuelle fejl kan opdages hurtigt og korrigeres. Endelig anbefaler vi altid at holde en bestand af mellemliggende trin i tilfælde af kontaminering eller uventede problemer, der kan påvirke levedygtigheden af cellerne i protokollen. Vigtigere, vores protokollen har til formål at generere modeller af resistens ved at udsætte prostata cancerceller for høje doser af Docetaxel for 72 h efterfulgt af lange hvileperioder, snarere end lavere konstant koncentrationer af stoffet i et forsøg på at efterligne bedste kliniske scenario rapporteret for prostatakræft behandling med denne taxane agent15,16.

Derudover skal det bemærkes, at resistente celler udviser en høj plasticitet, hvilket kan føre til en fremadskridende tab af erhvervede egenskaber over tid. Derfor, udvidelse af brugen af disse celler i mere end 2-3 måneder i kultur er ikke anbefalet. Hvis en permanent forsyning er nødvendigt er det tilrådeligt at løbende generere nye partier af resistente celler. Men hvis partier af celler har været kulturperler i længere tid, koloni dannelse assays og qPCR kan bruges til at revurdere deres modstand. Et andet alternativ er at øge aftagende modstand ved behandling af celler med en høj dosis af Docetaxel i 72 timer (500-1.000 nM). Efter et opsving periode på en til to uger, kan fænotype igen testet af qPCR og koloni dannelse assays. Det er også muligt, selvom det ikke anbefales at gemme delprøver af behandlede celler i flydende kvælstof (i FBS, 10% DMSO). Bemærk, at efter et fryse-tø cyklus, chemoresistance fænotype bør altid revurderes med de ovennævnte metoder.

Trods disse forbehold, vi28,29 og andre30,31,32,33 var i stand til med succes anvender disse modelsystemer at identificere centrale roman cellulære og molekylære mekanismer fører til forhøjet tumor-indlede kapacitet, celle overlevelse og aggressivitet i Docetaxel-resistente celler. Bruge systemerne kræft celle model, opdagede vi, at celler udstiller en udifferentieret fænotype, karakteriseret ved fravær af epitel og prostata-relaterede differentiering markører og overekspression af markedssegment udviklingsmæssige (hak og Pindsvin) signaling veje, overleve kemoterapeutiske eksponering28. I en anden undersøgelse, afsløret ved hjælp af disse modeller sammen med offentligt tilgængelige patient gen datasæt24,25, vi at pioner transskription faktor GATA2 er meget overexpressed i metastatisk kastration-resistente kemoterapi-resistente prostata cancerceller. GATA2 øger overlevelsen af celler med direkte aktivering af en IGF2-afhængige downstream kinase signalering netværk29. Især disse undersøgelser hjalp med at identificere roman nøgleroller i GATA2 i fremskreden metastatisk prostatacancer aggressivitet34.

Udvikling af resistens er et problem, der ikke er begrænset til Docetaxel og prostata kræft, da det er udbredt blandt mange andre typer af kræft behandlet med en bred vifte af kemoterapeutiske stoffer. Faktisk gælder lignende begrænsninger på tilgængeligheden af eksperimentelle modeller, og det er tænkeligt, at vores protokol kan tilpasses til at studere andre kræft typer og deres respektive chemoresistance mekanismer.

Generation af Docetaxel-resistente celler som beskrevet i denne protokol kan bruges som et funktionelt redskab til at identificere nye relevante molekylære og cellulære mekanismer af chemoresistance. Dette åbner døren til at finde nye mål, hvorpå udviklingen af nye behandlinger for stærkt malign prostatakræft kan formulere, skubber igen grænser for hvad vi ved om denne sygdom, og hvordan vi behandler sine patienter.

Disclosures

Forfatterne erklærer, at de har ingen konkurrerende finansielle interesser.

Acknowledgments

VR-B. modtager støtte fra USA 's Department of Health & menneskelige tjenester, NIH, National Cancer Institute giver nummer 1 K22 CA207458-01 og J.D.-D. modtager støtte fra USA 's Department of Health & menneskelige tjenester, NIH, National Cancer Institute giver nummer 1 R01 CA207311-01.

Materials

Name Company Catalog Number Comments
DU145 cells ATCC HTB-81
22Rv1 cells ATCC CRL-2505
Docetaxel Selleck Chemicals S1148 in DMSO (10mM)
Tissue culture flask 150cm2 Falcon 355001
6-well tissue culture plates Falcon 353046
RPMI 1640 Medium Gibco 11875093 Supplemented with 10% FBS and 1% Penicilin/Streptomycin
Foundation B Fetal Bovine Serum Gemini 900208
1X Phosphate-Buffered Saline (PBS) Corning 21-040-CM
0.05%Trypsin-EDTA Gibco 25300-062
Penicillin-Streptomycin Gibco 15140122
RNeasy Mini Kit Qiagen 74106
SuperScript III first strand synthesis system for RT-PCR Invitrogen 18080051
Power SYBR Green PCR Master Mix Invitrogen 4367659
Crystal Violet Sigma-Aldrich C0775
10% Formalin Solution Sigma-Aldrich HT501128
Primers for qRT-PCR: Life technologies
CK19 F: CTGCGGGACAAGATTCTTGGT
CK19 R: CCAGACGGGCATTGTCGAT
CDH1 F: GGAAGTCAGTTCAGACTCCAGCC
CDH1 R: AGGCCTTTTGACTGTAATCACACC
ABCB1 F: TGTTCAAACTTCTGCTCCTGA
ABCB1 R: CCCATCATTGCAATAGCAGG
GATA2 F: CATCAAGCCCAAGCGAAGA
GATA2 R: TTTGACAGCTCCTCGAAGCA
ACTIN F: CATGTACGTTGCTATCCAGGC
ACTIN R: CTCCTTAATGTCACGCACGAT

DOWNLOAD MATERIALS LIST

References

  1. Hanahan, D., Weinberg, R. A. Hallmarks of cancer: the next generation. Cell. 144, (5), 646-674 (2011).
  2. Lapenna, S., Giordano, A. Cell cycle kinases as therapeutic targets for cancer. Nature reviews. Drug discovery. 8, (7), 547-566 (2009).
  3. Jackson, J. R., Patrick, D. R., Dar, M. M., Huang, P. S. Targeted anti-mitotic therapies: can we improve on tubulin agents? Nature reviews. Cancer. 7, (2), 107-117 (2007).
  4. Dumontet, C., Jordan, M. A. Microtubule-binding agents: a dynamic field of cancer therapeutics. Nature reviews. Drug discovery. 9, (10), 790-803 (2010).
  5. Schiff, P. B., Fant, J., Horwitz, S. B. Promotion of microtubule assembly in vitro by taxol. Nature. 277, (5698), 665-667 (1979).
  6. Schiff, P. B., Horwitz, S. B. Taxol stabilizes microtubules in mouse fibroblast cells. Proceedings of the National Academy of Sciences of the United States of America. 77, (3), 1561-1565 (1980).
  7. Musacchio, A., Salmon, E. D. The spindle-assembly checkpoint in space and time. Nature reviews. Molecular cell biology. 8, (5), 379-393 (2007).
  8. Kops, G. J. P. L., Weaver, B. A. A., Cleveland, D. W. On the road to cancer: aneuploidy and the mitotic checkpoint. Nature reviews. Cancer. 5, (10), 773-785 (2005).
  9. Derry, W. B., Wilson, L., Jordan, M. A. Substoichiometric binding of taxol suppresses microtubule dynamics. Biochemistry. 34, (7), 2203-2211 (1995).
  10. Jordan, M. A., Wendell, K., Gardiner, S., Derry, W. B., Copp, H., Wilson, L. Mitotic block induced in HeLa cells by low concentrations of paclitaxel (Taxol) results in abnormal mitotic exit and apoptotic cell death. Cancer research. 56, (4), 816-825 (1996).
  11. Orth, J. D., Kohler, R. H., Foijer, F., Sorger, P. K., Weissleder, R., Mitchison, T. J. Analysis of mitosis and antimitotic drug responses in tumors by in vivo microscopy and single-cell pharmacodynamics. Cancer research. 71, (13), 4608-4616 (2011).
  12. Zasadil, L. M., et al. Cytotoxicity of paclitaxel in breast cancer is due to chromosome missegregation on multipolar spindles. Science translational medicine. 6, (229), (2014).
  13. Dominguez-Brauer, C., Thu, K. L., Mason, J. M., Blaser, H., Bray, M. R., Mak, T. W. Targeting Mitosis in Cancer: Emerging Strategies. Molecular cell. 60, (4), 524-536 (2015).
  14. Torre, L. A., Bray, F., Siegel, R. L., Ferlay, J., Lortet-Tieulent, J., Jemal, A. Global cancer statistics, 2012. CA: a cancer journal for clinicians. 65, (2), 87-108 (2015).
  15. Petrylak, D. P., et al. Docetaxel and estramustine compared with mitoxantrone and prednisone for advanced refractory prostate cancer. The New England journal of medicine. 351, (15), 1513-1520 (2004).
  16. Tannock, I. F., et al. Docetaxel plus prednisone or mitoxantrone plus prednisone for advanced prostate cancer. The New England journal of medicine. 351, (15), 1502-1512 (2004).
  17. Sweeney, C. J., et al. Chemohormonal Therapy in Metastatic Hormone-Sensitive Prostate Cancer. The New England journal of medicine. 373, (8), 737-746 (2015).
  18. Mahon, K. L., Henshall, S. M., Sutherland, R. L., Horvath, L. G. Pathways of chemotherapy resistance in castration-resistant prostate cancer. Endocrine-related cancer. 18, (4), R103-R123 (2011).
  19. Follit, C. A., Brewer, F. K., Wise, J. G., Vogel, P. D. In silico identified targeted inhibitors of P-glycoprotein overcome multidrug resistance in human cancer cells in culture. Pharmacology research & perspectives. 3, (5), e00170 (2015).
  20. Ranganathan, S., Benetatos, C. A., Colarusso, P. J., Dexter, D. W., Hudes, G. R. Altered beta-tubulin isotype expression in paclitaxel-resistant human prostate carcinoma cells. British journal of cancer. 77, (4), 562-566 (1998).
  21. Martello, L. A., et al. Elevated levels of microtubule destabilizing factors in a Taxol-resistant/dependent A549 cell line with an alpha-tubulin mutation. Cancer research. 63, (6), 1207-1213 (2003).
  22. Lee, A. J. X., et al. Chromosomal instability confers intrinsic multidrug resistance. Cancer research. 71, (5), 1858-1870 (2011).
  23. Sansregret, L., Swanton, C. The Role of Aneuploidy in Cancer Evolution. Cold Spring Harbor perspectives in medicine. 7, (1), (2017).
  24. Grasso, C. S., et al. The mutational landscape of lethal castration-resistant prostate cancer. Nature. 487, (7406), 239-243 (2012).
  25. Taylor, B. S., et al. Integrative genomic profiling of human prostate cancer. Cancer cell. 18, (1), 11-22 (2010).
  26. Gao, D., et al. Organoid cultures derived from patients with advanced prostate cancer. Cell. 159, (1), 176-187 (2014).
  27. Drost, J., et al. Organoid culture systems for prostate epithelial and cancer tissue. Nature Protocols. 11, (2), 347-358 (2016).
  28. Domingo-Domenech, J., et al. Suppression of acquired docetaxel resistance in prostate cancer through depletion of notch- and hedgehog-dependent tumor-initiating cells. Cancer cell. 22, (3), 373-388 (2012).
  29. Vidal, S. J., et al. A targetable GATA2-IGF2 axis confers aggressiveness in lethal prostate cancer. Cancer cell. 27, (2), 223-239 (2015).
  30. Marín-Aguilera, M., et al. Identification of docetaxel resistance genes in castration-resistant prostate cancer. Molecular cancer therapeutics. 11, (2), 329-339 (2012).
  31. Zhao, L., et al. Identification of candidate biomarkers of therapeutic response to docetaxel by proteomic profiling. Cancer research. 69, (19), 7696-7703 (2009).
  32. Lin, H. -M., et al. Circulating microRNAs are associated with docetaxel chemotherapy outcome in castration-resistant prostate cancer. British journal of cancer. 110, (10), 2462-2471 (2014).
  33. Puhr, M., et al. Epithelial-to-mesenchymal transition leads to docetaxel resistance in prostate cancer and is mediated by reduced expression of miR-200c and miR-205. The American journal of pathology. 181, (6), 2188-2201 (2012).
  34. Rodriguez-Bravo, V., Carceles-Cordon, M., Hoshida, Y., Cordon-Cardo, C., Galsky, M. D., Domingo-Domenech, J. The role of GATA2 in lethal prostate cancer aggressiveness. Nature reviews. Urology. 14, (1), 38-48 (2017).
Generation af prostatakræft Cell modeller af resistens over for anti-mitotiske Agent Docetaxel
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Mohr, L., Carceles-Cordon, M., Woo, J., Cordon-Cardo, C., Domingo-Domenech, J., Rodriguez-Bravo, V. Generation of Prostate Cancer Cell Models of Resistance to the Anti-mitotic Agent Docetaxel. J. Vis. Exp. (127), e56327, doi:10.3791/56327 (2017).More

Mohr, L., Carceles-Cordon, M., Woo, J., Cordon-Cardo, C., Domingo-Domenech, J., Rodriguez-Bravo, V. Generation of Prostate Cancer Cell Models of Resistance to the Anti-mitotic Agent Docetaxel. J. Vis. Exp. (127), e56327, doi:10.3791/56327 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter