Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Cancer Research

Generatie van prostaatkanker modellen van de cel van de weerstand tegen de anti-mitotische Agent Docetaxel

doi: 10.3791/56327 Published: September 8, 2017

Summary

Weerstand tegen kankertherapieën draagt bij aan de progressie van de ziekte en dood. Het bepalen van de mechanistische onderbouwing van resistentie is cruciaal voor de verbetering van de therapeutische respons. Dit manuscript details het protocol voor het genereren van taxane-resistente cel modellen van prostaatkanker (PC) om te helpen met het ontleden van de trajecten betrokken bij progressie naar Docetaxel resistentie bij patiënten van de PC.

Abstract

Microtubulus targeting agenten (MTAs) zijn een steunpilaar in de behandeling van een breed scala aan tumoren. Verworven resistentie tegen chemotherapeutische geneesmiddelen is echter een gemeenschappelijk mechanisme van progressie van de ziekte en de functie van een prognostic-determinant van kwaadaardige tumoren. In prostaatkanker (PC) dicteert weerstand tegen MTA's zoals de taxane Docetaxel falen van de behandeling, alsmede progressie naar dodelijke stadia van de ziekte die worden gedefinieerd door een slechte prognose en de hoge sterftecijfers. Hoewel studeerde voor decennia, de matrix van mechanismen bij te dragen aan verworven resistentie zijn niet helemaal begrepen, en vormen dus een belangrijke beperking aan de ontwikkeling van nieuwe therapeutische strategieën die patiënten in deze geavanceerde stadia van kunnen profiteren ziekte. In dit protocol, beschrijven we de generatie van Docetaxel-resistente prostaatkanker cellijnen die dodelijke kenmerken van laat-stadium prostaatkanker nabootsen, en daarom kan worden gebruikt om de mechanismen bestuderen door welke verworven chemoresistance ontstaat. Ondanks mogelijke beperkingen inherent is aan een cel gebaseerd model, zoals het verlies van weerstand bezit na verloop van tijd de Docetaxel-resistente cellijnen geproduceerd door deze methode met succes hebben ingezet in recente studies en de mogelijkheid bieden om verder onze moleculaire begrip van verworven chemoresistance in dodelijke prostaatkanker.

Introduction

Een verhoogd tarief van proliferatie veroorzaakt door het verlies van controle van de celcyclus is een kenmerk van kanker1. Deze functionele eigenschap maakt kankercellen uniek afhankelijk van de trouw van de celcyclus belangrijke processen tijdens S - en M-fasen, die heeft geleid tot de ontwikkeling van verschillende celcyclus storing veroorzaakt drugs die DNA-beschadiging of mitotische defecten veroorzaken. Hoewel vele anti-mitotische agenten, zoals remmers van de mitotische kinases of motor eiwitten, zijn momenteel ontwikkeld en getest in klinische proeven, blijven oudere microtubulus targeting agenten (MTAs) de enige klinisch goedgekeurde aanpak voor gericht op de mitose in kanker2,3,4. MTA's ofwel destabiliseren (Vinblastine, Vincristine, Vinorelbine) of (taxane afkomstige agenten Paclitaxel, Docetaxel of Cabazitaxel) microtubuli stabiliseren en daarmee de vorming van een functionerende mitotische spindel5,6te voorkomen. Deze agenten activeren de spindel vergadering checkpoint7,8, wat in een langdurige mitotische arrestatie en de uiteindelijke celdood in gekweekte cellen9,10 en mitotische gebreken in tumoren11 resulteert ,12 en zijn daarom nuttig voor de behandeling van een groot aantal vormen van kanker, onder hen prostaatkanker13.

Prostaatkanker is de meest voorkomende diagnose kanker en een belangrijke oorzaak van kanker gerelateerde sterfgevallen in mannen14. Antimitotische agenten zoals Docetaxel verbeteren van prostaatkanker patiënt overleving en zijn een steunpilaar in de behandeling van deze ziekte15,16,17. Helaas, ondanks de krimp van de oorspronkelijke tumor, tumorcellen ontwikkelen vaak resistentie tijdens de behandeling. Verschillende cellulaire mechanismen zijn betrokken bij het ontstaan van de ontwikkeling van chemoresistance, met inbegrip van deregulering van apoptotic en inflammatoire trajecten of activering/overexpressie van efflux geneesmiddelenpompen zoals de ATP-binding cassette vervoerder P-glycoproteïne (P-gp/ABCB1), de laatste bij de uitvoer van chemotherapeutische agenten uit de cellen18,19 resultaten. Weerstand tegen taxine heeft ook in verband gebracht met andere oorzaken, zoals veranderingen in de expressie van tubuline isotypes of tubuline mutaties, waardoor interactie tussen het geneesmiddel en haar doel 20,21. Bovendien heeft weerstand is gerelateerd aan genoom instabiliteit accumulatie en22,23van de heterogeniteit van de tumor. Echter worden de mechanismen bij te dragen tot taxane weerstand niet volledig begrepen, die is duidelijk door het ontbreken van therapeutische strategieën die zijn verschijning voorkomen. Daarom is er een dringende noodzaak voor het genereren van experimentele modellen die helpen in de dissectie van deze mechanismen en te identificeren van nieuwe therapeutische benaderingen die voorkomen de ontwikkeling van resistentie tegen deze geneesmiddelen dat.

In dit artikel beschrijven we een methode waarmee de generatie van Docetaxel-resistente (DR) prostaatkanker cellen. We zullen verder beschrijven het valideren van de status van de weerstand van deze cellen met behulp van de kolonie vorming testen en kwantitatieve RT-PCR. Cellen geproduceerd door deze methode hebben het voordeel van veel van de moleculaire eigenschappen gevonden in openbaar beschikbare menselijke tumor voorbeelddatabases met het extra voordeel van het verstrekken van de veelzijdigheid voor het uitvoeren van een grote verscheidenheid van experimentele tests Recapitulerend langere perioden dan toegestaan door de tumor monsters. Deze kanker modellen van therapie resistentie kunnen worden uitgebreid voor vele weken in de weefselkweek en onder andere benaderingen, kan worden genetisch gemanipuleerd, gevisualiseerd door Microscopie methodes en geanalyseerd voor genexpressie. Bovendien kunnen zij xenotrasplanted in muizen voor verdere analyse van de effecten in de vorming en groei van de tumor in vivo. Op dit moment is het belangrijkste alternatieve methode om te studeren van resistentie in het kader van prostaatkanker de directe analyse van monsters van de tumor. Terwijl deze monsters een zeer krachtig systeem dienen voor het verzamelen van informatie over de expressie van genen en vogelgriepvirus status van de bepaalde tumoren, toegang tot hen zeer beperkt kan worden en ze zijn moeilijk te handhaven voor verdere manipulaties en experimentele analyse, die kan gemakkelijk worden gedaan met de cellijnen gegenereerd met dit protocol24,25. Nog belangrijker is, in de toekomst benaderingen alternatieve zoals de generatie van menselijke afgeleide organoids rechtstreeks vanuit patiënten zou een zeer krachtig hulpmiddel en een alternatief voor de huidige methode26,27. Aangezien zij in een 3D-kader wat een tumor in haar oorspronkelijke omgeving herhalen zal was, zullen organoids het perfecte model tussen cellijnen en menselijke tumoren. Toch zijn de modellen van de experimentele cel beschreven in dit protocol nog meer betaalbaar te houden en geschikt voor snellere analyse. De resultaten verkregen door het bestuderen van deze cellijnen kunnen worden geëxtrapoleerd naar en bevestigd in menselijke specimens en 3D culturen. Dit protocol kan dus van belang voor onderzoekers op zoek naar cel modellen om te studeren van chemoresistance mechanismen op een willekeurige cellijn, aangezien ons protocol aangepast aan de studie van andere drugs en de soorten kanker worden kan. De hier beschreven methoden zijn eenvoudig toe te passen in een laboratorium, betaalbare en toestaan van voorbereidende studies van de moleculaire en cellulaire mechanismen van resistentie.

Protocol

1. bepaling van de concentratie van de Docetaxel veroorzaakt 50% afname vermogen (IC50) om de vorming van de kolonie

Opmerking: In dit protocol, Docetaxel IC50 concentratie is geëvalueerd met behulp van de kolonie vorming vermogen. Alternatieve methoden voor het beoordelen van de levensvatbaarheid van de cellen (dat wil zeggen, MTS testen) kunnen worden gebruikt op basis van onderzoekers ' voorkeuren.

  1. DU145 groeien of 22Rv1 cellen in een maatkolf van 75 cm 2 en bereiden genoeg voorraad van 10 mM Docetaxel verdund in DMSO moet worden gebruikt in toekomstige experimenten.
  2. Plaat cellen voor de bepaling van IC50 voor Docetaxel media verwijderen uit de kolf, cellen met 5 mL PBS grondig te wassen, en broeden met 2 mL 0,05% trypsine-EDTA gedurende 3-5 minuten bij 37 ° C cellen van het oppervlak van de kolf loskoppelen.
  3. Trypsinized cellen spoelen uit de kolf met 5 mL verse media en het verzamelen van de celsuspensie in een tube van 15 mL. Pellet cellen door middel van centrifugeren (3 min, kamertemperatuur (RT), 300 x g).
  4. Verwijder het supernatant en resuspendeer de pellet cel in 5 mL verse media cellen tellen. Verdun de celsuspensie 2-2.5 x 10 5 cellen/mL voor DU145 en 4-4,5 x 10 5 cellen/mL voor 22Rv1 en meng goed door omhoog en omlaag pipetteren zaad van 2 mL van de suspensie in elk putje van twee 6-Wells-platen.
  5. Na 24 h, wanneer de cellen bij 70-80% samenvloeiing, toevoegen dosis-escalatie Docetaxel concentraties van 1 nM 2,5 nM 5 nM, 10 nM, 25 nM, 50 nM, 100 nM, 250 nM, 500 nM, en 1000 nM aan elk putje. Het besturingselement goed met DMSO behandelen met het hoogste volume gebruikt voor Docetaxel ( figuur 2A).
  6. Na 72 h, gecombineerd met media drug en voeg toe 2 mL verse media. Binnen ongeveer 4-5 dagen, de platen klaar zal zijn voor kleuring.
  7. Om de vlek de koloniën, was ze zachtjes met 2-3 mL PBS en broeden ze met 2-3 mL Kristalvioletoplossing (0,1% w/v in 10% formaline) gedurende 20 minuten in de weefselkweek kap of een zuurkast.
  8. Verwijderen van kleuring oplossing en wassen platen met 2-3 mL H 2 O, verwijderen van H 2 O en luchtdroog platen.
  9. Analyseren de resultaten met het visualiseren van de putten om na te gaan welke de Docetaxel concentratie die de levensvatbaarheid van de cellen met 50% (IC50 daalt). Handmatig tellen kolonies met de hulp van een viltstift (om te voorkomen dat tweemaal de dezelfde kolonies tellen) en vertegenwoordigen het percentage van de levensvatbaarheid van de cellen in een grafiek ( figuur 2A). Tot slot, het nemen van digitale beelden van de platen voor figuur vertegenwoordiging (zoals weergegeven in figuur 3A).

2. Generatie van Docetaxel-resistente prostaat kankercellen

Opmerking: uitvoeren van cel behandelingen met behulp van de dezelfde Docetaxel oplossing voorraad gebruikt voor de bepaling van IC50 drug concentratie (bereiden genoeg voorraad bij voorbaat voor experimentele gebruik). Houd altijd een kleine kolf met cellen uit de vorige stap, voor het geval er iets niet goed werkt. Ouderlijke cellen moeten worden gekweekt in parallel in een kleine kolf gedurende de hele procedure en blootgesteld aan voertuig (DMSO) in overeenkomstige hoeveelheden nabootsen van de bedragen die zijn gebruikt in de kolven Docetaxel behandeld.

  1. Plaat DU145 of 22Rv1 cellen in 150 cm 2 flacons met 20 mL media (3,5 x 10 6 cellen per kolf voor DU145 en 6.5 * 10 6 cellen per kolf voor 22Rv1). Gebruik van 10 tot 20 maatkolven van cellen wordt aanbevolen om voldoende cellen aan het einde van het protocol.
  2. Na 24 h, wanneer cellen op ongeveer 70-80% confluence ( figuur 2B, vóór Docetaxel), Docetaxel op de concentratie van de IC50 bepaald in stap 1 van het protocol toevoegen (5 nM voor de cellen in dit protocol omschreven).
  3. Na 72 h, gecombineerd met media drug en toevoegen van verse, Docetaxel-vrije media ( figuur 2B, 72 h na Docetaxel). De media elke 3-4 dagen wijzigen. Binnen ongeveer 1-2 weken, resistente klonen verschijnt duidelijk onder de Microscoop ( figuur 2B, 7 en 14 dagen na Docetaxel).
  4. Media gecombineerd, cellen met 15 mL PBS grondig te wassen en incubeer met 4 mL 0,05% trypsine-EDTA gedurende 3-5 minuten bij 37 ° C cellen van het oppervlak van de kolf loskoppelen.
  5. Resuspendeer trypsinized cellen uit de erlenmeyer 8 mL verse media gebruiken. Zwembad cellen uit alle behandelde kolven. Pellet cellen door middel van centrifugeren (300 x g, 3 min, RT).
  6. Verwijder het supernatant en resuspendeer de pellet cel in 20 mL verse media plaat van de cellen in 150 cm 2 flacons (3,5 x 10 6 cellen per kolf voor DU145 en 6.5 * 10 6 cellen per kolf voor 22Rv1).
  7. Na 24 h, wanneer cellen op ongeveer 70-80% samenvloeiing, voeg 5 nM Docetaxel (beginconcentratie van de IC50) opnieuw.
  8. Herhaal stap 2.3 tot en met 2.6 op dag 3.
  9. Na 24 h, wanneer cellen op ongeveer 70-80% samenvloeiing, traktatie cellen met 2 X IC50 Docetaxel concentratie (10 nM voor de cellen in dit protocol omschreven).
  10. Herhaal stappen 2.3 tot en met 2.8, na een dosis-escalatie van Docetaxel concentraties (25 nM, 50 nM, 100 nM en 250 nM), voor het genereren van een stabiele bevolking van cellen groeien in uw kolven onder de uiteindelijke hoogste concentratie. Voor hogere concentraties, kan de dosis-escalatie-protocol worden uitgevoerd voor maximaal 6 maanden totdat de 1.000 nM concentratie is bereikt ( figuur 1A).

3. Functionele karakterisering van verworven Docetaxel weerstand door kolonie vorming Assay

Opmerking: In dit protocol, chemoresistance heeft geëvalueerd met behulp van de kolonie vorming testen. Alternatieve methoden voor het beoordelen van de levensvatbaarheid van de cellen (dat wil zeggen, MTS testen) kunnen worden gebruikt op basis van onderzoekers ' voorkeuren.

  1. Plaat 2.000 cellen (DU145 of 22Rv1, ouderschaps- en Docetaxel-resistente) per putje in 6-Wells-platen, met behulp van media 2 mL per putje.
  2. Na 24 h, toenemende concentraties van Docetaxel toevoegen (ouderlijke cellen: 0,25 0,5, 1, 2.5 en 5 nM; DR cellen: 50, 125, 250, 500 en 1000 nM). Voor zowel DU145 als 22Rv1 cellijnen. DMSO alleen toevoegen aan een goed als een besturingselement op hetzelfde volume gebruikt voor de hoogste dosis Docetaxel.
  3. Na 72 uur, gecombineerd met media drug en toevoegen van verse Docetaxel-vrije media.
  4. Platen Incubeer gedurende 1-2 weken totdat kolonies zichtbaar onder de Microscoop zijn.
  5. Om de vlek de koloniën, was ze zachtjes met 2-3 mL PBS en broeden ze met 2-3 mL Kristalvioletoplossing (0,1% w/v in 10% formaline) gedurende 20 minuten in de weefselkweek kap of een zuurkast.
  6. Verwijderen van kleuring oplossing en wassen platen met 2-3 mL H 2 O, verwijderen van H 2 O en luchtdroog platen.
  7. Analyseren resultaat door het visualiseren van de putten en handmatig tellen kolonies met de hulp van een viltstift (om te voorkomen dat tweemaal de dezelfde kolonies tellen) en vertegenwoordigen het percentage van de levensvatbaarheid van de cellen in een grafiek. Nemen van digitale beelden van de platen voor figuur vertegenwoordiging ( figuur 3A).

4. Fenotypische karakterisering van Docetaxel resistentie verworven fenotype via qRT-PCR analyse

Opmerking: Docetaxel-resistente (DR) cellen vertonen een andere expressie profiel in vergelijking met hun ouderlijke cellijnen 28 , 29. Daarom, het succes van de selectie kan worden geverifieerd door qRT-PCR gebruikt inleidingen voor specifieke markers (voor primer sequenties, verwijzen naar de sectie materialen; voor meer informatie, Raadpleeg de sectie resultaten). Dit moet gebeuren na elke ronde van selectie beginnen na de derde ronde. Als alternatief, evaluatie van Docetaxel-resistente fenotype door het westelijke bevlekken is ook mogelijk.

  1. Extract RNA van ouderschaps- en Docetaxel-resistente cellen met behulp van een RNA extractie kit en volgende de fabrikant ' s instructies (Zie de Tabel van materialen en reagentia voor details). Het gebruik van een minimum van 1-2 x 10 6 cellen wordt aanbevolen.
  2. Quantify RNA op 260 nm absorptie, met behulp van een spectrofotometer. Beste zuiverheid, de 260 nm/280 nm absorptie ratio's moeten dicht bij 2.0.
  3. PerfoRM reverse transcriptie te verkrijgen van cDNA (cDNA) met behulp van de omgekeerde transcriptie kit en volgende de fabrikant ' s instructies (Zie de Tabel van materialen en reagentia voor details), met behulp van 1 microgram van RNA in een 20 µL reactie mix (indien een grotere hoeveelheid cDNA is nodig, dienovereenkomstig een schaal-up van de reactie mix).
  4. Voorbereiden op de reactie van de qPCR in drievoud elk gen van belang als volgt:
    - 2 µL van 10 µM voorwaartse primer
    - 2 µL van 10 µM omgekeerde primer
    - 10 µL SYBR Green PCR master mix
    - 5 µL H 2 O
    -1 µL van de onlangs bereid cDNA uit stap 4.3.
    Opmerking: Zie Tabel van materialen voor de reeksen inleidingen gebruikt in dit protocol.
  5. De PCR-programma als volgt instellen:
    - 95 ° C gedurende 15 min
    - 94 ° C gedurende 30 s |
    -56 ° C gedurende 40 s | 40 keer
    - 72 ° C gedurende 30 s |
  6. QPCR resultaten analyseren en bepalen van wijzigingen in genexpressie tussen ouderlijke en DR monsters, de cyclus (Ct) drempelwaarden voor elk gen van belang in drievoud worden bepaald en de gemiddelde genormaliseerd naar het besturingselement laden (actine drievoudige gemiddeld ) voor DR (DR Ct) en ouderlijke cellen (Ct ouderlijke). Waarden voor de ouderlijke cellen zijn genormaliseerd naar 1. ΔCt (Ct DR - Ct ouderlijke) is vastbesloten om de laatste mRNA vouw wijzigingen ophalen en weergegeven in een grafiek. Een stijging van > 2 of een daling van < 0,5 als aanzienlijk worden beschouwd en een goede validatie van de inrichting van de Docetaxel verworven resistente fenotype ( figuur 3B).

Representative Results

Dit protocol zal leiden tot de generatie van Docetaxel-resistente (DR) prostaat kankercellen. De tijdlijn voor voltooiing kan variëren van 4 tot 7 maanden, zoals samengevat in de schematische weergave van de stappen van de protocol in figuur 1A en figuur 1B. De tijdsinvestering kan verschillen naargelang de cellijn van keuze en het bereik van de concentraties van de drug gebruikt zoals beschreven in het protocol. Nog belangrijker is, kan de bepaling van de concentratie van de Docetaxel IC50 voor elke regel van de cel het ontwerp van de escalerende concentratiebereik drug te gebruiken in het protocol voor de cellen van keuze (figuur 2A). Zodra het protocol is gestart, kunnen de eerste Docetaxel effecten op DU145 en 22Rv1 cellen worden waargenomen op verschillende tijdstippen onder de Microscoop om te controleren of het protocol goed werkt. Voorgesteld tijdstippen te controleren van het verwerkingsproces Docetaxel zijn: vóór de Docetaxel blootstelling (basislijn), na Docetaxel blootstelling gedurende 72 uur, 7 dagen en 14 dagen. Merk op dat slechts een minderheid van tumorcellen overleven de Docetaxel blootstelling en genereren van klonen, die kunnen worden waargenomen onder de Microscoop (figuur 2B).

Representatieve kolonie vorming testen en kwantificering grafieken van ouderschapsverlof en de nieuw gegenereerde Docetaxel-resistente (DR) cellen worden weergegeven in figuur 3A. Merk op dat de gegenereerde Docetaxel-resistente cellen drug tot 1,000-fold hogere concentraties dan de ouderlijke cellen kunnen overleven.

Tot slot kan het Docetaxel-resistente fenotype worden gevalideerd door qRT-PCR (figuur 3B). Merk op dat Docetaxel-resistente cellen, in vergelijking met de ouderlijke cellen, karakteristieke up-regulatie van ABCB1 en GATA2 en down-regulatie van CK19 en CDH1 weergegeven. Deze genen werden geselecteerd voor validatie, want we hebben al experimenteel aangetoond in ons eerder gepubliceerde werk GATA2 opregulatie en Downregulatie van CK19 samen met CDH1 in beide DR cel modellen28,29. Het ABCB1-gen werd ook geselecteerd als een nietje gen dat is aangetoond door anderen worden consistent upregulated in resistente cellen18,19. Het is echter belangrijk op te merken dat andere genen mag worden gekozen volgens de literatuur en afhankelijk van de cel-modellen en de drugs voor het genereren van resistente cellen door de onderzoeker gekozen.

Figure 1
Figuur 1: tijdlijn voor de generatie van modellen van de cel Docetaxel-resistente prostaatkanker. (A) representatieve diagram van de tijdlijn protocol voor generatie van Docetaxel-resistente cel modellen. Illustratie toont de Docetaxel behandeling validatiestappen en de tijd die nodig is voor elk deel. (B) Schematische weergave van de validatiestappen van het protocol met inbegrip van functionele kolonie vorming testen van ouderschaps- en Docetaxel-resistente cellen behandeld met de aangegeven Docetaxel concentraties voor 72 h (in rood), vertegenwoordiger grafiek van het percentage van de kolonie en qRT-PCR voor fenotypische validatie. Klik hier voor een grotere versie van dit cijfer.

Figure 2
Figuur 2: generatie Docetaxel-resistente prostaatkanker cel modelsystemen. (A) Diagram waarin u ziet de bepaling van de Docetaxel IC50 in de ouderlijke prostaatkanker cellijnen, DU145 en 22Rv1 (stap 1 van het protocol). Verwachte percentages van de levensvatbaarheid van de cellen en de Docetaxel dosis-escalatie concentraties nodig zijn opgenomen. Vertegenwoordiger DU145 en 22Rv1 cel levensvatbaarheid grafieken die aangeeft 5 nM als de IC50 na 72 h van Docetaxel blootstelling zijn opgenomen. De experimenten worden triplicates en gegevens vertegenwoordigen de gemiddelde ± SD. (B) vertegenwoordiger helder veld microscopie beelden van DU145 en 22Rv1 cellen op aangegeven tijden tijdens de generatie van Docetaxel weerstand (stap 2 van het protocol). Rode pijlen wijzen een resistente Docetaxel kloon nadat het protocol is voltooid. Schaal bars = 50 nm. Klik hier voor een grotere versie van dit cijfer.

Figure 3
Figuur 3: functioneel en fenotypische karakterisering van de Docetaxel-resistente cel modellen. (A) representatieve kolonie vorming testen van ouderschaps- en Docetaxel-resistente cellen die de aangegeven Docetaxel concentraties voor 72 h. Percentage van kolonies behandeld voor elke behandeling concentratie is vertegenwoordigd in de grafiek opgenomen. De experimenten worden triplicates en gegevens vertegenwoordigen de gemiddelde ± SD. schaal bars = 5 mm. (B) DR/ouderlijke relatieve mRNA-voudige toename gekwantificeerd door qRT-PCR van ABCB1, GATA2, CK19 en CDH1 worden weergegeven. Alle ruwe gegevens van de qPCR is genormaliseerd naar actine (zie protocol voor details). De experimenten zijn triplicates en gegevens vertegenwoordigen de gemiddelde ± SD. * p < 0.05. Klik hier voor een grotere versie van dit cijfer.

Discussion

In dit manuscript beschrijven we een methode voor het genereren van Docetaxel-resistente prostaatkanker cel modelsystemen waarmee voor de studie van de mechanismen die bijdragen tot de verwerving van het fenotype van de chemoresistance. Hoewel deze benadering zeer betrouwbaar en reproduceerbaar is, moeten sommige mogelijke beperkingen worden beschouwd. Aangezien slechts een klein deel van de bevolking van de bulk van de cellen chemoresistance28 vertonen zal, wordt aangeraden om te beginnen met een grote bevolking van cellen (we meestal plaat 20 maatkolven van 150 cm2, die goed zijn voor ongeveer 1.2 x 108 cellen). Belangrijkste stappen van het protocol moeten worden overwogen om succes van de procedure te waarborgen. Eerste plaats is het heel belangrijk om het gebruik van de dezelfde Docetaxel vers bereide voorraad voor lange termijn gebruik (10 mM stock aliquots kunnen worden gebruikt voor jaren wanneer adequaat opgeslagen bij-80 ° C). Lichte veranderingen in het aliquoot Docetaxel kunnen invloed hebben op de resultaten van IC50, de generatie van de cel lijn timing en de kolonie vorming resultaten. Ten tweede, is het cruciaal om te beginnen met het protocol bepalen de IC50 in elke afzonderlijke cel regel, aangezien de variaties kunnen optreden bij het gebruik van een nieuwe partij van cellen. Ten derde is het essentieel om te controleren dat de medicamenteuze behandeling effectief is door het controleren van cellen onder de Microscoop vaak zodat eventuele fouten kunnen worden snel ontdekt en gecorrigeerd worden. Ten slotte, het is raadzaam om altijd een voorraad van tussenliggende stappen in geval van besmetting of onverwachte problemen die van invloed kunnen zijn voor de levensvatbaarheid van de cellen in het midden van het protocol. Nog belangrijker is, ons protocol is gericht op het genereren van modellen van medicamenteuze resistentie door bloot prostaat kankercellen aan hoge doses van Docetaxel gedurende 72 uur gevolgd door lange herstel periodes, in plaats van constante concentraties lager van de drug in een poging om na te bootsen de beste klinische scenario voor de behandeling van prostaatkanker met deze taxane agent15,16gerapporteerd.

Bovendien moet opgemerkt worden dat resistente cellen vertonen een hoge plasticiteit, hetgeen tot een progressief verlies van verworven resistentie eigenschappen na verloop van tijd leiden kan. Uitbreiding van het gebruik van deze cellen voor meer dan 2-3 maanden in cultuur wordt daarom niet aangeraden. Als een permanente voorraad nodig is is het raadzaam om voortdurend nieuwe batches van resistente cellen te genereren. Echter als batches van cellen hebben gekweekt is voor een langere periode, kolonie vorming testen en qPCR kunnen worden gebruikt voor opnieuw beoordelen hun weerstand. Een ander alternatief is het stimuleren van waning weerstand door de behandeling van de cellen met een hoge dosis Docetaxel voor 72 h (500-1000 nM). Na een herstelperiode van een tot twee weken, het fenotype kan opnieuw worden getest door qPCR en kolonie vorming testen. Het is ook mogelijk, hoewel niet aanbevolen, om op te slaan aliquots van behandelde cellen in vloeibare stikstof (in FBS, 10% DMSO). Houd er rekening mee dat na een freeze-dooi cyclus, het fenotype van de chemoresistance moet altijd worden geëvalueerd met de bovengenoemde methoden.

Ondanks deze kanttekeningen, we28,29 e.a.30,31,32,33 waren in staat om met succes in deze modelsystemen te identificeren van de belangrijkste roman cellulaire dienst en moleculaire mechanismen die leiden tot verhoogde tumor-starten capaciteit, overleving van de cel en agressiviteit in Docetaxel-resistente cellen. Met behulp van deze kanker cel modelsystemen, ontdekten we dat cellen exposeren een ongedifferentieerde fenotype, gekenmerkt door het ontbreken van epitheliale en prostaat-gerelateerde differentiatie markers en overexpressie van targetable ontwikkelingsstoornissen (Inkeping en Hedgehog) signaalroutes, overleven chemotherapeutische blootstelling28. In een tweede studie, met behulp van deze modellen samen met openbaar patiënt gene datasets24,25, wij aan het licht gebracht dat de pionier transcriptiefactor GATA2 is zeer overexpressie in metastatische castratie-resistente chemotherapie-resistente prostaatkanker cellen. GATA2 verhoogt het voortbestaan van cellen door direct activeren een IGF2-afhankelijke downstream kinase signalering netwerk29. Met name deze studies geholpen om nieuwe belangrijke rollen van GATA2 in geavanceerde uitgezaaide prostaatkanker agressiviteit34te identificeren.

De ontwikkeling van resistentie is een probleem dat is niet beperkt tot Docetaxel en prostaatkanker, zoals het heerst onder vele andere soorten van kanker behandeld met een breed scala aan chemotherapeutische geneesmiddelen. Inderdaad, gelden soortgelijke beperkingen op de beschikbaarheid van experimentele modellen, en het is denkbaar dat ons protocol aangepast worden kan aan andere soorten kanker en hun respectieve chemoresistance mechanismen bestuderen.

De generatie van Docetaxel-resistente cellen zoals beschreven in dit protocol kan worden gebruikt als een functioneel instrument te identificeren van nieuwe relevante moleculaire en cellulaire mechanismen van chemoresistance. Dit opent de deur naar het vinden van nieuwe doelstellingen, waarop de ontwikkeling van nieuwe behandelingen voor zeer kwaadaardige prostaat kanker articuleren kan, eens te meer verleggen van wat we weten over deze ziekte en hoe we omgaan met haar patiënten.

Disclosures

De auteurs verklaren dat zij geen concurrerende financiële belangen hebben.

Acknowledgments

V.R.-B. wordt gesubsidieerd door de Amerikaanse Department of Health & Human Services, NIH, National Cancer Institute verlenen nummer 1 K22 CA207458-01 en J.D.-D. wordt gesubsidieerd door de Amerikaanse Department of Health & Human Services, NIH, National Cancer Institute verlenen nummer 1 R01 CA207311-01.

Materials

Name Company Catalog Number Comments
DU145 cells ATCC HTB-81
22Rv1 cells ATCC CRL-2505
Docetaxel Selleck Chemicals S1148 in DMSO (10mM)
Tissue culture flask 150cm2 Falcon 355001
6-well tissue culture plates Falcon 353046
RPMI 1640 Medium Gibco 11875093 Supplemented with 10% FBS and 1% Penicilin/Streptomycin
Foundation B Fetal Bovine Serum Gemini 900208
1X Phosphate-Buffered Saline (PBS) Corning 21-040-CM
0.05%Trypsin-EDTA Gibco 25300-062
Penicillin-Streptomycin Gibco 15140122
RNeasy Mini Kit Qiagen 74106
SuperScript III first strand synthesis system for RT-PCR Invitrogen 18080051
Power SYBR Green PCR Master Mix Invitrogen 4367659
Crystal Violet Sigma-Aldrich C0775
10% Formalin Solution Sigma-Aldrich HT501128
Primers for qRT-PCR: Life technologies
CK19 F: CTGCGGGACAAGATTCTTGGT
CK19 R: CCAGACGGGCATTGTCGAT
CDH1 F: GGAAGTCAGTTCAGACTCCAGCC
CDH1 R: AGGCCTTTTGACTGTAATCACACC
ABCB1 F: TGTTCAAACTTCTGCTCCTGA
ABCB1 R: CCCATCATTGCAATAGCAGG
GATA2 F: CATCAAGCCCAAGCGAAGA
GATA2 R: TTTGACAGCTCCTCGAAGCA
ACTIN F: CATGTACGTTGCTATCCAGGC
ACTIN R: CTCCTTAATGTCACGCACGAT

DOWNLOAD MATERIALS LIST

References

  1. Hanahan, D., Weinberg, R. A. Hallmarks of cancer: the next generation. Cell. 144, (5), 646-674 (2011).
  2. Lapenna, S., Giordano, A. Cell cycle kinases as therapeutic targets for cancer. Nature reviews. Drug discovery. 8, (7), 547-566 (2009).
  3. Jackson, J. R., Patrick, D. R., Dar, M. M., Huang, P. S. Targeted anti-mitotic therapies: can we improve on tubulin agents? Nature reviews. Cancer. 7, (2), 107-117 (2007).
  4. Dumontet, C., Jordan, M. A. Microtubule-binding agents: a dynamic field of cancer therapeutics. Nature reviews. Drug discovery. 9, (10), 790-803 (2010).
  5. Schiff, P. B., Fant, J., Horwitz, S. B. Promotion of microtubule assembly in vitro by taxol. Nature. 277, (5698), 665-667 (1979).
  6. Schiff, P. B., Horwitz, S. B. Taxol stabilizes microtubules in mouse fibroblast cells. Proceedings of the National Academy of Sciences of the United States of America. 77, (3), 1561-1565 (1980).
  7. Musacchio, A., Salmon, E. D. The spindle-assembly checkpoint in space and time. Nature reviews. Molecular cell biology. 8, (5), 379-393 (2007).
  8. Kops, G. J. P. L., Weaver, B. A. A., Cleveland, D. W. On the road to cancer: aneuploidy and the mitotic checkpoint. Nature reviews. Cancer. 5, (10), 773-785 (2005).
  9. Derry, W. B., Wilson, L., Jordan, M. A. Substoichiometric binding of taxol suppresses microtubule dynamics. Biochemistry. 34, (7), 2203-2211 (1995).
  10. Jordan, M. A., Wendell, K., Gardiner, S., Derry, W. B., Copp, H., Wilson, L. Mitotic block induced in HeLa cells by low concentrations of paclitaxel (Taxol) results in abnormal mitotic exit and apoptotic cell death. Cancer research. 56, (4), 816-825 (1996).
  11. Orth, J. D., Kohler, R. H., Foijer, F., Sorger, P. K., Weissleder, R., Mitchison, T. J. Analysis of mitosis and antimitotic drug responses in tumors by in vivo microscopy and single-cell pharmacodynamics. Cancer research. 71, (13), 4608-4616 (2011).
  12. Zasadil, L. M., et al. Cytotoxicity of paclitaxel in breast cancer is due to chromosome missegregation on multipolar spindles. Science translational medicine. 6, (229), (2014).
  13. Dominguez-Brauer, C., Thu, K. L., Mason, J. M., Blaser, H., Bray, M. R., Mak, T. W. Targeting Mitosis in Cancer: Emerging Strategies. Molecular cell. 60, (4), 524-536 (2015).
  14. Torre, L. A., Bray, F., Siegel, R. L., Ferlay, J., Lortet-Tieulent, J., Jemal, A. Global cancer statistics, 2012. CA: a cancer journal for clinicians. 65, (2), 87-108 (2015).
  15. Petrylak, D. P., et al. Docetaxel and estramustine compared with mitoxantrone and prednisone for advanced refractory prostate cancer. The New England journal of medicine. 351, (15), 1513-1520 (2004).
  16. Tannock, I. F., et al. Docetaxel plus prednisone or mitoxantrone plus prednisone for advanced prostate cancer. The New England journal of medicine. 351, (15), 1502-1512 (2004).
  17. Sweeney, C. J., et al. Chemohormonal Therapy in Metastatic Hormone-Sensitive Prostate Cancer. The New England journal of medicine. 373, (8), 737-746 (2015).
  18. Mahon, K. L., Henshall, S. M., Sutherland, R. L., Horvath, L. G. Pathways of chemotherapy resistance in castration-resistant prostate cancer. Endocrine-related cancer. 18, (4), R103-R123 (2011).
  19. Follit, C. A., Brewer, F. K., Wise, J. G., Vogel, P. D. In silico identified targeted inhibitors of P-glycoprotein overcome multidrug resistance in human cancer cells in culture. Pharmacology research & perspectives. 3, (5), e00170 (2015).
  20. Ranganathan, S., Benetatos, C. A., Colarusso, P. J., Dexter, D. W., Hudes, G. R. Altered beta-tubulin isotype expression in paclitaxel-resistant human prostate carcinoma cells. British journal of cancer. 77, (4), 562-566 (1998).
  21. Martello, L. A., et al. Elevated levels of microtubule destabilizing factors in a Taxol-resistant/dependent A549 cell line with an alpha-tubulin mutation. Cancer research. 63, (6), 1207-1213 (2003).
  22. Lee, A. J. X., et al. Chromosomal instability confers intrinsic multidrug resistance. Cancer research. 71, (5), 1858-1870 (2011).
  23. Sansregret, L., Swanton, C. The Role of Aneuploidy in Cancer Evolution. Cold Spring Harbor perspectives in medicine. 7, (1), (2017).
  24. Grasso, C. S., et al. The mutational landscape of lethal castration-resistant prostate cancer. Nature. 487, (7406), 239-243 (2012).
  25. Taylor, B. S., et al. Integrative genomic profiling of human prostate cancer. Cancer cell. 18, (1), 11-22 (2010).
  26. Gao, D., et al. Organoid cultures derived from patients with advanced prostate cancer. Cell. 159, (1), 176-187 (2014).
  27. Drost, J., et al. Organoid culture systems for prostate epithelial and cancer tissue. Nature Protocols. 11, (2), 347-358 (2016).
  28. Domingo-Domenech, J., et al. Suppression of acquired docetaxel resistance in prostate cancer through depletion of notch- and hedgehog-dependent tumor-initiating cells. Cancer cell. 22, (3), 373-388 (2012).
  29. Vidal, S. J., et al. A targetable GATA2-IGF2 axis confers aggressiveness in lethal prostate cancer. Cancer cell. 27, (2), 223-239 (2015).
  30. Marín-Aguilera, M., et al. Identification of docetaxel resistance genes in castration-resistant prostate cancer. Molecular cancer therapeutics. 11, (2), 329-339 (2012).
  31. Zhao, L., et al. Identification of candidate biomarkers of therapeutic response to docetaxel by proteomic profiling. Cancer research. 69, (19), 7696-7703 (2009).
  32. Lin, H. -M., et al. Circulating microRNAs are associated with docetaxel chemotherapy outcome in castration-resistant prostate cancer. British journal of cancer. 110, (10), 2462-2471 (2014).
  33. Puhr, M., et al. Epithelial-to-mesenchymal transition leads to docetaxel resistance in prostate cancer and is mediated by reduced expression of miR-200c and miR-205. The American journal of pathology. 181, (6), 2188-2201 (2012).
  34. Rodriguez-Bravo, V., Carceles-Cordon, M., Hoshida, Y., Cordon-Cardo, C., Galsky, M. D., Domingo-Domenech, J. The role of GATA2 in lethal prostate cancer aggressiveness. Nature reviews. Urology. 14, (1), 38-48 (2017).
Generatie van prostaatkanker modellen van de cel van de weerstand tegen de anti-mitotische Agent Docetaxel
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Mohr, L., Carceles-Cordon, M., Woo, J., Cordon-Cardo, C., Domingo-Domenech, J., Rodriguez-Bravo, V. Generation of Prostate Cancer Cell Models of Resistance to the Anti-mitotic Agent Docetaxel. J. Vis. Exp. (127), e56327, doi:10.3791/56327 (2017).More

Mohr, L., Carceles-Cordon, M., Woo, J., Cordon-Cardo, C., Domingo-Domenech, J., Rodriguez-Bravo, V. Generation of Prostate Cancer Cell Models of Resistance to the Anti-mitotic Agent Docetaxel. J. Vis. Exp. (127), e56327, doi:10.3791/56327 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter