Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Begeleide Protocol voor fecale microbiële karakterisering door 16S rRNA-Amplicon Sequencing

doi: 10.3791/56845 Published: March 19, 2018

Summary

Dit manuscript beschrijft een gedetailleerde gestandaardiseerde protocol voor high-throughput 16S rRNA-amplicon sequencing. Het protocol introduceert een protocol van het geïntegreerde, geüniformeerde haalbaar en goedkoop vanaf fecale sample collectie door middel van data-analyses. Dit protocol maakt analyse van grote aantallen monsters met strenge normen en diverse besturingselementen.

Abstract

De menselijke intestinale microbiome speelt een centrale rol bij de bescherming van cellen tegen verwonding, bij de verwerking van energie en voedingsstoffen en bij de bevordering van immuniteit. Afwijkingen van wat wordt beschouwd als een gezonde microbiota samenstelling (dysbiosis) kunnen de vitale functies leidt tot pathologische voorwaarden schaden. De karakterisatie van associaties tussen microbiële samenstelling en de menselijke gezondheid en ziekte hebben recente en aanhoudende onderzoeksinspanningen is gericht.

Voorschotten in high-throughput sequencing technologieën inschakelen karakterisering van de microbiële samenstelling van gut. Deze methoden omvatten 16S rRNA-amplicon sequencing en shotgun sequencing. 16S rRNA-amplicon sequencing wordt gebruikt om het profiel van taxonomische samenstelling, terwijl geweer sequencing aanvullende informatie over gene voorspellingen en functionele annotatie bevat. Een voordeel bij het gebruik van een methode gerichte sequentiebepaling van het 16S rRNA gene variabele regio is de aanzienlijk lagere kosten in vergelijking met jachtgeweer sequencing. Reeks verschillen in het 16S rRNA gen worden gebruikt als een microbiële vingerafdruk te identificeren en kwantificeren van de verschillende taxa binnen een afzonderlijke monster.

Grote internationale inspanningen hebben normen voor 16S rRNA-amplicon sequencing ingeroepen. Verschillende studies verslag echter een gemeenschappelijke bron van variatie, veroorzaakt door batch effect. Om te minimaliseren van dit effect, geüniformeerde protocollen voor sample collectie, moeten verwerking, en volgorde worden uitgevoerd. Dit protocol stelt de integratie van algemeen gebruikte protocollen fecale sample collectie vanaf tot data-analyses. Dit protocol bevat een kolom-vrij, direct-PCR aanpak waarmee gelijktijdige behandeling en DNA-extractie van grote aantallen fecale monsters, samen met PCR versterking van de V4-regio. Bovendien, het protocol beschrijft de analyse-pijpleiding en bevat een script met behulp van de nieuwste versie van QIIME (QIIME 2 versie 2017.7.0 en DADA2). Dit stapsgewijze protocol is gericht op diegenen die geïnteresseerd zijn in het gebruik van het 16S rRNA-amplicon sequencing starten in een robuuste, reproductieve, makkelijk te gebruiken en gedetailleerde manier begeleiden.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Geconcentreerde inspanningen hebben gedaan om microbiome diversiteit en abundantie, als een ander aspect van het vastleggen van verschil en overeenkomsten tussen particulieren in gezonde en pathologische omstandigheden beter te begrijpen. Leeftijd2,3, geografie4, levensstijl5,6en ziekte5 werden getoond kunnen worden betrokken bij de samenstelling van de microbiome van de darm hebben, maar veel voorwaarden en populaties nog niet volledig gekenmerkt. Er werd onlangs gemeld dat de microbiome kan worden gewijzigd voor therapeutische toepassingen7,8,9. Daarom, meer inzicht in de relatie tussen verschillende fysiologische omstandigheden en de microbiële samenstelling is de eerste stap naar optimalisatie van de potentiële toekomstige wijzigingen.

De traditionele microbiële cultuur worden beperkt door lage opbrengst10,11, methodenen worden geconceptualiseerd als een binaire staat waar een bacterie is ofwel presenteren in de darm, of niet. High-throughput DNA gebaseerde sequencing heeft een revolutie teweeggebracht in microbiële ecologie, toelatend de vang van alle leden van de microbiële Gemeenschap. Nochtans, Las volgorde lengte en kwaliteit blijven belangrijke belemmeringen voor nauwkeurige taxonomie toewijzing12. High-throughput gebaseerde experimenten kunnen bovendien lijden van batch-effecten, waar metingen worden beïnvloed door niet-biologische of niet-wetenschappelijke variabelen13. In de afgelopen jaren zijn verschillende programma's vastgesteld om te bestuderen van de menselijke microbiome, met inbegrip van het Amerikaanse Gut-project, de menselijke Microbiome-Project van Verenigde Staten (VS) en het Verenigd Koninkrijk (UK)-MetaHIT-project. Deze initiatieven hebben gegenereerd grote hoeveelheden gegevens die niet gemakkelijk vergelijkbaar te wijten aan een gebrek aan samenhang in hun aanpak. Een scala aan internationale projecten zoals de International menselijke Microbiome Consortium, het project van de standaarden voor de menselijke Microbiome, en de National Institute of Standards and Technology (NIST) geprobeerd om enkele van deze kwesties14 , en de normen voor metingen van de microbiome waarmee de verwezenlijking van betrouwbare reproductieve resultaten moeten ontwikkeld. Hier wordt beschreven, is een geïntegreerde protocol verschillende algemeen gebruikte methoden15,16 voor het 16S rRNA high-throughput sequencing (16S-seq) vanaf fecale sample collectie door middel van data-analyses. Het protocol beschrijft een kolom-vrije PCR-aanpak, oorspronkelijk ontworpen voor directe extractie van plantaardige DNA16, zodat de gelijktijdige behandeling van grote aantallen fecale monsters in een relatief korte tijd met hoge kwaliteit versterkt DNA voor gerichte rangschikking van de microbiële variabele V4 regio op een gemeenschappelijk platform van de sequencing. Dit protocol is gericht op het begeleiden van de wetenschappers ook geïnteresseerd in de inleiding van het gebruik van het 16S rRNA-amplicon sequencing in een robuuste, reproductieve, makkelijk te gebruiken en gedetailleerde manier, belangrijke besturingselementen gebruiken. Na een begeleide en gedetailleerde stap-by stap protocol batch effect kan minimaliseren en dus meer vergelijkbare rangschikkend resultaten tussen labs zal toestaan.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Ethische goedkeuring voor de studie werd verleend door de ethische commissie voor Sheba lokale onderzoek en alle methoden werden uitgevoerd volgens de relevante richtlijnen en verordeningen. Het protocol ontvangen een uitzondering van de patiënt toestemming van de plaatselijke ethische Review Board, sinds de fecaal materiaal die gebruikt werden waren reeds voorgelegd aan de kern van de microbiologie als onderdeel van de klinische workup en zonder identificeerbare patiënteninformatie dan leeftijd, geslacht en microbiële resultaten. Geschreven, geïnformeerde toestemming was verkregen uit gezonde vrijwilligers en de institutionele Review Board goedgekeurd de studie. Sommige van deze monsters zijn al opgenomen in een vorige analyse1.

1. sample Handling

  1. Een ongeveer 5 mm2 uitstrijkje (ongeveer de grootte van een potlood gum) uit een vers fecale monster met een steriel doekje in een test tube verzamelen (Zie Tabel van materialen). Bewaar alle swabs met fecale monsters bij-80 ° C binnen 24 uur. De fecale swabs kunnen er blijven totdat zij worden verwerkt.

2. DNA-extractie

  1. De extractie en verdunning oplossingen op kamertemperatuur ontdooien (Zie Tabel van materialen).
  2. Overdracht het fecale staafje in een verzameling lege 2 mL tube (Zie Tabel van materialen). De swab stick grootte aanpassen door te snijden met behulp van een schone schaar om sluiting van de buis met minimale kruisbesmetting. 250 μL van de extractievloeistof toevoegen aan elke buis van de collectie met de fecale doekje en vortex te mengen.
  3. Verwarm de monsters gedurende 10 minuten in een kokend waterbad (95-100° C). Voeg toe 250 μL van verdunning oplossing aan elk monster en de vortex te mengen.
  4. Opslaan van de 2 mL tubes met de geëxtraheerde DNA en het staafje bij 4 ° C.

3. PCR en voorbereiding van de bibliotheek

Voor stap 3.1 en 3.2, werkomgeving in een PCR-workstation dat schone biedt, sjabloon en amplicon gratis.

  1. Label de inleidingen (tabel 1) volgens hun barcode. Verdun elk primer in dubbel gedestilleerd water (DDW) om een 50 μM concentratie en sla bij-20 ° C.
  2. Een 96-wells-plaat gebruiken voor PCR reacties. Elke plaat kan 32 verschillende monsters, die zijn gelabeld door 32 verschillende index inleidingen bevatten. De voorwaartse primer en de 32 omgekeerde inleidingen op kamertemperatuur ontdooien en vul ze tot 5 μM.
  3. Bereid de PCR reactie mixen voor 100 reacties (eindvolume in elk putje zullen 20 μl) door het mengen van 100 μl van 5 μM Forward primer, 1 mL 2 X PCR Master mix en 400 μL DDW. Zet 15 μL van deze PCR-mix in elk putje (in totaal 96-wells). Breng 1 μL van elk 5 μM Reverse geïndexeerde primer in 3 verschillende putjes (32 verschillende inleidingen in triplicates geeft een totaal van 96-wells).
  4. In een specifieke zone van pre-PCR, wat betekent dat een schone bankje thats sjabloon en amplicon gratis, Voeg 4 μL van elk geëxtraheerde DNA-monster aan reactie mengsels (elk geëxtraheerde DNA-monster wordt versterkt in drievoud — 32 monsters per 96-wells-plaat).
  5. PCR uitgevoerd met de volgende instellingen: eerste denaturatie van 94 ° C gedurende 3 minuten; gevolgd door 35 cycli van denaturatie bij 94 ° C voor 1 min, gloeien bij 55 ° C gedurende 1 minuut en uitbreiding bij 72 ° C gedurende 1 min; en een laatste uitbreiding bij 72 ° C gedurende 10 minuten.
  6. Combineren op een andere bank, die zal worden gedefinieerd als een specifieke zone van post-PCR, elke drievoudige PCR-reactie in een enkel volume buis (60 μL per monster).
  7. Om te beoordelen van de kwaliteit van PCR waarbij, 4 μL van elke combinatie-PCR reactie worden uitgevoerd op een ethidium bromide gebeitste 1% agarose gel. Onder UV golflengte van 260 nm, de positieve waarbij zal verschijnen in een verwachte band grootte van 375-425 bp. Alleen deze waarbij zal worden opgenomen in de volgende stappen.
    Opmerking: Elk monster wordt versterkt in drievoudige, betekenis dat elk monster wordt versterkt in 3 verschillende PCR reacties. Niet schaalbaar.

4. bibliotheek kwantificering en reiniging

  1. Om een mengsel concentratie zwembad van alle monsters van PCR, kwantificeren elk amplicon door een dubbele gestrande DNA (dsDNA kwantificeren reagens) TL nucleïnezuur vlek (Zie Tabel of Materials), geschikt voor de gelijktijdige kwantificering van een grote bedrag van de monsters.
    Opmerking: Aangezien het bereik van de grootte van het amplicon dubbelzinnig is, wordt het werkelijke bedrag in nanogram gebruikt voor het laden van een mengsel concentratie.
  2. Combineer 500 ng van elk monster in een enkele, steriele buis. Vortex te mengen.
  3. Voer 200 μL van de gebundelde bibliotheek op een Ethidium Bromide gebeitste 1% agarose gel. Pak de 375-425 bp bands uit de gel met een gel-kit voor extractie volgens de instructies van de fabrikant (Zie Tabel van materialen) en elueer de gepoolde bibliotheek in 80 μL DDW.
    Opmerking: De gepoolde bibliotheek moet grootte geselecteerd om niet-specifieke versterking producten vanaf host DNA.
  4. Meten van de concentratie van de definitieve bibliotheek met behulp van een hooggevoelige dsDNA detectie kit volgens de instructies van de fabrikant (Zie Tabel van materialen). De grootte van de nauwkeurige bibliotheek met behulp van een hooggevoelige scheiding en analyse kit voor DNA bibliotheken volgens de instructies van de fabrikant meten (Zie Tabel van materialen).

5. sequencing

  1. Verdun de gepoolde bibliotheek tot 19u met toevoeging van 20% controle bibliotheek (Zie Tabel of Materials), volgens het protocol van de machine sequencing.
  2. Gebruik aangepaste ontworpen Lees voor sequencing, inleidingen die gratis naar de V4 amplificatie inleidingen (Zie tabel 1).
  3. Gebruik een derde aangepaste ontworpen sequencing primer die luidt de barcode in een extra cyclus (Zie tabel 1) en genereert gekoppeld-einde leest van 175 bases in lengte in elke richting, volgens de specificaties van de fabrikant.
  4. Start de machine sequencing en FASTQ bestanden volgens protocol van de fabrikant te verkrijgen.

6. verwerking van de gegevens

  1. Stik en verwerken van de overlappende gekoppeld-end FASTQ bestanden in een gegevens curatie pijpleiding uitgevoerd in QIIME 2 versie 2017.7.017. Demultiplex het luidt volgens monster specifieke barcodes.
  2. DADA218 wordt gebruikt voor kwaliteitscontrole en volgorde variant (SVs) detectie. Afkappen leest op 13 bases van de 3'-eind en 15 honken na 5', discard leest met meer dan 2 verwachte fouten. Identificeren en verwijderen van de Chimaera met behulp van de methode van consensus — Chimaera worden gedetecteerd in monsters individueel en sequenties gevonden chimeer in een voldoende aantal monsters worden verwijderd.
  3. Uitvoeren van SVs taxonomische classificatie op basis van een classificatie Naive Bayes uitgerust, opgeleid op de augustus 2013 99% identiteit Greengenes database6, voor 175 lang leest en de vooruit-/ achteruitspoelen primer instellen.
  4. Rarefy alle monsters diepte van 2,146 sequenties.
  5. Gebruik ongewogen UniFrac voor meting van β-diversiteit (tussen monster diversiteit19,20) op de ijle monsters, om te voorkomen dat een steekproef-grootte-effect.
  6. Gebruik de resulterende matrix van afstand voor het uitvoeren van een analyse van de belangrijkste coördinaten (PCoA).
    Opmerking: De gegevensverwerking script en mapping-bestanden worden geleverd als aanvullend materiaal (aanvullend materiaal 1 en 2).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Een schematische illustratie van het protocol is afgebeeld in Figuur 1.

We hebben prospectief kruk monsters van gehospitaliseerde patiënten met vermoedelijke infectieuze diarree verzameld. Deze monsters werden ter beschikking gesteld aan de klinische microbiologie Lab aan het Sheba Medical Center tussen februari en mei 2015, zoals eerder beschreven1was. Kruk monsters werden onderworpen aan conventionele microbiologische cultuur uitgevoerd op het labo voor klinische microbiologie en aan breed scala high-throughput 16S-seq parallel. Daarnaast werden de kruk monsters van gezonde volwassenen sequenced voor vergelijking.

In deze analyse lag de nadruk op de controle op de kwaliteit van de gegevens, en de representatieve resultaten Toon van de output verkregen QIIME217. Aanvankelijk, rangschikkend resultaten in 6 negatieve controlemonsters werden herzien voor kwaliteitscontrole inclusief: i) PCR zonder sjabloon, ii) PCR op schoon en steriel swabs in extractie en verdunning oplossing, en iii) PCR op gemengde extractie en verdunning oplossingen. Tabel 2 toont dat alle negatieve controlemonsters had ≤118 totale leest (gemiddeld 29 sequenties), voornamelijk uit de Mycoplasma taxa, terwijl alle andere monsters geanalyseerd toonde gemiddelde totale leest van 10622.57 (±1211.34 standaard fout) en niet Mycoplasma lezen controle op de kwaliteit van de belangrijkste monsters doorgegeven.

Zestien monsters dat elk afkomstig van de hetzelfde monster van de ontlasting is maar ging door andere bibliotheek voorbereiding met verschillende omgekeerde barcoded inleidingen werden gebruikt als positieve controle. Deze 16 monsters 8 met positieve culturen voor Campylobacter, Salmonella, Shigella , die door het laboratorium klinische microbiologie en 8 die werden gerapporteerd als negatieve culturen zijn gemeld of opgenomen. De plot van een gebied op het niveau van de stammen is afgebeeld in Figuur 2. Monsters die afkomstig is van de hetzelfde monster van de ontlasting maar ging door andere bibliotheek voorbereiding met verschillende omgekeerde barcoded inleidingen blijkt zeer consequent relatieve overvloed (Mantel test tussen duplicaten van phylum niveau taxonomische relatieve overvloed waarden gesimuleerd p-waarde = 1 x 10-04 op basis van 9999 wordt gerepliceerd).

Belangrijkste coördinaten analyse (PCoA), waardoor dimensionaliteit van de invoergegevens, was op de UniFrac matrix gebruikt om visueel verkennen monster scheiding en gelijkenis. In figuur 3A, zijn gesequenceerd monsters die afkomstig is van de dezelfde oorspronkelijke monster van de ontlasting maar ging door andere bibliotheek voorbereiding gekleurd hetzelfde. Inderdaad, die liggen relatief nauw betrokken worden bij de PCoA plot (Mantel test tussen duplicaten PC1, PC2 waarden gesimuleerde p-waarde = 1e-04 gebaseerd op 9999 wordt gerepliceerd). Daarnaast is de gemiddelde ongewogen unifrac bèta diversiteit afstand tussen monsters in deze studie 0.706, terwijl de gemiddelde afstand tussen twee duplicaten 0.235 is (Wilcoxon rangschikking som test p-waarde = 4.205 x 10-11). Interessant, monsters positief voor Campylobacter, Salmonellaen Shigella maagdarm cultuur waren bleek aanzienlijk verschillende PC1 waarden (Wilcoxon rangschikking som test p-waarde = 0.011) in vergelijking met monsters met negatieve resultaten van de cultuur. Figuur 3B toont hetzelfde PCoA terrein maar nu monsters worden gekleurd door de relatieve overvloed aan Proteobacteria. Monsters met een hoge Proteobacteria overvloed had aanzienlijk verschillende PC1 waarden (Spearman correlatie r =-0.533, p-waarde = 0.000975). Deze resultaten zijn in overeenstemming met eerdere analyse van deze gegevens, waar gehospitaliseerde patiënten hebben diepgaande verhogingen in taxa van Proteobacteria stam1. Hier toonden wij dat PC1 is gecorreleerd met Proteobacteria overvloed, met positieve monsters cultuur clustering meestal aan de ene kant van de PC1 as en cultuur negatieve monsters clustering meestal aan de andere kant, samen met de gezonde monsters.

Figure 1
Figuur 1 : Stroomschema van fecale monsters naar relatieve microbiële overvloed. 1) monster behandeling: links, fecale monsters worden verzameld in een steriel doekje buis. Rechts, is de grootte van de stok doekje aangepast door te snijden zodat de sluiting van 2ml tube, en opslag. 2) DNA-extractie: DNA wordt geëxtraheerd door directe PCR kolommen-vrije benadering. 3) library voorbereiding: verliet 4 μL van de geëxtraheerde DNA wordt versterkt met vooruit/achteruit-index inleidingen. Elke omgekeerde primer bevat een 12 basis barcode. Elk monster wordt versterkt in drievoud. Een 96-wells-plaat bevat 32 verschillende streepjescodes. Rechts, elke barcode drievoudige te combineren tot een enkel volume buis. Een 96-wells-plaat bevat 96 verschillende streepjescodes. 4) library kwantificering: bovenste deelvenster screening voor positieve monsters, waarbij geconstateerd op Ethidium Bromide gebeitste 1% agarose gel. Lagere paneel, kwantificering van de positieve waarbij tot mengsel concentratie van 500 ng amplicon van elk monster in een pool van één bibliotheek. 5) library zuivering: bovenste paneel, de gepoolde bibliotheek is gel gewonnen voor maat keuze en zuivering. Lagere paneel, de exacte grootte van de bibliotheek en de concentratie wordt gemeten. 6) sequencing: hoge-doorvoer sequencing van de gebundelde bibliotheek. 7) de gegevens rangschikken door een pijpleiding bioinformatic voor 16S rRNA-amplicon microbiële ecologie wordt geanalyseerd. Klik hier voor een grotere versie van dit cijfer.

Figure 2
Figuur 2 : Consistent relatieve overvloed tussen monsters die afkomstig is van de hetzelfde monster van de ontlasting maar ging door andere bibliotheek voorbereiding. Taxonomische relatieve overvloed op het niveau van de stam wordt weergegeven per monster zoals aangegeven. Relatieve overvloed weergegeven voor 16 fecale monsters gehospitaliseerde patiënten met vermoedelijke infectieuze diarree dat elk ging door andere bibliotheek voorbereiding (Duplicate 1en 2) met verschillende omgekeerde barcoded inleidingen en 3 gezonde controles verkregen. Klik hier voor een grotere versie van dit cijfer.

Figure 3
Figuur 3 : Phylogenetic diversiteit Toon consistente resultaten voor monsters die afkomstig is van de hetzelfde monster van de ontlasting maar ging door andere bibliotheek voorbereiding. Belangrijkste coördinaten analyse (PCoA), dat dimensionaliteit van de invoergegevens vermindert gewend was op de UniFrac matrix visueel verkennen monster scheiding en gelijkenis. De afstand tussen de twee monsters geeft het verschil in de samenstelling van hun microbiome. (A) ongewogen UniFrac PCoA uitzetten. Elk punt vertegenwoordigt één gesequenceerd sample. Monsters afkomstig is van hetzelfde oorspronkelijke kruk monster zijn hetzelfde gekleurd. Monsters van gehospitaliseerde patiënten met positieve kruk cultuur gerapporteerd door de klinische microbiologie1 zijn gemarkeerd door pleinen, gehospitaliseerde patiënten met cultuur in driehoeken1en gezonde volwassenen vanaf een aparte sequencing run1 negatief zijn gemarkeerd met gevuld in cirkels. (B) dezelfde PCoA als in een, maar monsters zijn nu gekleurd door hun relatieve abundantie van de Proteobacteria, zoals aangegeven. Klik hier voor een grotere versie van dit cijfer.

De naam van de primer Primer volgorde Beschrijving van de primer
Voorwaartse primer AATGATACGGCGACCACCGAGATCTACAC - TATGGTAATT - GT - GTGCCAGCMGCCGCGGTAA 5' adapter sequentie - toekomen primer pad - toekomen primer linker - Forward primer
Omgekeerde index primer CAAGCAGAAGACGGCATACGAGAT - XXXXXXXXXXXX - AGTCAGTCAG - CC - GACTACHVGGGTWTCTAAT Aanvulling 3' adapter sequentie - Golay barcode - Reverse primer pad - Reverse primer linker - Reverse primer omkeren
Lees 1 sequencing primer TATGGTAATT - GT - GTGCCAGCMGCCGCGGTAA Toekomen primer pad - toekomen primer linker - Forward primer
Lees 2 sequencing primer AGTCAGTCAG - CC - GGACTACHVGGGTWTCTAAT Omgekeerde primer pad - Reverse primer linker - Reverse primer
Index volgorde primer ATTAGAWACCCBDGTAGTCC - GG - CTGACTGACT Aanvulling van omgekeerde primer - Reverse aanvulling voor omgekeerde primer linker - Reverse complement van omgekeerde primer pad omkeren

Tabel 1: Primer lijst.

Monster Aantal leest bericht
eerste kwaliteitscontrole in
QIIME
PCR op schone swabs in extractie en verdunning oplossing -1 118
PCR op schone swabs in extractie en verdunning oplossing -2 39
PCR zonder sjabloon -1 0
PCR zonder sjabloon -2 0
PCR op extractie en verdunning oplossingen mix - 1 16
PCR op extractie en verdunning oplossingen mix - 2 0
Monsters (gemiddelde ± standaardafwijking) 10622.57 ± 1211.34

Tabel 2: Aantal leest voor negatieve controles en fecale monsters.

Aanvullende materiaal 1: gegevensverwerking script. Klik hier om dit bestand te downloaden.

Aanvullende materiaal 2: toewijzingsbestand. Klik hier om dit bestand te downloaden.

Aanvullende materiaal 3: Primer regeling. Klik hier om dit bestand te downloaden.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

16S rRNA-amplicon en metagenomics jachtgeweer sequencing hebben opgedaan populariteit in klinische microbiologie toepassingen21,22,23. Deze technieken zijn voordelig in hun toegenomen capaciteit om te vangen culturable en niet-culturable taxa, verstrekken van gegevens over de relatieve abundantie van de pathogene entmateriaal en hun vermogen om te identificeren nauwkeuriger een besmettelijke polymicrobial vingerafdruk24. De vooruitgang op het gebied van microbiome onderzoek hebben gegenereerd grote hoeveelheden gegevens die niet gemakkelijk vergelijkbaar te wijten aan een gebrek aan samenhang in de verschillende benaderingen. In de afgelopen jaren hebben verschillende consortia geprobeerd om enkele van deze kwesties. Dit protocol volgt soortgelijke bibliotheek voorbereiding als het aarde-microbiome project (EMP). Het is echter een gedetailleerde stapsgewijze protocol voor DNA-extractie van fecale monsters via analyses pipeline toegevoegd.

Eerder, 16S rRNA sequencing is gebruikt voor het karakteriseren van de patronen van de microbiële samenstelling van fecale monsters van gezonde proefpersonen voor niet-opgenomen in het ziekenhuis en van gehospitaliseerde patiënten met vermoedelijke besmettelijke diarree, en traditionele cultuur resultaten. De resultaten van die analyse bleek dat gehospitaliseerde patiënten diepgaande verhogingen in taxa van Proteobacteria stam1. Hier beschreven is een geïntegreerde protocol van algemeen gebruikte methoden voor het 16S rRNA gene amplicon rangschikken met behulp van de directe PCR kolommen-vrije benadering dat oorspronkelijk was bedoeld voor de extractie van DNA16plant. Deze aanpak kan efficiënt en snel uitpakken kwalitatief goede versterkt-DNA bibliotheken gericht op de regio V4 variabele van het 16S rRNA gen van een groot aantal monsters geschikt voor high-throughput 16S rRNA sequencing.

Dit is een methode op basis van DNA sequencing, zijn gegevens over zowel anaëroben en sporenvormende anaerobe bacteriën microbiële gemeenschappen aanwezig in een individuele fecale monster verkregen. De aanneming van het protocol de inleidingen die oorspronkelijk ontworpen15 tegen de V4-regio van het 16S rRNA gen werden. Nog belangrijker is, de omgekeerde amplificatie primer bevatten een reeks van twaalf basis barcode die ondersteunt bundeling van maximaal 2,167 verschillende monsters in elke rijstrook15. De voorwaartse amplificatie primer bevat negen extra bases in de regio van de adapter die gekoppeld-eind rangschikken op de sequencing platform25 (tabel 1 en aanvullend materiaal 3) ondersteunen. Deze aanpak ingeschakeld hanteren een bibliotheek samengesteld uit 250 fecale monsters die waren sequenced op één rijstrook met een lopende diepte van 10622.57 ± 1211.34 (gemiddelde ± standaardafwijking) luidt per monster tegen een kostprijs van ongeveer 30 dollar per monster.

Om te zorgen voor kwaliteitscontrole, raden we u aan de volgende negatieve controles; i) PCR zonder DNA sjabloon, ii) PCR op DNA geëxtraheerd uit een schone steriel doekje, en iii) PCR op gemengd extractie en verdunning oplossing. Wat betreft de positieve controles, is het raadzaam met inbegrip van monsters die afkomstig is van de hetzelfde monster van de ontlasting maar ging door andere bibliotheek voorbereiding met verschillende omgekeerde barcoded primers en monsters uit vorige runs als interne kwaliteitscontrole. Van de nota zijn andere optionele positieve controles moeten worden gebruikt die microbiome meetnormen geboden door NIST. De gemiddelde leest dekking voor de negatieve controles is opmerkelijk lager in vergelijking met de werkelijke kruk monsters (tabel 1) en bestond voornamelijk uit de Mycoplasma taxa. Verder toonden we de consistentie van de resultaten van de sequencing met behulp van voorbeelden die elk afkomstig is van de dezelfde fecaal materiaal maar dat ging door andere bibliotheek voorbereiding (Figuur 3). Dit resultaat bevestigt ook dat, wanneer u onze geïntegreerde methode gebruikt, er geen kruisbesmetting tussen de monsters is.

In dit protocol introduceren wij een geïntegreerde geüniformeerde en haalbaar protocol om grote aantallen monsters die monsters te analyseren. Dit protocol is gericht op het begeleiden van de wetenschappers ook geïnteresseerd in de inleiding van het gebruik van het 16S rRNA-amplicon sequencing in een robuuste, reproductieve, makkelijk te gebruiken, goedkoop, gedetailleerde manier uit fecale collectie om data-analyses, belangrijke besturingselementen gebruiken. Deze gestandaardiseerde gedetailleerde begeleide protocol gebruikt, kan minimaliseren batch effecten en toestaan meer vergelijkbare rangschikkend resultaten tussen verschillende laboratoria.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs hebben niets te onthullen.

Acknowledgments

Dit werk werd gedeeltelijk ondersteund door het programma van de ik-CORE (verleent nr. 41/11), de Israël Science Foundation (grant nr. 908/15), en de Europese ziekte van Crohn en Colitis organisatie (ECCO).

Materials

Name Company Catalog Number Comments
Primers Integrated DNA Technologies (IDT)
Extraction solution Sigma-Aldrich E7526
Dilution solution Sigma-Aldrich D5688
Kapa HiFi HotStart ReadyMix PCR Kit KAPABIOSYSTEMS KK2601 PCR Master mix
Quant-iT PicoGreen dsDNA Reagent kit Invitrogen P7589 dsDNA quantify reagent
MinElute Gel extraction kit Qiagen 28606
Agarose Amresco 0710-250G
Ultra Pure Water Dnase and Rnase Free Biological Industries 01-866-1A
Qubit dsDNA HS assay kit Molecular probes Q32854 dsDNA detecting kit
High Sensitivity D1000 Agilent Technologies Screen Tape 5067-5582 separation and analysis
Screen Tape Assay Agilent Technologies Reagents 5067-5583 for DNA libraries
PhiX Control v3 Illumina 15017666 control library
MiSeq Reagent Kit v2 (500 cycle) Illumina MS-102-2003
Ethidium Bromide Amresco E406-10mL-TAM
2 mL collection tubes SARSTEDT 72.695.400 Safe Seal collection tubes
Plastic stick swab in PP test tube STERILE INTERIOR 23117
Name Company Catalog Number Comments
Equipment
PCR Machine Applied Biosystems 2720 Thermal Cycler
Sequncing Machine Illumina Miseq
PCR workstation Biosan UV-cleaner
scissors
vortexer Scientific Industries Vortex-Genie 2

DOWNLOAD MATERIALS LIST

References

  1. Braun, T., et al. Fecal microbial characterization of hospitalized patients with suspected infectious diarrhea shows significant dysbiosis. Scientific Reports. 7, 1088 (2017).
  2. De Filippo, C., et al. Impact of diet in shaping gut microbiota revealed by a comparative study in children from Europe and rural Africa. Proceedings of the National Academy of Sciences of the United States of America. 107, 14691-14696 (2010).
  3. Yatsunenko, T., et al. Human gut microbiome viewed across age and geography. Nature. 486, 222-227 (2012).
  4. Rodriguez, J. M., et al. The composition of the gut microbiota throughout life, with an emphasis on early life. Microbial Ecology in Health and Disease. 26, 26050 (2015).
  5. Turnbaugh, P. J., et al. An obesity-associated gut microbiome with increased capacity for energy harvest. Nature. 444, 1027-1031 (2006).
  6. McDonald, D., et al. An improved Greengenes taxonomy with explicit ranks for ecological and evolutionary analyses of bacteria and archaea. The ISME Journal. 6, 610-618 (2012).
  7. Bakken, J. S., et al. Treating Clostridium difficile infection with fecal microbiota transplantation. Clinical Gastroenterology and Hepatology. 9, 1044-1049 (2011).
  8. Khoruts, A., Dicksved, J., Jansson, J. K., Sadowsky, M. J. Changes in the composition of the human fecal microbiome after bacteriotherapy for recurrent Clostridium difficile-associated diarrhea. Journal of Clinical Gastroenterology. 44, 354-360 (2010).
  9. Nood, E. V., et al. Duodenal infusion of donor feces for recurrent Clostridium difficile. The New England Journal of Medicine. 368, 407-415 (2013).
  10. Koplan, J. P., Benfari Ferraro, M. J., Fineberg, H. V., Rosenberg, M. L. Value of stool cultures. The Lancet. 316, 413-416 (1980).
  11. Platts-Mills, J. A., Liu, J., Houpt, E. R. New concepts in diagnostics for infectious diarrhea. Mucosal Immunology. 6, 876-885 (2013).
  12. Bokulich, N. A., et al. Quality-filtering vastly improves diversity estimates from Illumina amplicon sequencing. Nature Methods. 10, 57-59 (2013).
  13. Leek, J. T., et al. Tackling the widespread and critical impact of batch effects in high-throughput data. Nature Reviews Genetics. 11, (2010).
  14. Dubilier, N., McFall-Ngai, M., Zhao, L. Create a global microbiome effort. Nature. 526, 631-634 (2015).
  15. Caporaso, J. G., et al. Global patterns of 16S rRNA diversity at a depth of millions of sequences per sample. PNAS. 108, 4516-4522 (2011).
  16. Flores, G. E., Henley, J. B., Fierer, N. A direct PCR approach to accelerate analyses of human-associated microbial communities. PloS One. 7, (2012).
  17. Caporaso, J. G., et al. QIIME allows analysis of high-throughput community sequencing data. Nature Methods. 7, 335-336 (2010).
  18. Callahan, B. J., et al. DADA2: High-resolution sample inference from Illumina amplicon data. Nature Methods. 13, 581-583 (2016).
  19. Lozupone, C., Knight, R. UniFrac: A new phylogenetic method for comparing microbial communities. Applied and Environmental Microbiology. 71, 8228-8235 (2005).
  20. Lozupone, C., Lladser, M. E., Knights, D., Stombaugh, J., Knight, R. UniFrac: An effective distance metric for microbial community comparison. The ISME Journal. 5, 169-172 (2011).
  21. Srinivasan, R., et al. Use of 16S rRNA gene for identification of a broad range of clinically relevant bacterial pathogens. PloS One. 10, e0117617 (2015).
  22. Hiergeist, A., Gläsner, J., Reischl, U., Gessner, A. Analyses of intestinal microbiota: culture versus sequencing. ILAR Journal. 56, 228-240 (2015).
  23. Didelot, X., Bowden, R., Wilson, D. J., Peto, T. E. A., Crook, D. W. Transforming clinical microbiology with bacterial genome sequencing. Nature Reviews Genetics. 13, 601-612 (2012).
  24. Salipante, S. J., et al. Rapid 16S rRNA next-generation sequencing of polymicrobial clinical samples for diagnosis of complex bacterial infections. PloS One. 8, e65226 (2013).
  25. Caporaso, J. G., et al. Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms. The ISME Journal. 6, 1621-1624 (2012).
Begeleide Protocol voor fecale microbiële karakterisering door 16S rRNA-Amplicon Sequencing
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Di Segni, A., Braun, T., BenShoshan, M., Farage Barhom, S., Glick Saar, E., Cesarkas, K., Squires, J. E., Keller, N., Haberman, Y. Guided Protocol for Fecal Microbial Characterization by 16S rRNA-Amplicon Sequencing. J. Vis. Exp. (133), e56845, doi:10.3791/56845 (2018).More

Di Segni, A., Braun, T., BenShoshan, M., Farage Barhom, S., Glick Saar, E., Cesarkas, K., Squires, J. E., Keller, N., Haberman, Y. Guided Protocol for Fecal Microbial Characterization by 16S rRNA-Amplicon Sequencing. J. Vis. Exp. (133), e56845, doi:10.3791/56845 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter