Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

פרוטוקול מודרך לקבלת צואה אפיון חיידקים על ידי מטוסי אף-16 rRNA-אמפליקון רצף

doi: 10.3791/56845 Published: March 19, 2018

Summary

כתב יד זה מתאר פרוטוקול מתוקננת מפורט של תפוקה גבוהה מטוסי אף-16 rRNA-אמפליקון רצף. הפרוטוקול מציג פרוטוקול משולב, לובשי מדים, ריאלי וזולה החל באיסוף הנתונים ניתוחים דגימת צואה. פרוטוקול זה מאפשר ניתוח של מספר רב של דוגמאות עם סטנדרטים קפדניים מספר פקדים.

Abstract

Microbiome מעיים אנושיים ממלאת תפקיד מרכזי בהגנה על התאים מפני פגיעה, עיבוד אנרגיה וחומרים מזינים, ובקידום חסינות. סטיות מן מה נחשב קומפוזיציה microbiota בריא (dysbiosis) עשוי לפגום תפקידים חיוניים מובילים לתנאים פיפטות. מאמצי מחקר האחרונות ומתמשכים מכוונת כלפי אפיון השיוכים בין הרכב מיקרוביאלי, מחלה ובריאות האדם.

ההתקדמות טכנולוגיות רצף תפוקה גבוהה מאפשרים אפיון ההרכב חיידקים במעיים. שיטות אלה כוללות 16 rRNA-אמפליקון רצף ורצף רובה ציד. מטוסי אף-16 rRNA-אמפליקון רצף משמש פרופיל taxonomical הרכב, ואילו רובה רצף מספקת מידע נוסף אודות הגן תחזיות, ביאור פונקציונלי. יתרון באמצעות שיטה רצף יישוב של rRNA 16 גנים באזור משתנה הוא עלותו נמוכות משמעותית לעומת רובה רצף. רצף הבדלים ג'ין rRNA מטוסי אף-16 משמשים כמו טביעת חיידקים כדי לזהות ולכמת taxa שונים בתוך דוגמה אישית.

המאמצים הבינלאומיים הגדולים נשאר תקנים עבור מטוסי אף-16 rRNA-אמפליקון רצף. עם זאת, מספר מחקרים מדווחים ממקור משותף של וריאציה הנגרמת על ידי אפקט אצווה. כדי למזער את האפקט הזה, פרוטוקולים במדים לאיסוף הדגימה, עיבוד, ורצף חייב ליישם. פרוטוקול זה מציע השילוב של פרוטוקולים משמש בהרחבה מתחיל מאוסף דגימת צואה ניתוח נתונים. פרוטוקול זה כולל גישה ישירה-PCR ללא עמודים, המאפשרת טיפול בו זמנית, הפקת דנ א מספרים גדולים של דגימות צואה, יחד עם ה-PCR הגברה של אזור V4. בנוסף, הפרוטוקול מתאר את הצינור ניתוח ומספק קובץ script באמצעות הגירסה העדכנית ביותר של QIIME (QIIME 2 גירסה 2017.7.0 ו- DADA2). פרוטוקול צעד אחר צעד זה נועד כדי להנחות את אלו המעוניינים ליזום את השימוש מטוסי אף-16 rRNA-אמפליקון רצף בצורה איתנה, הרבייה, קל לשימוש, מפורט.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

מרוכזים מאמצים נעשו כדי להבין טוב יותר microbiome גיוון ושפע, כמו היבט נוסף של לכידת ההבדל ונקודות הדמיון בין אנשים בריאים ופתולוגיים בתנאים. גיל2,3, גאוגרפיה4,5,סגנון חיים6ו מחלה5 הוצגו להיות מזוהה עם ההרכב של microbiome הבטן, אבל התנאים אוכלוסיות רבות טרם אושרו במלואן מאופיין. לאחרונה דווח כי ניתן לשנות את microbiome עבור יישומים טיפוליים-7,-8,-9. לכן, נוספים תובנות לגבי מערכת היחסים בין מצבים פיזיולוגיים שונים ההרכב מיקרוביאלי הוא הצעד הראשון לקראת אופטימיזציה של שינויים עתידיים פוטנציאליים.

השיטות התרבות חיידקים המסורתית מוגבלים על ידי תשואות נמוכות10,11, נתפסים כמו מדינה בינארי חיידקים איפה גם להציג בבטן או לא. תפוקה גבוהה מבוסס DNA רצף יש מהפכה אקולוגיה מיקרוביאלית, הפעלת לכידתו של כל חברי הקהילה מיקרוביאלי. עם זאת, רצף לקרוא אורך ואיכות נותרו מכשולים משמעותיים טקסונומיה מדויק הקצאה12. יתר על כן, ניסויים לפי תפוקה גבוהה עלולים לסבול מתופעות אצווה, איפה מדידות מושפעים הלא-ביולוגיים או לא מדעי משתנים13. בשנים האחרונות הוקמו מספר תוכניות כדי ללמוד את microbiome האנושית, כולל הפרויקט בטן אמריקאי, פרוייקט Microbiome האנושי של ארצות הברית (ארה ב) של הפרויקט MetaHIT הממלכה המאוחדת (בריטניה). היוזמות הללו יצרו כמויות אדירות של נתונים שאינם השוואה בקלות עקב חוסר עקביות הגישות שלהם. מגוון רחב של פרויקטים בינלאומיים כגון האיחוד הבינלאומי Microbiome האנושי, הפרויקט לסטנדרטים Microbiome האנושית בינלאומיים, ואת המכון הלאומי לתקנים וטכנולוגיה (NIST) ניסה להתמודד עם בעיות אלה,14 , ופיתח תקנים עבור מדידות microbiome אשר צריך לאפשר את ההישג של תוצאות אמינות הרבייה. המתוארים כאן הוא פרוטוקול משולב של מספר15,בשימוש רחב16 עבור מטוסי אף-16 rRNA תפוקה גבוהה רצף (16-seq) מתחיל דגימת צואה מקולקציית לצורך הערכה ניתוח נתונים. הפרוטוקול מתאר גישה ללא עמודים PCR, תוכנן במקור עבור חילוץ ישיר של צמח ה-DNA16, כדי לאפשר טיפול בו זמנית מספר גדול של צואה דגימות תוך זמן קצר יחסית עם איכות גבוהה מוגבר DNA עבור ממוקד קביעת רצף של אזור V4 משתנה חיידקים על פלטפורמה משותפת רצף. פרוטוקול זה שמטרתו להדריך מדענים מעוניין ליזום את השימוש מטוסי אף-16 rRNA-אמפליקון רצף בצורה איתנה, הרבייה, קל לשימוש, מפורט, באמצעות פקדי חשוב. יש פרוטוקול שלב מודרכים ומפורט אחר עשוי לצמצם את ההשפעה אצווה, ובכך יאפשר תוצאות דומות יותר רצף בין מעבדות.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

אישור מוסרי לחקר הוענקה על ידי ועדת האתיקה שיבא מחקר מקומיים, כל השיטות בוצעו בהתאם ההנחיות הרלוונטיות והתקנות. הפרוטוקול קיבל החולה והסכמתו לחריגה מן הלוח המקומי ביקורת אתית, מאז החומר הצואתי ששימשו כבר הוגשו עד היסוד מיקרוביולוגיה כחלק של בדיקות קליניות, ללא מידע המאפשר זיהוי אישי, סבלני חוץ גיל, מגדר, ותוצאות מיקרוביאלי. נכתב, הסכמה מדעת היה המתקבלים מתנדבים בריאים, ועדת הבדיקה מוסדיים אישור המחקר. חלק את הדגימות כבר נכללו בניתוח הקודם1.

1. מדגם טיפול

  1. אוספים כ 5 מ מ2 השמצות (בערך בגודל של מחק עיפרון) של דגימת צואה טרייה עם מקלון סטרילי במבחן צינור (ראה טבלה של חומרים). לאחסן כל דגימות המכיל דגימות צואה ב-80 מעלות צלזיוס בתוך 24 שעות. הושארו צואה יכולים להישאר שם עד עיבוד נוסף.

2. הפקת דנ א

  1. להפשיר את החילוץ ופתרונות דילול בטמפרטורת החדר (ראה טבלה של חומרים).
  2. העברת הדגימה צואה לתוך אוסף ריק mL 2 צינור (ראה טבלה של חומרים). להתאים את גודל ספוגית מקל על ידי חיתוך באמצעות מספריים נקי כדי לאפשר סגירת שפופרת עם מינימום זיהום צולב. להוסיף 250 μL של פתרון מיצוי כל שפופרת אוסף המכיל את ספוגית צואתי ואת מערבולת לערבב.
  3. מחממים את הדגימות 10 דקות באמבט מים רותחים (95-100° C). להוסיף 250 μL של דילול פתרון לכל דגימה של מערבולת לערבב.
  4. מאחסנים צינורות 2 מ"ל המכיל את ה-DNA שחולץ הדגימה ב 4 º C.

3. PCR והכנת ספריית

עבור שלבים 3.1 ו- 3.2, עובד תחנת עבודה-PCR המספק נקי, תבנית סביבה אמפליקון חינם.

  1. תווית של תחל (טבלה 1) לפי ברקוד שלהם. לדלל כל תחל במים מזוקקים כפול (DDW) ריכוז μM 50 ו החנות ב-20 ° C.
  2. להשתמש בלוח 96-ובכן לתגובות PCR. כל צלחת יכול להכיל 32 מדגמים שונים, אשר מתויגות כברירת 32 תחל אינדקס שונים. להפשיר את פריימר לפנים, את צבעי יסוד הפוך 32 בטמפרטורת החדר, לדלל אותם כדי 5 μM.
  3. היכונו PCR התגובה mixes 100 תגובות (נפח סופי בכל טוב יהיה 20 μl) על ידי ערבוב μL 100 μM 5 פריימר לפנים, מיקס מאסטר PCR X 1 מ"ל 2 ו 400 μL DDW. הכניסו μL 15 של מיקס PCR הזה מכל קידוח (סה כ 96 וולס). להוסיף 1 μL של כל פריימר באינדקס ההפוך 5 μM 3 בארות שונות (32 שונים תחל ב- triplicates נותן סך של בארות 96).
  4. בתוך אזור ייעודי טרום-PCR, כלומר ספסל נקי תבנית, אמפליקון חינם, להוסיף 4 μL של כל מדגם ה-DNA שחולץ התגובה תערובות (כל מדגם ה-DNA שחולץ מוגבר שהפקידים — 32 דגימות לכל צלחת 96-ובכן).
  5. הפעל את ה-PCR עם ההגדרות הבאות: דנטורציה הראשונית של 94 º C למשך 3 דקות; ואחריו 35 מחזורי דנטורציה ב 94 ° C עבור 1 דקות, חישול ב 55 ° C 1 דקות, סיומת ב-72 מעלות עבור 1 דקות; ועם סיומת הסופי ב-72 מעלות למשך 10 דקות.
  6. על ספסל שונים, אשר תוגדר כאזור ייעודי פוסט-PCR, לשלב את כל התגובה PCR triplicate לתוך צינור אחסון יחיד (60 μL עבור דגימה).
  7. כדי להעריך את האיכות של ה-PCR amplicons, להפעיל 4 μL של כל תגובה משולב-PCR על ג'ל שהוכתמו ברומיד agarose 1% אתידיום. מתחת UV באורך גל של 260 ננומטר, amplicons חיובי יופיעו גודל של הלהקה הצפוי של bp 375-425. רק amplicons אלה ייכלל והשלבים הבאים.
    הערה: כל מדגם מוגבר במובן triplicate, כי כל מדגם מוגבר ב- 3 תגובות PCR שונות. לא תעשה זום

4. ספריית כימות וניקוי

  1. על מנת לקבל בריכת equimolar ריכוז של כל הדגימות PCR, לכמת כל אמפליקון על ידי ה-DNA נטושים כפול (dsDNA לכמת ריאגנט) חומצת גרעין נמכרות כתם (ראה טבלה של חומרים), מתאים כימות סימולטני של גדול כמות דגימות.
    הערה: מאז הטווח בגודל אמפליקון מפוקפקת, הסכום בפועל ב ננוגרם משמש לטעינת של ריכוז equimolar.
  2. שילוב 500 ננוגרם של כל מדגם לתוך צינור יחיד, סטרילי. מערבולת לערבב.
  3. הרץ μL 200 של הספרייה במאגר ג'ל שהוכתמו אתידיום ברומיד agarose 1%. לחלץ את הלהקות bp 375-425 מ הג'ל באמצעות ערכת חילוץ ג'ל על פי הוראות היצרן (ראה טבלה של חומרים) ו elute בספריה 80 μL DDW במאגר.
    הערה: הספרייה במאגר צריך להיות בגודל שנבחר כדי לצמצם מוצרים שאינם ספציפיים הגברה מהמארח הדנ א.
  4. למדוד את הריכוז ספריית הסופי באמצעות dsDNA רגישה מאוד גילוי הערכה על פי הוראות היצרן (ראה טבלה של חומרים). למדוד את גודל הספרייה מדויק באמצעות ערכת ההפרדה וניתוח רגישות גבוהה עבור ספריות DNA על-פי הוראות היצרן (ראה טבלה של חומרים).

5. רצף

  1. לדלל במאגר הספריה עד 7 בערב עם תוספת של 20% בקרת ספרייה (ראה טבלה של חומרים), לפי הפרוטוקול המכונה רצף.
  2. עבור רצף, מותאמים אישית לשימוש שנועדו לקרוא תחל זה ללא תשלום תחל הגברה V4 (ראה טבלה 1).
  3. פריימר רצף מעוצב מותאם אישית לשימוש שלישי שקורא הברקוד ב נוספים מחזור (ראה טבלה 1) ומייצר קריאות סוף-זיווג הבסיסים 175 אורך לכל כיוון, בהתאם למפרט היצרן.
  4. להפעיל את המכונה רצף ולקבל FASTQ קבצים על פי הפרוטוקול של היצרן.

6. עיבוד נתונים

  1. . סטיץ ' יחד ולעבד את קבצי FASTQ סוף-לזווג חופפים צינור curation נתונים מיושם QIIME 2 גירסה 2017.7.017. Demultiplex את הקריאות לפי מדגם ספציפי ברקודים.
  2. השתמש DADA218 עבור זיהוי משתנה (SVs) בקרת איכות, רצף. לחתוך קריאות-13 בסיסים מקצה 3' ובסיסים 15 5' מהקצה, להשליך קורא עם יותר מ- 2 שגיאות הצפוי. לזהות ולהסיר את כימרות באמצעות שיטת הקונצנזוס — כימרות מזוהים בדגימות באופן אינדיבידואלי, רצפים נמצאו chimeric בשבריר מספיק דוגמאות של יוסרו.
  3. לבצע סיווג טקסונומי SVs באמצעות מסווג Bayes נאיבי מצויד, על אוגוסט 2013 99% זהות Greengenes מאגר6, 175 זמן של קריאות של פריימר לפנים/הפוכה להגדיר.
  4. כל הדגימות לעומק של רצפי 2,146 להעלימה.
  5. השתמש Unweighted UniFrac למדידה של β-גיוון (בין מדגם גיוון19,20) על הדגימות דליל, כדי להימנע אפקט גודל המדגם.
  6. השתמש המטריצה המתקבלת מרחק כדי לבצע ניתוח נקודות הציון העיקריות (PCoA).
    הערה: קבצי script ומיפוי עיבוד הנתונים מסופקים כחומר משלים (חומר משלים 1 ו- 2).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

איור סכמטי הפרוטוקול מוצג באיור1.

אספנו פרוספקטיבי דגימות צואה של מאושפזים חולים עם חשד שלשול זיהומיות. הדגימות הוגשו למעבדה למיקרוביולוגיה קלינית במרכז הרפואי שיבא בין פברואר מאי 2015, כפי שתואר לעיל1. דגימות צואה נחשפו לתרבות מיקרוביולוגית קונבנציונאלי שבוצעה במעבדה למיקרוביולוגיה קלינית וכדי רחב תפוקה גבוהה 16-seq במקביל. בנוסף, דגימות צואה של מבוגרים בריאים היו רציף להשוואה.

ניתוח זה, הפוקוס היה על בקרת האיכות של נתונים, וכן תוצאות נציג של הפלט המתקבל QIIME217. בתחילה, נבחנו תוצאות רצף בתאריך 6 דוגמאות שליטה שלילי עבור בקרת איכות כולל: i) PCR בלי תבנית ii) PCR על דגימות נקי וסטרילי בפתרון החילוץ, דילול, iii) PCR על הוצאה מעורבת, דילול פתרונות. בטבלה 2 מראה שיש כל שליטה שלילי דוגמאות ≤118 הכולל קריאות (ממוצע של רצפי 29), בעיקר מן taxa Mycoplasma, בעוד אחרים כל דוגמאות ניתח הראה אומר סה כ קורא של 10622.57 (שגיאת התקן ±1211.34) ולקרוא Mycoplasma אין עברו את בקרת האיכות של הדגימות הראשי.

דוגמאות 16 כי אחד מקורם צואה אותו אבל עבר הכנה בספרייה אחרת עם תחל לבר-קוד הפוכה שונים שימשו כפקדי חיובי. הדגימות 16 כלל 8 עם תרבויות חיוביות קמפילובקטר, סלמונלהאו שיגלה אשר דווחו על ידי המעבדה למיקרוביולוגיה קלינית ו- 8 זה דווחו כבעלי תרביות שליליות. מגרש שטח ברמת phyla מוצג באיור2. דוגמאות מקורם צואה אותו, אך עבר בספרייה אחרת הכנה לבר-קוד הפוכה שונים תחל להראות עקבי מאוד יחסית שפע (מבחן מדף בין כפילויות השפע היחסי בטקסונומיה רמת מערכה ערכים מדומה ערך-p = עונה 1 פרק 10-04 בהתבסס על משכפל 9999).

ניתוח נקודות הציון העיקריות (PCoA), אשר מפחית-ממדיות של נתוני הקלט, שימש על המטריצה UniFrac לחקור באופן חזותי מדגם ההפרדה ואת הדמיון. ב- איור 3A, דגימות ברצף שמקורם באותה דגימת זרע המקורי שרפרף אך עבר הכנה בספרייה אחרת צבעוניים אותו ואכן, אלה מצויים יחסית מקרוב בעלילה PCoA (האח מבחן בין כפילויות PC1 PC2 ערכים מדומה ערך-p = 1e-04 בהתבסס על משכפל 9999). בנוסף, המרחק גיוון בטא unifrac unweighted הממוצע בין דגימות במחקר זה הוא 0.706, ואילו המרחק הממוצע בין שני כפילויות הוא 0.235 (סכום דרגה Wilcoxon לבדוק ערך-p = 4.205 x 10-11). מעניין, דגימות שהיו תרבות חיובי עבור קמפילובקטר, סלמונלהאו שיגלה enteropathogens הראו ערכי PC1 שונה באופן משמעותי (סכום דרגה Wilcoxon לבדוק ערך-p = 0.011) לעומת דגימות עם תוצאות שליליות תרבות. איור 3B מציגה עלילה PCoA זהה אך עכשיו דוגמאות הן צבעוניות על ידי שפע יחסי של פרוטאובקטריה. בדגימות עם שפע פרוטאובקטריה גבוהה היה שונה באופן משמעותי PC1 ערכים (מתאם ספירמן r =-0.533, ערך-p = 0.000975). תוצאות אלה עקביים עם ניתוח קודמות של נתונים אלה, שבו מאושפזים יש עליות עמוקה ב taxa מפרוטאובקטריה מערכה1. כאן הראינו כי PC1 הוא מתואם עם שפע פרוטאובקטריה, עם דוגמאות חיוביות התרבות קיבוץ באשכולות בעיקר בצד אחד של PC1 ציר ותרבות שלילי הדגימות קיבוץ באשכולות בעיקר בצד השני, יחד עם הדגימות בריא.

Figure 1
איור 1 : תרשים זרימה של דגימות צואה לשפע מיקרוביאלי יחסית. 1) טיפול לדוגמה: שמאל, דגימות צואה נאספים בשפופרת ספוגית סטרילית. . נכון, גודל מקל אוזניים מותאמת על ידי חיתוך זה כדי לאפשר סגירת שפופרת 2 מ"ל ואחסון. 2) הפקת דנ א: ה-DNA מופק על ידי גישה נטולת עמודות ה-PCR ישירה. 3) ספריית הכנה: שמאל, μL 4 של ה-DNA שחולץ מוגבר עם קדימה/הפוכה-אינדקס תחל. פריימר הפוכה כל מכיל ברקוד בסיס 12. כל מדגם מוגבר דולר. צלחת 96-ובכן מכיל 32 ברקודים שונים. נכון, לשלב כל ברקוד triplicate לתוך צינור אחסון יחיד. צלחת 96-ובכן מכיל 96 ברקודים שונים. 4) ספריית כמת: החלונית העליונה, הקרנת עבור דגימות חיוביות, amplicons אותרו על ג'ל שהוכתמו אתידיום ברומיד agarose 1%. פאנל התחתונה, כימות amplicons חיובי כדי להגיע equimolar ריכוז אמפליקון ng 500 מ כל מדגם לתוך בריכה בספריה מסוימת. 5) ספריית טיהור: החלונית העליונה, ספריית במאגר היא ג'ל שחולצו עבור בחירת גודל והיטהרות. בחלונית התחתונה, גודל מדויק הספרייה הריכוז נמדד. 6) רצף: תפוקה גבוהה רצף של הספרייה במאגר. 7) ניתוח המידע רצף על ידי צינור bioinformatic עבור מטוסי אף-16 rRNA-אמפליקון אקולוגיה מיקרוביאלית. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 2
איור 2 : שפע יחסית עקבית בין דגימות שמקורם צואה באותה דגימת זרע, אך עבר הכנה בספרייה אחרת. השפע היחסי בטקסונומיה ברמת מערכה מוצג עבור דגימה כמצוין. השפע היחסי מוצג עבור 16 דגימות צואה המתקבל חולים מאושפזים עם שלשול זיהומיות חשד כי אחד עבר הכנה בספרייה אחרת (כפולים 1 ו- 2) עם תחל שונים לבר-קוד הפוכה, של פקדים בריא 3. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 3
איור 3 : גיוון פילוגנטי להראות תוצאות עקביות עבור דגימות שמקורם צואה באותה דגימת זרע, אך עבר הכנה בספרייה אחרת. ניתוח נקודות הציון העיקריות (PCoA) המפחיתה-ממדיות של נתוני הקלט שימש על המטריצה UniFrac לחקור באופן חזותי מדגם ההפרדה ואת הדמיון. המרחק בין שני מדגמים מייצגת את ההבדל בהרכב microbiome שלהם. מגרש UniFrac PCoA Unweighted (א). כל נקודה מייצגת דוגמה אחת ברצף. דוגמאות מקורם של צואה המקורית באותו צבעוניים אותו דגימות מחולים מאושפזים עם התרבות צואה חיוביים שדווחו על-ידי ה מיקרוביולוגיה קלינית1 שסומנו על-ידי ריבועים, חולים מאושפזים עם התרבות שלילית אצל משולשים1, ומבוגרים בריאים מריצה רצף נפרד1 מסומנים עם מלא במעגלים. (B) PCoA אותו כמו A, אך דוגמאות עכשיו צבעוניים על ידי שלהם שפע יחסי של פרוטאובקטריה, כמצוין. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

פריימר שם פריימר רצף תיאור פריימר
פריימר לפנים AATGATACGGCGACCACCGAGATCTACAC - TATGGTAATT - GT - GTGCCAGCMGCCGCGGTAA 5' מתאם רצף - pad פריימר לפנים - קדימה מקשר פריימר - פריימר לפנים
הפוך אינדקס פריימר CAAGCAGAAGACGGCATACGAGAT - CC. תודה על הטרמפ - AGTCAGTCAG - - GACTACHVGGGTWTCTAAT הפוך המשלים של 3' מתאם רצף - ברקוד Golay - פריימר הפוכה pad - מקשר פריימר הפוכה - הפוכה פריימר
1 קריאה רצף פריימר TATGGTAATT - GT - GTGCCAGCMGCCGCGGTAA להעביר משטח פריימר - קדימה מקשר פריימר - פריימר לפנים
פריימר רצף קריאה 2 AGTCAGTCAG - CC - GGACTACHVGGGTWTCTAAT הפוך פריימר pad - מקשר פריימר הפוכה - פריימר הפוכה
אינדקס רצף פריימר ATTAGAWACCCBDGTAGTCC - GG - CTGACTGACT הפוך המשלים של פריימר הפוכה - הפוכה המשלים של מקשר פריימר הפוכה - המשלים הפוכה של משטח פריימר הפוכה

טבלה 1: רשימת פריימר.

מדגם מספר קריאות פוסט
בקרת איכות הראשונית ב
QIIME
PCR-מטליות נקי בפתרון החילוץ, דילול-1 118
PCR-מטליות נקי בפתרון החילוץ, דילול-2 39
PCR בלי תבנית-1 0
PCR בלי תבנית-2 0
PCR על שילוב פתרונות חילוץ, דילול - 1 16
PCR על שילוב פתרונות חילוץ, דילול - 2 0
דוגמאות (זאת אומרת ± תקן שגיאה) 10622.57 ± 1211.34

טבלה 2: מספר קריאות עבור פקדים שלילי, דגימות צואה.

1 חומר משלים: עיבוד נתונים script. אנא לחץ כאן כדי להוריד את הקובץ.

2 חומר משלים: מיפוי קובץ. אנא לחץ כאן כדי להוריד את הקובץ.

3 חומר משלים: ערכת פריימר. אנא לחץ כאן כדי להוריד את הקובץ.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

מטוסי אף-16 rRNA-אמפליקון ורצף רובה metagenomics צברו פופולריות ב מיקרוביולוגיה קלינית יישומים21,22,23. טכניקות אלה הן יתרון ביכולת מוגברת שלהם לכידת taxa culturable ו- culturable, המספק נתונים אודות שפע יחסי של inoculum פתוגניים, ואת יכולתם לזהות ביתר דיוק זיהומיות polymicrobial טביעות אצבע של24. ההתקדמות בתחום של מחקר microbiome יצרו כמויות אדירות של נתונים שאינם השוואה בקלות עקב חוסר עקביות הגישות השונות. בשנים האחרונות, מספר מהמגזר ניסו להתמודד עם בעיות אלה. פרוטוקול זה עוקב אחר הכנת ספריה דומה כפרוייקט microbiome כדור הארץ (EMP). אולם, הוסיף הוא פרוטוקול מפורט שלב אחר שלב להפקת DNA של דגימות צואה דרך צינור ניתוחים.

בעבר, מטוסי אף-16 rRNA רצף שימש לאפיין את הדפוסים קומפוזיציה מיקרוביאלית של דגימות צואה לנסיינים בריאים שאינם מאושפזים, חולים מאושפזים עם חשד שלשול זיהומיות, התרבות המסורתית לתוצאות. התוצאות של ניתוח זה הראה כי חולים מאושפזים יש עליות עמוקה ב taxa מפרוטאובקטריה מערכה1. המתוארים כאן הוא פרוטוקול משולב של שיטות שימוש בהרחבה עבור מטוסי אף-16 rRNA ג'ין אמפליקון רצף באמצעות PCR ללא עמודות ישיר זה תוכנן במקור עבור מיצוי של הצמח דנ א16. גישה זו ניתן ביעילות, במהירות לחלץ באיכות טובה מוגבר-DNA ספריות פילוח האזור משתנה V4 של הגן rRNA מטוסי אף-16 מ מספר רב של דוגמאות מתאים תפוקה גבוהה מטוסי אף-16 rRNA רצף.

כמו זו היא שיטה המבוססת על ה-DNA רצף, מתקבלים נתונים על aerobes והן anaerobes מיקרוביאלי קהילות נוכח דוגמה צואה בודדים. הפרוטוקול אימצה את תחל שהיו במקור תוכנן15 נגד האזור V4 של הגן rRNA מטוסי אף-16. חשוב, ומהצמיגים הגברה הפוכה להכיל רצף 12 ברקוד בסיס תומך באגירת דוגמאות שונות עד 2,167 כל ליין15. פריימר לפנים הגברה כוללת תשעה עוד בסיסים באזור מתאם התומכים לזווג-קצה הרצף על רצף פלטפורמה25 (טבלה 1 ו- 3 חומר משלים). גישה זו זמינה טיפול ספריה מורכבת 250 דגימות צואה היו וסודרו ליין אחד עם עומק המצטבר של 10622.57 ± 1211.34 (זאת אומרת ± תקן שגיאה) קריאות עבור דגימה בעלות של ~ 30 דולר לכל דגימה.

כדי להבטיח בקרת איכות, אנו ממליצים להשתמש שלילי הפקדים הבאים; i) PCR בלי תבנית ה-DNA, ii) PCR על ה-DNA מופק ספוגית סטרילית נקי ו- iii) PCR על מעורבות החילוץ פתרון דילול. עבור פקדים חיובית, אנו ממליצים כולל דוגמאות שמקורם צואה באותה דגימת זרע, אך עבר הכנה בספרייה אחרת עם תחל לבר-קוד הפוכה שונים ודוגמאות מן הקודם פועל כמו בקרת איכות פנימית. ראוי לציין, פקדים אחרים חיובי אופציונלי כדי לשמש הן את הסטנדרטים מדידה microbiome הללו, שסופקו על-ידי NIST. הממוצע קורא כיסוי עבור הפקדים שלילי נמוך במידה ניכרת לעומת דגימות צואה בפועל (טבלה 1) וכללה בעיקר מ taxa Mycoplasma. הראנו נוסף לשיפור העקביות של רצף התוצאות המתקבלות באמצעות דגימות אחד שמקורם באותו חומר צואתי, אך זה עבר הכנה בספרייה אחרת (איור 3). תוצאה זו גם מאשרת כי, כאשר משתמשים בשיטה המשולבת שלנו, יש אין זיהום צולב בין דגימות.

ב פרוטוקול זה נסקור פרוטוקול משולב במדים, ריאלי לנתח מספר רב של דוגמאות. פרוטוקול זה שמטרתו להדריך מדענים מעוניין ליזום את השימוש מטוסי אף-16 rRNA-אמפליקון רצף בצורה איתנה, הרבייה, קל לשימוש, זול, מפורט מתוך אוסף צואה כדי ניתוח נתונים, באמצעות פקדי חשוב. באמצעות פרוטוקול מודרך מפורט מתוקננת זה, ייתכן למזער תופעות אצווה ומאפשרים תוצאות דומות יותר רצף בין מעבדות שונות.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

המחברים אין לחשוף.

Acknowledgments

עבודה זו נתמך בחלקה על ידי התוכנית-CORE (מעניקה מס 41/11), הקרן הלאומית למדע (גרנט מס 908/15), ואת אירופה קרוהן קוליטיס הארגון (ECCO).

Materials

Name Company Catalog Number Comments
Primers Integrated DNA Technologies (IDT)
Extraction solution Sigma-Aldrich E7526
Dilution solution Sigma-Aldrich D5688
Kapa HiFi HotStart ReadyMix PCR Kit KAPABIOSYSTEMS KK2601 PCR Master mix
Quant-iT PicoGreen dsDNA Reagent kit Invitrogen P7589 dsDNA quantify reagent
MinElute Gel extraction kit Qiagen 28606
Agarose Amresco 0710-250G
Ultra Pure Water Dnase and Rnase Free Biological Industries 01-866-1A
Qubit dsDNA HS assay kit Molecular probes Q32854 dsDNA detecting kit
High Sensitivity D1000 Agilent Technologies Screen Tape 5067-5582 separation and analysis
Screen Tape Assay Agilent Technologies Reagents 5067-5583 for DNA libraries
PhiX Control v3 Illumina 15017666 control library
MiSeq Reagent Kit v2 (500 cycle) Illumina MS-102-2003
Ethidium Bromide Amresco E406-10mL-TAM
2 mL collection tubes SARSTEDT 72.695.400 Safe Seal collection tubes
Plastic stick swab in PP test tube STERILE INTERIOR 23117
Name Company Catalog Number Comments
Equipment
PCR Machine Applied Biosystems 2720 Thermal Cycler
Sequncing Machine Illumina Miseq
PCR workstation Biosan UV-cleaner
scissors
vortexer Scientific Industries Vortex-Genie 2

DOWNLOAD MATERIALS LIST

References

  1. Braun, T., et al. Fecal microbial characterization of hospitalized patients with suspected infectious diarrhea shows significant dysbiosis. Scientific Reports. 7, 1088 (2017).
  2. De Filippo, C., et al. Impact of diet in shaping gut microbiota revealed by a comparative study in children from Europe and rural Africa. Proceedings of the National Academy of Sciences of the United States of America. 107, 14691-14696 (2010).
  3. Yatsunenko, T., et al. Human gut microbiome viewed across age and geography. Nature. 486, 222-227 (2012).
  4. Rodriguez, J. M., et al. The composition of the gut microbiota throughout life, with an emphasis on early life. Microbial Ecology in Health and Disease. 26, 26050 (2015).
  5. Turnbaugh, P. J., et al. An obesity-associated gut microbiome with increased capacity for energy harvest. Nature. 444, 1027-1031 (2006).
  6. McDonald, D., et al. An improved Greengenes taxonomy with explicit ranks for ecological and evolutionary analyses of bacteria and archaea. The ISME Journal. 6, 610-618 (2012).
  7. Bakken, J. S., et al. Treating Clostridium difficile infection with fecal microbiota transplantation. Clinical Gastroenterology and Hepatology. 9, 1044-1049 (2011).
  8. Khoruts, A., Dicksved, J., Jansson, J. K., Sadowsky, M. J. Changes in the composition of the human fecal microbiome after bacteriotherapy for recurrent Clostridium difficile-associated diarrhea. Journal of Clinical Gastroenterology. 44, 354-360 (2010).
  9. Nood, E. V., et al. Duodenal infusion of donor feces for recurrent Clostridium difficile. The New England Journal of Medicine. 368, 407-415 (2013).
  10. Koplan, J. P., Benfari Ferraro, M. J., Fineberg, H. V., Rosenberg, M. L. Value of stool cultures. The Lancet. 316, 413-416 (1980).
  11. Platts-Mills, J. A., Liu, J., Houpt, E. R. New concepts in diagnostics for infectious diarrhea. Mucosal Immunology. 6, 876-885 (2013).
  12. Bokulich, N. A., et al. Quality-filtering vastly improves diversity estimates from Illumina amplicon sequencing. Nature Methods. 10, 57-59 (2013).
  13. Leek, J. T., et al. Tackling the widespread and critical impact of batch effects in high-throughput data. Nature Reviews Genetics. 11, (2010).
  14. Dubilier, N., McFall-Ngai, M., Zhao, L. Create a global microbiome effort. Nature. 526, 631-634 (2015).
  15. Caporaso, J. G., et al. Global patterns of 16S rRNA diversity at a depth of millions of sequences per sample. PNAS. 108, 4516-4522 (2011).
  16. Flores, G. E., Henley, J. B., Fierer, N. A direct PCR approach to accelerate analyses of human-associated microbial communities. PloS One. 7, (2012).
  17. Caporaso, J. G., et al. QIIME allows analysis of high-throughput community sequencing data. Nature Methods. 7, 335-336 (2010).
  18. Callahan, B. J., et al. DADA2: High-resolution sample inference from Illumina amplicon data. Nature Methods. 13, 581-583 (2016).
  19. Lozupone, C., Knight, R. UniFrac: A new phylogenetic method for comparing microbial communities. Applied and Environmental Microbiology. 71, 8228-8235 (2005).
  20. Lozupone, C., Lladser, M. E., Knights, D., Stombaugh, J., Knight, R. UniFrac: An effective distance metric for microbial community comparison. The ISME Journal. 5, 169-172 (2011).
  21. Srinivasan, R., et al. Use of 16S rRNA gene for identification of a broad range of clinically relevant bacterial pathogens. PloS One. 10, e0117617 (2015).
  22. Hiergeist, A., Gläsner, J., Reischl, U., Gessner, A. Analyses of intestinal microbiota: culture versus sequencing. ILAR Journal. 56, 228-240 (2015).
  23. Didelot, X., Bowden, R., Wilson, D. J., Peto, T. E. A., Crook, D. W. Transforming clinical microbiology with bacterial genome sequencing. Nature Reviews Genetics. 13, 601-612 (2012).
  24. Salipante, S. J., et al. Rapid 16S rRNA next-generation sequencing of polymicrobial clinical samples for diagnosis of complex bacterial infections. PloS One. 8, e65226 (2013).
  25. Caporaso, J. G., et al. Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms. The ISME Journal. 6, 1621-1624 (2012).
פרוטוקול מודרך לקבלת צואה אפיון חיידקים על ידי מטוסי אף-16 rRNA-אמפליקון רצף
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Di Segni, A., Braun, T., BenShoshan, M., Farage Barhom, S., Glick Saar, E., Cesarkas, K., Squires, J. E., Keller, N., Haberman, Y. Guided Protocol for Fecal Microbial Characterization by 16S rRNA-Amplicon Sequencing. J. Vis. Exp. (133), e56845, doi:10.3791/56845 (2018).More

Di Segni, A., Braun, T., BenShoshan, M., Farage Barhom, S., Glick Saar, E., Cesarkas, K., Squires, J. E., Keller, N., Haberman, Y. Guided Protocol for Fecal Microbial Characterization by 16S rRNA-Amplicon Sequencing. J. Vis. Exp. (133), e56845, doi:10.3791/56845 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter